diff --git a/tasks/README.md b/tasks/README.md index b8ef8890a..6b60d3586 100644 --- a/tasks/README.md +++ b/tasks/README.md @@ -1509,4 +1509,8 @@ Name | Summary | Category | Domain | Input Language | Output Language `task1582_bless_hypernym_generation` | Given a concept word, generate a hypernym for it | Answer Generation `task1583_bless_meronym_classification` | Given an object and a part, decide whether the object has that part | Classification `task1584_evalution_meronym_classification` | Given an object and a part, decide whether the object has that part | Classification -`task1585_root09_hypernym_generation` | Given a concept word, generate a hypernym for it | Answer Generation \ No newline at end of file +`task1585_root09_hypernym_generation` | Given a concept word, generate a hypernym for it | Answer Generation +`task1699_jnlpba_entity_classification` | Classifying entities (based on jnlpba) | Entity Classification +`task1700_jnlpba_entity_counting` | Counting the bio entities in jnlpba | Count Generation +`task1701_bn_hate_speech_machine_translation` | Translation of records in bn_hate_speech | Machine Translation +`task1702_bn_hate_speech_news_category_classification` | Classifying the news into 5 categories | News Classification diff --git a/tasks/task1699_jnlpba_entity_classification.json b/tasks/task1699_jnlpba_entity_classification.json new file mode 100644 index 000000000..f27d62758 --- /dev/null +++ b/tasks/task1699_jnlpba_entity_classification.json @@ -0,0 +1,12015 @@ +{ + "Contributors": [ + "Sagar Rudagi" + ], + "Source": [ + " JNLPBA (https://huggingface.co/datasets/jnlpba)" + ], + "Input_language": [ + "English" + ], + "Output_language": [ + "English" + ], + "Instruction_language": [ + "English" + ], + "Categories": [ + "Entity Classification" + ], + "Definition": "In this task, a sequence of tokens is provided and you need to classify each token as '0','1', or '2' where '0' corresponds to Non-bio entity, '1' to Bio entity start token, and '2' to Subsequent bio entity tokens. Each word in the sentence is called a token.", + "Positive Examples": [ + { + "input": "IL - 2 gene expression and NF - kappa B activation through CD28 requires reactive oxygen production by 5 - lipoxygenase .", + "output": "1222001222001000001220", + "explanation": "This is a good example. All the tokens are classified in a list." + }, + { + "input": "Activation of the CD28 surface receptor provides a major costimulatory signal for T cell activation resulting in enhanced production of interleukin - 2 ( IL - 2 ) and cell proliferation .", + "output": "00012200000000000000122012200000", + "explanation": "This is a good example. All the tokens are correctly classified and the length of tokens and classified tokens matches." + }, + { + "input": "In primary T lymphocytes we show that CD28 ligation leads to the rapid intracellular formation of reactive oxygen intermediates ( ROIs ) which are required for CD28 - mediated activation of the NF - kappa B / CD28 - responsive complex and IL - 2 expression .", + "output": "00000001000000000000000000100000122201222012200", + "explanation": "This is a good example. All the tokens are classified correctly." + } + ], + "Negative Examples": [ + { + "input": "Delineation of the CD28 signaling cascade was found to involve protein tyrosine kinase activity , followed by the activation of phospholipase A2 and 5 - lipoxygenase .", + "output": "0001000000122000000012012", + "explanation": "This is a bad example. The length of tokens and the length of classified tokens don't match." + }, + { + "input": "These findings should be useful for therapeutic strategies and the development of immunosuppressants targeting the CD28 costimulatory pathway .", + "output": "0000000000000000000", + "explanation": "This is a bad example. CD28 is a bio entity but is classified as a non-bio entity." + }, + { + "input": "The peri - kappa B site mediates human immunodeficiency virus type 2 enhancer activation in monocytes but not in T cells .", + "output": "0222220122222000000000", + "explanation": "This is a bad example. Second token is classified as 2. There cannot be subsequent bio entities(2) without the starting entity(1)." + } + ], + "Instances": [ + { + "input": "HIV - 1 and HIV - 2 display significant differences in nucleic acid sequence and in the natural history of clinical disease .", + "output": [ + "00000000000000000000000" + ] + }, + { + "input": "Consistent with these differences , we have previously demonstrated that the enhancer / promoter region of HIV - 2 functions quite differently from that of HIV - 1 .", + "output": [ + "00000000000122200000000000000" + ] + }, + { + "input": "Whereas activation of the HIV - 1 enhancer following T - cell stimulation is mediated largely through binding of the transcription factor NF - kappa B to two adjacent kappa B sites in the HIV - 1 long terminal repeat , activation of the HIV - 2 enhancer in monocytes and T cells is dependent on four cis - acting elements : a single kappa B site , two purine - rich binding sites , PuB1 and PuB2 , and a pets site .", + "output": [ + "000012220000000000001212220001220012222200001222000000000122200012200122220101000120" + ] + }, + { + "input": "We have now identified a novel cis - acting element within the HIV - 2 enhancer , immediately upstream of the kappa B site , designated peri - kappa B .", + "output": [ + "0000001222001222000001220012220" + ] + }, + { + "input": "This site is conserved among isolates of HIV - 2 and the closely related simian immunodeficiency virus , and transfection assays show this site to mediate HIV - 2 enhancer activation following stimulation of monocytic but not T - cell lines .", + "output": [ + "000000000000000000000000001222000000000000" + ] + }, + { + "input": "Further , while specific constitutive binding to the peri - kappa B site is seen in monocytes , stimulation with phorbol esters induces additional , specific binding .", + "output": [ + "0000000012222000000000000000" + ] + }, + { + "input": "E1A gene expression induces susceptibility to killing by NK cells following immortalization but not adenovirus infection of human cells .", + "output": [ + "12000000000000000000" + ] + }, + { + "input": "Adenovirus ( Ad ) infection and E1A transfection were used to model changes in susceptibility to NK cell killing caused by transient vs stable E1A expression in human cells .", + "output": [ + "000000100000000000000000100000" + ] + }, + { + "input": "Only stably transfected target cells exhibited cytolytic susceptibility , despite expression of equivalent levels of E1A proteins in Ad - infected targets .", + "output": [ + "00000000000000012000000" + ] + }, + { + "input": "The inability of E1A gene products to induce cytolytic susceptibility during infection was not explained by an inhibitory effect of viral infection on otherwise susceptible target cells or by viral gene effects on class I MHC antigen expression on target cells .", + "output": [ + "000120000000000000000000000001200122200000" + ] + }, + { + "input": "This differential effect of E1A expression on the cytolytic phenotypes of infected and stably transfected human cells suggests that human NK cells provide an effective immunologic barrier against the in vivo survival and neoplastic progression of E1A - immortalized cells that may emerge from the reservoir of persistently infected cells in the human host .", + "output": [ + "0000100000000000000000000000000000000000000000000000000" + ] + }, + { + "input": "The CD4 coreceptor interacts with non - polymorphic regions of major histocompatibility complex class II molecules on antigen - presenting cells and contributes to T cell activation .", + "output": [ + "0120012220122222000000000000" + ] + }, + { + "input": "We have investigated the effect of CD4 triggering on T cell activating signals in a lymphoma model using monoclonal antibodies ( mAb ) which recognize different CD4 epitopes .", + "output": [ + "00000010000000000012010000120" + ] + }, + { + "input": "We demonstrate that CD4 triggering delivers signals capable of activating the NF - AT transcription factor which is required for interleukin - 2 gene expression .", + "output": [ + "00010000000122220000122000" + ] + }, + { + "input": "Lack of full activation of NF - AT could be correlated to a dramatically reduced capacity to induce calcium flux and could be complemented with a calcium ionophore .", + "output": [ + "00000122000000000000000000000" + ] + }, + { + "input": "The results identify functionally distinct epitopes on the CD4 coreceptor involved in activation of the Ras / protein kinase C and calcium pathways .", + "output": [ + "000001001200000122220000" + ] + }, + { + "input": "Ligand - dependent repression of the erythroid transcription factor GATA - 1 by the estrogen receptor .", + "output": [ + "00000012212200120" + ] + }, + { + "input": "High - dose estrogen administration induces anemia in mammals .", + "output": [ + "0000000000" + ] + }, + { + "input": "In chickens , estrogens stimulate outgrowth of bone marrow - derived erythroid progenitor cells and delay their maturation .", + "output": [ + "0000000000000000000" + ] + }, + { + "input": "This delay is associated with down - regulation of many erythroid cell - specific genes , including alpha - and beta - globin , band 3 , band 4 . 1 , and the erythroid cell - specific histone H5 .", + "output": [ + "00000000001222200122222000000000001222210" + ] + }, + { + "input": "We show here that estrogens also reduce the number of erythroid progenitor cells in primary human bone marrow cultures .", + "output": [ + "00000000000000000000" + ] + }, + { + "input": "We demonstrate that the transcriptional activity of GATA - 1 is strongly repressed by the estrogen receptor ( ER ) in a ligand - dependent manner and that this repression is reversible in the presence of 4 - hydroxytamoxifen .", + "output": [ + "0000000122000001201000000000000000000000" + ] + }, + { + "input": "GATA - 1 and ER bind to each other in vitro in the absence of DNA .", + "output": [ + "12201000000000000" + ] + }, + { + "input": "Mapping experiments indicate that GATA - 1 and the ER form at least two contacts , which involve the finger region and the N - terminal activation domain of GATA - 1 .", + "output": [ + "000012200100000000000001222201220" + ] + }, + { + "input": "We speculate that estrogens exert effects on erythropoiesis by modulating GATA - 1 activity through protein - protein interaction with the ER .", + "output": [ + "00000000001220000000010" + ] + }, + { + "input": "Mouse interleukin - 2 receptor alpha gene expression .", + "output": [ + "122222200" + ] + }, + { + "input": "Interleukin - 1 and interleukin - 2 control transcription via distinct cis - acting elements .", + "output": [ + "1220122000012220" + ] + }, + { + "input": "We have shown that interleukin - 1 ( IL - 1 ) and IL - 2 control IL - 2 receptor alpha ( IL - 2R alpha ) gene transcription in CD4 - CD8 - murine T lymphocyte precursors .", + "output": [ + "0000122012200122012222222222200000000000" + ] + }, + { + "input": "Here we map the cis - acting elements that mediate interleukin responsiveness of the mouse IL - 2R alpha gene using a thymic lymphoma - derived hybridoma ( PC60 ) .", + "output": [ + "0000122200000012222200000000000" + ] + }, + { + "input": "IL - 1 induces a rapid , protein synthesis - independent appearance of IL - 2R alpha mRNA that is blocked by inhibitors of NF - kappa B activation .", + "output": [ + "122000000000012222000000122200" + ] + }, + { + "input": "This segment functions as an IL - 2 - inducible enhancer and lies within a region that becomes DNase I hypersensitive in normal T cells in which IL - 2R alpha expression has been induced .", + "output": [ + "000001222220000000120000000122200000" + ] + }, + { + "input": "IL - 2 responsiveness requires three distinct elements within the enhancer .", + "output": [ + "122000010010" + ] + }, + { + "input": "Two of these are potential binding sites for STAT proteins .", + "output": [ + "00000000120" + ] + }, + { + "input": "Hematopoietic lineage commitment : role of transcription factors .", + "output": [ + "000000120" + ] + }, + { + "input": "This review focuses on the roles of transcription factors in hematopoietic lineage commitment .", + "output": [ + "00000001200000" + ] + }, + { + "input": "A brief introduction to lineage commitment and asymmetric cell division is followed by a discussion of several methods used to identify transcription factors important in specifying hematopoietic cell types .", + "output": [ + "000000000000000000000120000000" + ] + }, + { + "input": "Next is presented a discussion of the use of embryonic stem cells in the analysis of hematopoietic gene expression and the use of targeted gene disruption to analyze the role of transcription factors in hematopoiesis .", + "output": [ + "000000000000000012000000000000012000" + ] + }, + { + "input": "Finally , the status of our current knowledge concerning the roles of transcription factors in the commitment to erythroid , myeloid and lymphoid cell types is summarized .", + "output": [ + "0000000000001200000000000000" + ] + }, + { + "input": "Epstein - Barr virus replicative gene transcription during de novo infection of human thymocytes : simultaneous early expression of BZLF - 1 and its repressor RAZ .", + "output": [ + "000000000000000000012200010" + ] + }, + { + "input": "We and others have shown that EBV can also infect a subset of thymocytes .", + "output": [ + "000000000000000" + ] + }, + { + "input": "Infection of thymocytes was accompanied by the appearance of linear EBV genome within 8 hr of infection .", + "output": [ + "000000000122000000" + ] + }, + { + "input": "Circularization of the EBV genome was not detected .", + "output": [ + "000120000" + ] + }, + { + "input": "This is in contrast to the infection in B cells where the genome can circularize within 24 hr of infection .", + "output": [ + "000000000000000000000" + ] + }, + { + "input": "The appearance of a novel fusion transcript ( RAZ ) , which comprised regions of the BZLF - 1 locus and the adjacent BRLF - 1 locus , was detected by RT - PCR .", + "output": [ + "00000120100000001222000122200000000" + ] + }, + { + "input": "ZEBRA protein was also identified in infected thymocytes by immunoprecipitation .", + "output": [ + "12000000000" + ] + }, + { + "input": "In addition , we demonstrated that the EBNA - 1 gene in infected thymocytes was transcribed from the Fp promoter , rather than from the Cp / Wp promoter which is used in latently infected B cells .", + "output": [ + "00000001222000000012000001222000000000" + ] + }, + { + "input": "These observations suggest that de novo EBV infection of thymocytes differs from infection of B cells .", + "output": [ + "00000000000000000" + ] + }, + { + "input": "Identification and purification of human Stat proteins activated in response to interleukin - 2 .", + "output": [ + "000012200001220" + ] + }, + { + "input": "A key cytokine induced during the immune response is IL - 2 .", + "output": [ + "0010000001220" + ] + }, + { + "input": "Following T cell activation , the genes encoding IL - 2 and the various chains of its receptor are transcriptionally induced .", + "output": [ + "0000000012200000000000" + ] + }, + { + "input": "In turn , secreted IL - 2 serves to stimulate the proliferation and differentiation of T lymphocytes .", + "output": [ + "000012200000000000" + ] + }, + { + "input": "Following this lead , we set out to identify transcription factors induced in response to IL - 2 .", + "output": [ + "0000000001200001220" + ] + }, + { + "input": "Human peripheral blood lymphocytes were observed to contain several IL - 2 - inducible DNA binding activities .", + "output": [ + "000000000122000000" + ] + }, + { + "input": "Similar activities were also observed in a transformed human lymphocyte line , termed YT .", + "output": [ + "000000000000000" + ] + }, + { + "input": "We have purified these activities and found that the principal IL - 2 - inducible component bears significant relatedness to a prolactin - induced transcription factor first identified in sheep mammary gland tissue .", + "output": [ + "0000000000122222000001222200000000" + ] + }, + { + "input": "We hypothesize that activation of this protein , designated hStat5 , helps govern the biological effects of IL - 2 during the immune response .", + "output": [ + "0000000001000000012200000" + ] + }, + { + "input": "E2F - 1 and a cyclin - like DNA repair enzyme , uracil - DNA glycosylase , provide evidence for an autoregulatory mechanism for transcription .", + "output": [ + "12200122222012220000000000" + ] + }, + { + "input": "The cell cycle - dependent transcription factor , E2F - 1 , regulates the cyclin - like species of the DNA repair enzyme uracil - DNA glycosylase ( UDG ) gene in human osteosarcoma ( Saos - 2 ) cells .", + "output": [ + "01222220122000100000122122222220000000000" + ] + }, + { + "input": "The major putative downstream site for E2F , located in the first exon , serves as a target for E2F - 1 / DP1 complex binding in vitro .", + "output": [ + "01222010000120000001222220000" + ] + }, + { + "input": "We also provide evidence for the functional relationship between the cyclin - like UDG gene product and E2F .", + "output": [ + "0000000000122222010" + ] + }, + { + "input": "High levels of UDG expression in a transient transfection assay result in the down - regulation of transcriptional activity through elements specific for E2F - mediated transcription .", + "output": [ + "0001000000000000000010010000" + ] + }, + { + "input": "This hypothetical model integrates one mechanism of DNA repair with the cell cycle control of gene transcription , likely through E2F .", + "output": [ + "0000000000000000000010" + ] + }, + { + "input": "This implicates E2F as a multifunctional target for proteins and enzymes , possibly , responsive to DNA damage through the negative effect of UDG on E2F - mediated transcriptional activity .", + "output": [ + "0010000000000000000000010100000" + ] + }, + { + "input": "Interferon - gamma ( IFN - gamma ) is an important immunoregulatory protein produced predominantly by T cells and large granular lymphocytes ( LGL ) in response to different extracellular signals .", + "output": [ + "12201220000120000000000000000000" + ] + }, + { + "input": "In particular , two interleukins ( ILs ) , IL - 2 and IL - 12 , have been shown to be potent inducers of IFN - gamma gene expression in both T cells and LGL .", + "output": [ + "0000101001220122000000000122000000000" + ] + }, + { + "input": "Although it has been reported that there are some T cell lines that produce IFN - gamma in response to IL - 2 and IL - 12 stimulation , there has as yet been no report of a natural killer ( NK ) cell line that responds in a similar manner .", + "output": [ + "0000000000000012200000000000000000000000000000000000" + ] + }, + { + "input": "In this report we present evidence that the cell line NK3 . 3 derived from human NK cells , responds to both IL - 2 and IL - 12 , as measured by increases in IFN - gamma and granulocyte - macrophage colony - stimulating factor ( GM - CSF ) cytoplasmic mRNA and protein expression .", + "output": [ + "000000000000000000000012201220000001220122222201220000000" + ] + }, + { + "input": "The results suggest that activation of protein kinase C , but not new protein synthesis , is required for IL - 2 induction of IFN - gamma and GM - CSF cytoplasmic mRNA .", + "output": [ + "0000001220000000000122001222222220" + ] + }, + { + "input": "In contrast , IL - 12 induction of IFN - gamma cytoplasmic mRNA appears to only partially depend on activation of protein kinase C .", + "output": [ + "0001220012222000000001220" + ] + }, + { + "input": "Furthermore , both transforming growth factor - beta and genistein , a tyrosine kinase inhibitor , could suppress IL - 2 and IL - 12 signaling but CsA was generally inactive .", + "output": [ + "00012222000000000012201220000000" + ] + }, + { + "input": "It also was observed that suppression of cytokine gene expression by these agents was independent of the inhibition of proliferation .", + "output": [ + "000000012000000000000" + ] + }, + { + "input": "These data indicate that IL - 2 and IL - 12 may have distinct signaling pathways leading to the induction of IFN - gamma and GM - CSF gene expression , and that the NK3 . 3 cell line may serve as a novel model for dissecting the biochemical and molecular events involved in these pathways .", + "output": [ + "000012201220000000000122012200000000000000000000000000000" + ] + }, + { + "input": "A functional T - cell receptor signaling pathway is required for p95vav activity .", + "output": [ + "00122200000100" + ] + }, + { + "input": "Stimulation of the T - cell antigen receptor ( TCR ) induces activation of multiple tyrosine kinases , resulting in phosphorylation of numerous intracellular substrates .", + "output": [ + "00012222010000012000000000" + ] + }, + { + "input": "It contains a number of structural motifs , including Src homology 2 , Src homology 3 , and pleckstrin homology domains and a putative guanine nucleotide exchange domain .", + "output": [ + "00000120012222222222200122220" + ] + }, + { + "input": "The role of p95vav in TCR - mediated signaling processes is unclear .", + "output": [ + "0001010000000" + ] + }, + { + "input": "Here , we show that overexpression of p95vav alone in Jurkat T cells leads to activation of the nuclear factors , including NFAT , involved in interleukin - 2 expression .", + "output": [ + "0000000100000000001200100012200" + ] + }, + { + "input": "In contrast , NFAT activation by a G - protein - coupled receptor is not modulated by p95vav overexpression , suggesting that the effect is specific to the TCR signaling pathways .", + "output": [ + "00010001222220000100000000001000" + ] + }, + { + "input": "Although removal of the first 67 amino acids of p95vav activates its transforming potential in NIH 3T3 cells , this region appears to be required for its function in T cells .", + "output": [ + "00001222010000000000000000000000" + ] + }, + { + "input": "We further demonstrate that the p95vav - induced NFAT activation is not mimicked by Ras activation , though its function is dependent upon Ras and Raf .", + "output": [ + "000001001000001000000001010" + ] + }, + { + "input": "To further dissect p95vav involvement in TCR signaling , we analyzed various Jurkat mutants deficient in TCR signaling function or TCR expression and showed that an intact TCR signaling pathway is required for p95vav to function .", + "output": [ + "0001001000000000100010000001000001000" + ] + }, + { + "input": "However , overexpression of p95vav does not appear to influence TCR - induced protein tyrosine phosphorylation or increases in cytoplasmic free calcium .", + "output": [ + "00001000001000000000000" + ] + }, + { + "input": "Taken together , our data suggest that p95vav plays an important role at an yet unidentified proximal position in the TCR signaling cascade .", + "output": [ + "000000010000000000001000" + ] + }, + { + "input": "Positive and negative regulation of granulocyte - macrophage colony - stimulating factor promoter activity by AML1 - related transcription factor , PEBP2 .", + "output": [ + "00000122222200012222010" + ] + }, + { + "input": "The granulocyte - macrophage colony - stimulating factor ( GM - CSF ) gene promoter contains a consensus sequence for the polyomavirus enhancer binding - protein 2 ( PEBP2 ) transcription factor , which consists of alpha and beta subunits .", + "output": [ + "01222222222222200000012222222222000012220" + ] + }, + { + "input": "There are at least two genes , alpha A and alpha B , encoding the alpha subunit .", + "output": [ + "000000012012000120" + ] + }, + { + "input": "PEBP2 alpha A1 , alpha B1 , and alpha B2 proteins bound the PEBP2 site within the mouse GM - CSF promoter .", + "output": [ + "12201200122001200122220" + ] + }, + { + "input": "PEBP2 alpha A1 and alpha B1 enhanced the expression of the GM - CSF promoter - driven reporter plasmid in unstimulated and 12 - O - tetradecanoylphorbol 13 - acetate / phytohemagglutinin - stimulated human Jurkat T cells .", + "output": [ + "122012000001222222200000000000000000000" + ] + }, + { + "input": "In contrast , the promoter activity was suppressed by alpha B2 .", + "output": [ + "000000000120" + ] + }, + { + "input": "Coexpression of alpha B1 and alpha B2 showed that the promoter activity could be determined by the alpha B1 / alpha B2 ratio .", + "output": [ + "001201200000000001212200" + ] + }, + { + "input": "Jurkat cell extract contained PEBP2 site - binding protein ( s ) that cross - reacted with antimouse alpha A1 antibodies .", + "output": [ + "0000122220000000012220" + ] + }, + { + "input": "Northern blot analysis indicated the expression of human PEBP2 alpha A , alpha B ( AML1 ) , and beta genes in Jurkat cells .", + "output": [ + "0000000012201201000120000" + ] + }, + { + "input": "The augmentation of LPS responses by interferon gamma ( IFN - gamma ) , referred to as priming , is well established .", + "output": [ + "00000012012200000000000" + ] + }, + { + "input": "However , the mechanism ( s ) by which priming occurs is poorly defined .", + "output": [ + "000000000000000" + ] + }, + { + "input": "Using tumour necrosis factor ( TNF ) induction as a model , experiments were designed to analyse in detail the priming effect on the LPS response in human monocytes .", + "output": [ + "012201000000000000000000000000" + ] + }, + { + "input": "Priming by IFN - gamma was primarily manifested at the level of TNF mRNA accumulation .", + "output": [ + "0012200000001200" + ] + }, + { + "input": "IFN - gamma pre - treatment affected the magnitude rather than the sensitivity of the LPS response .", + "output": [ + "122000000000000000" + ] + }, + { + "input": "Priming occurred after several hours of treatment , and the primed state was induced by either IFN - gamma or GM - CSF , but not M - CSF .", + "output": [ + "000000000000000012201220001220" + ] + }, + { + "input": "Primed monocytes transcribed TNF mRNA at a higher rate than freshly isolated monocytes upon activation with LPS .", + "output": [ + "000120000000000000" + ] + }, + { + "input": "An additional significant finding was than TNF mRNA induced in primed cells was much more stable than in unprimed cells ( T1 / 2 increased 6 - 8 - fold ) .", + "output": [ + "00000012000000000000000000000000" + ] + }, + { + "input": "Finally , primed and unprimed cells possessed a differential sensitivity to the kinase inhibitor H - 89 .", + "output": [ + "000000000000000000" + ] + }, + { + "input": "( ABSTRACT TRUNCATED AT 250 WORDS )", + "output": [ + "0000000" + ] + }, + { + "input": "The CD4 promoter plays an important role in the developmental control of CD4 transcription .", + "output": [ + "012000000000100" + ] + }, + { + "input": "In this report , we show that the minimal CD4 promoter has four factor binding sites , each of which is required for full function .", + "output": [ + "00000000012001220000000000" + ] + }, + { + "input": "Using biochemical and mutagenesis analyses , we determined that multiple nuclear factors bind to these independent sites .", + "output": [ + "000000000012000000" + ] + }, + { + "input": "We determined that an initiator - like sequence present at the cap site and an Ets consensus sequence are required for full promoter function .", + "output": [ + "0000122200012001220000100" + ] + }, + { + "input": "We also demonstrate that the Myc - associated zinc finger protein ( MAZ ) appears to be the predominant factor binding to one of these sites .", + "output": [ + "000001222220100000120000000" + ] + }, + { + "input": "This last site closely resembles the ME1a1 G3AG4AG3 motif previously shown to be a critical element in the P2 promoter of the c - myc gene .", + "output": [ + "000000122000000000120012220" + ] + }, + { + "input": "We therefore believe that the MAZ transcription factor is also likely to play an important role in the control of developmental expression of the CD4 gene .", + "output": [ + "000001220000000000000000120" + ] + }, + { + "input": "Erythropoietin stimulates transcription of the TAL1 / SCL gene and phosphorylation of its protein products .", + "output": [ + "1000012220000120" + ] + }, + { + "input": "Activation of the TAL1 ( or SCL ) gene , originally identified through its involvement by a recurrent chromosomal translocation , is the most frequent molecular lesion recognized in T - cell acute lymphoblastic leukemia .", + "output": [ + "000122222000000000000000000000000000" + ] + }, + { + "input": "The protein products of this gene contain the basic - helix - loop - helix motif characteristic of a large family of transcription factors that bind to the canonical DNA sequence CANNTG as protein heterodimers .", + "output": [ + "012000001222222200000012000012220120" + ] + }, + { + "input": "TAL1 expression by erythroid cells in vivo and in chemical - induced erythroleukemia cell lines in vivo suggested the gene might regulate aspects of erythroid differentiation .", + "output": [ + "100000000000000000000000000" + ] + }, + { + "input": "Epo elicited a rapid , dose - related increase in TAL1 mRNA by increasing transcription of the gene and stabilizing one of its mRNAs .", + "output": [ + "1000000000120000000000010" + ] + }, + { + "input": "An Epo - inducible TAL1 DNA binding activity was identified in FVA cell nuclear extracts that subsequently decayed despite accumulating mRNA and protein .", + "output": [ + "010010000000000000001000" + ] + }, + { + "input": "Induction of DNA binding activity was associated temporally with Epo - induced phosphorylation of nuclear TAL1 protein .", + "output": [ + "000000000100001220" + ] + }, + { + "input": "These results indicate that Epo acts at both transcriptional and posttranscriptional levels on the TAL1 locus in Friend virus - induced erythroblasts and establish a link between Epo signaling mechanisms and a member of a family of transcription factors involved in the differentiation of diverse cell lineages .", + "output": [ + "000010000000001000000000000100000000012000000000" + ] + }, + { + "input": "Nonradioactive quantification of glucocorticoid receptor expression during differentiation of human monocytic cells ( U937 ) .", + "output": [ + "0001200000000000" + ] + }, + { + "input": "We describe a method for relative quantification of specific mRNA using a nonradioactive assay based on DNA strand competition between identical sequences of biotin - and fluorescein - labeled amplicon ( probe ) and unlabeled amplicon ( target ) during hybridization .", + "output": [ + "000000000100000000000000000000000000000000" + ] + }, + { + "input": "As the target quantity increased , that of the double - labeled probe decreased in accordance with the mass action law .", + "output": [ + "0000000000000000000000" + ] + }, + { + "input": "This technique was successfully applied to evaluate differences in glucocorticoid receptor expression in U937 cells before and after the addition of potent differentiation inducers : 12 - O - tetradecanoylphorbol 13 - acetate ( TPA ) and a combination of all - trans retinoic acid ( RA ) and 1 , 25 - dihydroxyvitamin D2 ( VD ) .", + "output": [ + "00000000012000000000000000000000000000000000000000000000000" + ] + }, + { + "input": "We observed that TPA treatment was associated with an increase in specific binding of [ 3H ] dexamethasone and up - regulation of GR mRNA while no enhanced GR expression was perceived with RA / VD treatment .", + "output": [ + "00000000000000000000000120001000000000" + ] + }, + { + "input": "Induction of Sp1 phosphorylation and NF - kappa B - independent HIV promoter domain activity in T lymphocytes stimulated by okadaic acid .", + "output": [ + "00100122222220000000000" + ] + }, + { + "input": "In contrast to the purely enhancer - dependent effect of cytokines such as TNF on the activity of the HIV regulatory region ( LTR ) , we observed that okadaic acid ( OKA ) activates HIV transcription through both the enhancer , responding to the factor NF - kappa B , and the promoter domain of the LTR .", + "output": [ + "00000000001001000001220100000000000000000000001222000120010" + ] + }, + { + "input": "The inducibility of HIV LTR - driven luciferase expression constructs in lymphoblastoid cells stimulated by OKA depended on both functional Sp1 binding elements and the ability of the TATA box to bind the protein TBP .", + "output": [ + "000122222200000000012220000012000010" + ] + }, + { + "input": "In both transformed and normal lymphocytes , OKA stimulation induced intense phosphorylation of the constitutively expressed Sp1 protein in the nucleus , a property of OKA not shared by TNF , phorbol ester , or PHA and interleukin 2 .", + "output": [ + "0000000000000000120000000000010000010120" + ] + }, + { + "input": "Responsiveness of LTR constructs deleted of kappa B elements to HIV Tat expression was increased upon OKA but not TNF stimulation .", + "output": [ + "0012001220120000000100" + ] + }, + { + "input": "Our results suggest that SP1 phosphorylation induced by OKA , a selective inhibitor of the serine - threonine phosphatase PP2A , facilitates the formation of a transcription complex involving general transcription factors , HIV Tat , and Sp1 proteins .", + "output": [ + "0000100000000001222100000012001201200120" + ] + }, + { + "input": "The formation of this complex would increase , independently of an in synergy with NF - kappa B , the low basal activity of the HIV LTR observed in normal T lymphocytes .", + "output": [ + "000000000000001222000000012000000" + ] + }, + { + "input": "To understand the molecular bases for cytokine redundancy and pleiotropy , we have compared the Stat proteins activated in peripheral blood lymphocytes ( PBLs ) by cytokines with shared and distinct actions .", + "output": [ + "000000000000000120000000001000000" + ] + }, + { + "input": "Interleukin - 2 ( IL - 2 ) rapidly activated Stat5 in fresh PBL , and Stat3 and Stat5 in preactivated PBL .", + "output": [ + "12201220001000001010000" + ] + }, + { + "input": "IL - 7 and IL - 15 induced the same complexes as IL - 2 , a feature explained by the existence of similar tyrosine - phosphorylated motifs in the cytoplasmic domains of IL - 2R beta and IL - 7R that can serve as docking sites for Stat proteins .", + "output": [ + "122012200000122000000000122200120122201220000000120" + ] + }, + { + "input": "These studies demonstrate that a single cytokine can activate different combinations of Stat proteins under different physiological conditions , and also indicate two mechanisms by which distinct cytokines can activate the same Stat protein .", + "output": [ + "00000010000012000000000000010000120" + ] + }, + { + "input": "I kappa B - alpha inhibits transcription factor NF - kappa B by retaining it in the cytoplasm .", + "output": [ + "1222201212220000000" + ] + }, + { + "input": "Various stimuli , typically those associated with stress or pathogens , rapidly inactivate I kappa B - alpha .", + "output": [ + "0000000000000122220" + ] + }, + { + "input": "This liberates NF - kappa B to translocate to the nucleus and initiate transcription of genes important for the defense of the organism .", + "output": [ + "001222000000000100000000" + ] + }, + { + "input": "Activation of NF - kappa B correlates with phosphorylation of I kappa B - alpha and requires the proteolysis of this inhibitor .", + "output": [ + "00122200001222200000000" + ] + }, + { + "input": "These results suggest that phosphorylation at one or both of these residues is critical for activation of NF - kappa B .", + "output": [ + "0000000000000000012220" + ] + }, + { + "input": "We used deletion analysis and transfection assays with reporter gene constructs to examine the transcription control elements in the 5 ' flanking region of the human EpoR gene .", + "output": [ + "00000000122000122001222001220" + ] + }, + { + "input": "In erythroid cells most of the transcription activity was contained in a 150 bp promoter fragment with binding sites for transcription factors AP2 , Sp1 and the erythroid - specific GATA - 1 .", + "output": [ + "0000000000001220012012101001222220" + ] + }, + { + "input": "The 150 bp hEpoR promoter exhibited high and low activity in erythroid OCIM1 and K562 cells , respectively , reflecting the high and low levels of constitutive hEpoR expression .", + "output": [ + "012220000000000000000000000100" + ] + }, + { + "input": "The GATA - 1 and Sp1 binding sites in this promoter lacking a TATA sequence were necessary for a high level of transcription activation .", + "output": [ + "0122222200000120000000000" + ] + }, + { + "input": "Protein - DNA binding studies suggested that Sp1 and two other CCGCCC binding proteins from erythroid and non - erythroid cells could bind to the Sp1 binding motif .", + "output": [ + "00000001000122000000000001220" + ] + }, + { + "input": "By increasing GATA - 1 levels via co - transfection , we were able to transactivate the hEpoR promoter in K562 cells and non - erythroid cells , but not in the highly active OCIM1 cells , although GATA - 1 mRNA levels were comparable in OCIM1 and K562 .", + "output": [ + "00122000000000000120000000000000000000122200000000" + ] + }, + { + "input": "Rather , hEpoR transcription activity depends on coordination between Sp1 and GATA - 1 with other cell - specific factors , including possibly other Sp1 - like binding proteins , to provide high level , tissue - specific expression .", + "output": [ + "0010000001012200122200001222200000000000" + ] + }, + { + "input": "Overexpression of DR - nm23 , a protein encoded by a member of the nm23 gene family , inhibits granulocyte differentiation and induces apoptosis in 32Dc13 myeloid cells .", + "output": [ + "00122000000000122000000000000" + ] + }, + { + "input": "Chronic myelogenous leukemia evolves in two clinically distinct stages : a chronic and a blast crisis phase .", + "output": [ + "000000000000000000" + ] + }, + { + "input": "The molecular changes associated with chronic phase to blast crisis transition are largely unknown .", + "output": [ + "000000000000000" + ] + }, + { + "input": "We have identified a cDNA clone , DR - nm23 , differentially expressed in a blast - crisis cDNA library , which has approximately 70 % sequence similarity to the putative metastatic suppressor genes , nm23 - H1 and nm23 - H2 .", + "output": [ + "0000120122000001222220000000001222012201220" + ] + }, + { + "input": "DR - nm23 mRNA is preferentially expressed at early stages of myeloid differentiation of highly purified CD34 + cells .", + "output": [ + "12220000000000000000" + ] + }, + { + "input": "Its constitutive expression in the myeloid precursor 32Dc13 cell line , which is growth - factor dependent for both proliferation and differentiation , results in inhibition of granulocytic differentiation induced by granulocyte colony - stimulating factor and causes apoptotic cell death .", + "output": [ + "000000000000000000000000000000012222000000" + ] + }, + { + "input": "These results are consistent with a role for DR - nm23 in normal hematopoiesis and raise the possibility that its overexpression contributes to differentiation arrest , a feature of blastic transformation in chronic myelogenous leukemia .", + "output": [ + "000000001220000000000000000000000000" + ] + }, + { + "input": "An interferon - gamma activation sequence mediates the transcriptional regulation of the IgG Fc receptor type IC gene by interferon - gamma .", + "output": [ + "01222200000012222201220" + ] + }, + { + "input": "Expression of the IgG Fc receptor type I ( Fc gamma RI ) on myeloid cells is dramatically increased by treatment with interferon - gamma ( IFN - gamma ) .", + "output": [ + "0001222201220000000000122012200" + ] + }, + { + "input": "We observed that Fc gamma RI transcript levels in monoblast - like U937 cells were elevated within 3 hr and peaked 12 hr after exposure to IFN - gamma .", + "output": [ + "000122000000000000000000001220" + ] + }, + { + "input": "Nuclear run - on analysis revealed that the rate of Fc gamma RI transcription was increased by IFN - gamma .", + "output": [ + "000000000012200001220" + ] + }, + { + "input": "Transient transfections of CAT reporter gene constructs containing various Fc gamma RIC promoter sequences into U937 cells revealed that a 20 - bp region surrounding the transcription start site ( - 7 to + 13 ) was capable of mediating transcription initiation and that an IFN - gamma responsive element ( GIRE ) was present within 74 bp upstream of the transcription initiation site .", + "output": [ + "00012220012222000000122200122000000000000000012222010000122001220" + ] + }, + { + "input": "A 17 - bp sequence between positions - 51 and - 35 conferred IFN - gamma responsiveness on a heterologous promoter .", + "output": [ + "0122200000000122000120" + ] + }, + { + "input": "Gel shift experiments further showed that the STAT1 alpha protein bound to the Fc gamma RIC GIRE in response to IFN - gamma treatment of U937 cells .", + "output": [ + "0000000122000122200012200000" + ] + }, + { + "input": "Our results demonstrate that transcriptional regulation of the Fc gamma RIC gene by IFN - gamma involves the binding of STAT1 alpha to a 17 - bp GAS homology in the proximal promoter .", + "output": [ + "0000000012220122000012001222200120" + ] + }, + { + "input": "Constitutively activated Jak - STAT pathway in T cells transformed with HTLV - I .", + "output": [ + "001120000000000" + ] + }, + { + "input": "Human T cell lymphotropic virus I ( HTLV - I ) is the etiological agent for adult T cell leukemia and tropical spastic paraparesis ( also termed HTLV - I - associated myelopathy ) .", + "output": [ + "00000000000000000000000000000000000" + ] + }, + { + "input": "HTLV - I - infected peripheral blood T cells exhibit an initial phase of interleukin - 2 ( IL - 2 ) - dependent growth ; over time , by an unknown mechanism , the cells become IL - 2 - independent .", + "output": [ + "0000000000000012201220000000000000000122000" + ] + }, + { + "input": "Whereas the Jak kinases Jak1 and Jak3 and the signal transducer and activator of transcription proteins Stat3 and Stat5 are activated in normal T cells in response to IL - 2 , this signaling pathway was constitutively activated in HTLV - I - transformed cells .", + "output": [ + "0012101000000012101000000000122000000000000000" + ] + }, + { + "input": "Nitric oxide decreases cytokine - induced endothelial activation .", + "output": [ + "000100000" + ] + }, + { + "input": "To test the hypothesis that nitric oxide ( NO ) limits endothelial activation , we treated cytokine - stimulated human saphenous vein endothelial cells with several NO donors and assessed their effects on the inducible expression of vascular cell adhesion molecule - 1 ( VCAM - 1 ) .", + "output": [ + "0000000000000000000000000000000000000122222012200" + ] + }, + { + "input": "This inhibition was paralleled by reduced monocyte adhesion to endothelial monolayers in nonstatic assays , was unaffected by cGMP analogues , and was quantitatively similar after stimulation by either IL - 1 alpha , IL - 1 beta , IL - 4 , tumor necrosis factor ( TNF alpha ) , or bacterial lipopolysaccharide .", + "output": [ + "0000000000000000000000000000012220122201220122012000000" + ] + }, + { + "input": "NO also decreased the endothelial expression of other leukocyte adhesion molecules ( E - selectin and to a lesser extent , intercellular adhesion molecule - 1 ) and secretable cytokines ( IL - 6 and IL - 8 ) .", + "output": [ + "0000000012201220000001222200010122012200" + ] + }, + { + "input": "Nuclear run - on assays , transfection studies using various VCAM - 1 promoter reporter gene constructs , and electrophoretic mobility shift assays indicated that NO represses VCAM - 1 gene transcription , in part , by inhibiting NF - kappa B .", + "output": [ + "0000000000122222200000000001220000000012220" + ] + }, + { + "input": "We propose that NO ' s ability to limit endothelial activation and inhibit monocyte adhesion may contribute to some of its antiatherogenic and antiinflammatory properties within the vessel wall .", + "output": [ + "000000000000000000000000000000" + ] + }, + { + "input": "MIP1 alpha nuclear protein ( MNP ) , a novel transcription factor expressed in hematopoietic cells that is crucial for transcription of the human MIP - 1 alpha gene .", + "output": [ + "122201000012000000000001222220" + ] + }, + { + "input": "Secreted from activated T cells and macrophages , bone marrow - derived MIP - 1 alpha / GOS19 inhibits primitive hematopoietic stem cells and appears to be involved in the homeostatic control of stem cell proliferation .", + "output": [ + "0000000001222222220000000000000000000" + ] + }, + { + "input": "Therefore , it is important to understand the mechanisms which control the expression of MIP - 1 alpha / GOS19 .", + "output": [ + "000000000000001222120" + ] + }, + { + "input": "Previous work has shown that in Jurkat T cells , a set of widely expressed transcription factors ( the ICK - 1 family ) affect the GOS19 promoter .", + "output": [ + "00000000000000012001222000120" + ] + }, + { + "input": "In this communication , we provide evidence that the pathway of induction in the macrophage cell line U937 is different from that in Jurkat cells .", + "output": [ + "00000000000000000000000000" + ] + }, + { + "input": "Furthermore , we show that the ICK - 1 binding site does not confer negative regulation in U937 cells .", + "output": [ + "00000012222000000000" + ] + }, + { + "input": "Interaction of nuclear extracts from various cell lines and tissue with the MNP site leads to the formation of fast - migrating protein - DNA complexes with similar but distinct electrophoretic mobilities .", + "output": [ + "000000000000120000012222220000000" + ] + }, + { + "input": "A mutation of the MNP site which does not abrogate ICK - 1 binding inactivates the GOS19 . 1 promoter in U937 cells and reduces its activity by fourfold in Jurkat cells .", + "output": [ + "000012000000000012220000000000000" + ] + }, + { + "input": "We propose that the MNP protein ( s ) binding at the MNP site constitutes a novel transcription factor ( s ) expressed in hematopoietic cells .", + "output": [ + "000012000000120001200000000" + ] + }, + { + "input": "The effect of Toremifene on the expression of some genes in human mononuclear cells .", + "output": [ + "000000000000000" + ] + }, + { + "input": "Toremifene exerts multiple and varied effects on the gene expression of human peripheral mononuclear cells .", + "output": [ + "0000000000000000" + ] + }, + { + "input": "After short - term , in vitro exposure to therapeutical levels , distinct changes in P - glycoprotein , steroid receptors , p53 and Bcl - 2 expression take place .", + "output": [ + "0000000000000000000000000000000" + ] + }, + { + "input": "In view of the increasing use of antiestrogens in cancer therapy and prevention , there is obvious merit in long - term in vivo studies to be conducted .", + "output": [ + "00000000000000000000000000000" + ] + }, + { + "input": "The interleukin - 5 / receptor interaction activates Lyn and Jak2 tyrosine kinases and propagates signals via the Ras - Raf - 1 - MAP kinase and the Jak - STAT pathways in eosinophils .", + "output": [ + "01220000122220000012222222001120000" + ] + }, + { + "input": "We have shown that the interaction of interleukin ( IL ) - 5 with the receptor activates Lyn tyrosine kinase within 1 min and Jak2 tyrosine kinase within 1 - 3 min .", + "output": [ + "000000012222200001220000122000000" + ] + }, + { + "input": "IL - 5 also stimulates GTP binding to p21ras .", + "output": [ + "1220000010" + ] + }, + { + "input": "Jak2 kinase has been shown to phosphorylate STAT nuclear proteins .", + "output": [ + "12000001220" + ] + }, + { + "input": "The activation of STAT nuclear factors was studied by electrophoretic mobility shift assay using a gamma activation site ( GAS ) probe .", + "output": [ + "00012200000000012201000" + ] + }, + { + "input": "We found that IL - 5 induces two GAS - binding proteins in eosinophils , one of which is STAT1 .", + "output": [ + "000122001222000000010" + ] + }, + { + "input": "The IE2 gene product of human cytomegalovirus ( HCMV ) is one of a few viral regulatory proteins expressed immediately upon infection of the host cell .", + "output": [ + "012200000000000122000000000" + ] + }, + { + "input": "It is a potent transcriptional activator of many viral and cellular promoters .", + "output": [ + "0000120012220" + ] + }, + { + "input": "However , unlike another tumor suppressor protein , p53 , Rb did not have any significant effect on basal levels of transcription , suggesting that Rb specifically interacts with IE2 rather than other cellular factors involved in the general transcription machinery .", + "output": [ + "000012201010000000000000010001000120000000" + ] + }, + { + "input": "We found by protein - affinity chromatography that Rb in nuclear extracts or produced by in vitro translation directly bound to IE2 .", + "output": [ + "00000000100000000000010" + ] + }, + { + "input": "Our results suggest that Rb may regulate the life cycle of HCMV , which is endemic in the human population .", + "output": [ + "000010000000000000000" + ] + }, + { + "input": "Furthermore , these data may provide new insights into the slow rate of HCMV DNA replication in cells and the possible involvement of HCMV in tumorigenesis .", + "output": [ + "000000000000000000000000000" + ] + }, + { + "input": "Expression of the nucleoside diphosphate kinase in human skin cancers : an immunohistochemical study .", + "output": [ + "000122000000000" + ] + }, + { + "input": "Expression of nucleoside diphosphate ( NDP ) kinase , which is homologous to the nm23 gene product in a variety of species , has been found to be inversely associated with metastatic potential .", + "output": [ + "0012222200000012200000000000000000" + ] + }, + { + "input": "In order to determine whether NDP kinase expression serves as a marker for metastatic potential in human skin cancer , we assessed the levels of NDP kinase expression in 9 keratoacanthomas ( KAs ) , 26 squamous cell carcinomas ( SCCs ) , and 25 basal cell carcinomas ( BCCs ) using immunohistochemistry .", + "output": [ + "000001200000000000000000012000000000000000000000000000" + ] + }, + { + "input": "The expression of NDP kinase was intense in KA and SCC compared with BCC .", + "output": [ + "000120000000000" + ] + }, + { + "input": "However , the difference of NDP kinase expression between KA and SCC was not statistically significant .", + "output": [ + "00000120000000000" + ] + }, + { + "input": "Our results contradict the hypothesis concerning the possible role of nm23 gene as a metastatic suppressor gene in human skin cancer .", + "output": [ + "0000000000120000000000" + ] + }, + { + "input": "The mechanism of overexpression in various tumor cell types and its biological significance in cutaneous carcinogenesis remain to be determined .", + "output": [ + "000000000000000000000" + ] + }, + { + "input": "RB and a novel E2F - 1 binding protein in MHC class II deficient B - cell lines and normal IFN - gamma induction of the class IL transactivator CIITA in class II non - inducible RB - defective tumor lines .", + "output": [ + "100012222000000000001220001221000000000000" + ] + }, + { + "input": "The major histocompatibility ( MHC ) class II genes encode cell surface proteins that bind antigenic peptide for presentation to T - cells .", + "output": [ + "012222222012200000000000" + ] + }, + { + "input": "The class II proteins are expressed constitutively on B - cells and EBV - transformed B - cells , and are inducible by IFN - gamma on a wide variety of cell types .", + "output": [ + "0122000000000000000000012200000000" + ] + }, + { + "input": "Therefore , we examined the RB status of a series of B - cell mutants that are defective in class II expression , generated either in vitro or derived from Bare Lymphocyte Syndrome ( BLS ) patients .", + "output": [ + "00000100000000000000000000000000000000" + ] + }, + { + "input": "Nuclear matrix - bound RB was detectable in all cases , indicating that loss of RB is not responsible for decreased class II expression in these lines .", + "output": [ + "0000100000000001000000000000" + ] + }, + { + "input": "A second E2F - I binding protein , most likely DP - I , was also apparently normal in both class II - positive and - negative B - cell lines .", + "output": [ + "00000000000000000000000000000000" + ] + }, + { + "input": "CIITA is a class II gene transactivator known to be defective in one form of BLS and to be required for the induction of MHC class II by IFN - gamma .", + "output": [ + "10012220000000000000000012201220" + ] + }, + { + "input": "CIITA mRNA is normally inducible by IFN - gamma in class II non - inducible , RB - defective lines , and in one line , re - expression of RB has no effect on CIITA mRNA induction levels .", + "output": [ + "1200001220000000000000000000001000012000" + ] + }, + { + "input": "Thus , the block in MHC class II inducibility in RB - defective cells is not due to a block in CIITA inducibility .", + "output": [ + "000000000000000000000100" + ] + }, + { + "input": "Interleukin 12 induces tyrosine phosphorylation and activation of STAT4 in human lymphocytes .", + "output": [ + "1200000010000" + ] + }, + { + "input": "Interleukin 12 ( IL - 12 ) is an important immunoregulatory cytokine whose receptor is a member of the hematopoietin receptor superfamily .", + "output": [ + "12012200001200000001220" + ] + }, + { + "input": "Recently , transcription factors known as STATs ( signal transducers and activators of transcription ) have been shown to be tyrosine phosphorylated and activated in response to a number of cytokines that bind hematopoietin receptors and activate JAK kinases .", + "output": [ + "0012001012222200000000000000001001200120" + ] + }, + { + "input": "In this report we demonstrate that IL - 12 induces tyrosine phosphorylation of a recently identified STAT family member , STAT4 , and show that STAT4 expression is regulated by T - cell activation .", + "output": [ + "00000012200000001220100001000000000" + ] + }, + { + "input": "These data , and the recent demonstration of JAK phosphorylation by IL - 12 , identify a rapid signal - transduction pathway likely to mediate IL - 12 - induced gene expression .", + "output": [ + "000000001001220000000000012200000" + ] + }, + { + "input": "Temperature - induced down - regulation of the glucocorticoid receptor in peripheral blood mononuclear leucocyte in patients with sepsis or septic shock .", + "output": [ + "00000000120000000000000" + ] + }, + { + "input": "OBJECTIVE : Activation of the hypothalamic - pituitary - adrenal axis is of vital importance during critical illness .", + "output": [ + "0000000000000000000" + ] + }, + { + "input": "We have studied the adaptive mechanisms which occur at the level of the glucocorticoid receptor in glucocorticoid target tissues in patients with sepsis or septic shock .", + "output": [ + "000000000000012000000000000" + ] + }, + { + "input": "SUBJECTS : Fifteen patients ( age 25 - 79 ) with sepsis or septic shock who were admitted to an intensive care unit were studied .", + "output": [ + "00000000000000000000000000" + ] + }, + { + "input": "The control group consisted of 24 healthy laboratory employees .", + "output": [ + "0000000000" + ] + }, + { + "input": "MEASUREMENTS : The binding capacity and affinity of the glucocorticoid receptors were measured and compared to clinical data and the plasma cortisol concentrations .", + "output": [ + "000000000120000000000000" + ] + }, + { + "input": "In vitro , hyperthermia as well as variations in the cellular composition did not influence the glucocorticoid receptor .", + "output": [ + "0000000000000000000" + ] + }, + { + "input": "In vivo , there was no change in the number of receptors per cell in patients with sepsis or septic shock as compared to healthy controls .", + "output": [ + "000000000000000000000000000" + ] + }, + { + "input": "However , a decreased affinity of the glucocorticoid receptor was observed .", + "output": [ + "000000012000" + ] + }, + { + "input": "There was a weak but significant negative correlation between body temperature and the number of glucocorticoid receptors in the patient group .", + "output": [ + "0000000000000001200000" + ] + }, + { + "input": "There was no relation between circulating cortisol concentrations and glucocorticoid receptor affinity and number .", + "output": [ + "000000000120000" + ] + }, + { + "input": "CONCLUSIONS : There is no obvious regulation of the number of glucocorticoid receptors by plasma cortisol concentrations in vivo .", + "output": [ + "00000000000120000000" + ] + }, + { + "input": "The decreased affinity of the glucocorticoid receptor together with the negative correlation between hyperthermia and the number of glucocorticoid receptors in patients with sepsis or septic shock suggest that hypothalamic - pituitary - adrenal axis activation during critical illness is accompanied by peripheral adaptation in glucocorticoid receptor number and affinity .", + "output": [ + "000001200000000000120000000000000000000000000120000" + ] + }, + { + "input": "A possible signaling role for the Syk tyrosine kinase .", + "output": [ + "0000001220" + ] + }, + { + "input": "Activation of cytoplasmic tyrosine kinases is an important aspect of signal transduction mediated by integrins .", + "output": [ + "0012200000000010" + ] + }, + { + "input": "In the human monocytic cell line THP - 1 , either integrin - dependent cell adhesion to fibronectin or ligation of beta 1 integrins with antibodies causes a rapid and intense tyrosine phosphorylation of two sets of proteins of about 65 - 75 and 120 - 125 kDa .", + "output": [ + "0000000000010000010000000100000000000000122222220" + ] + }, + { + "input": "In addition , integrin ligation leads to nuclear translocation of the p50 and p65 subunits of the NF - kappa B transcription factor , to activation of a reporter gene driven by a promoter containing NF - kappa B sites , and to increased levels of mRNAs for immediate - early genes , including the cytokine interleukin ( IL ) - 1 beta .", + "output": [ + "0001000000010120012222200000120001012222000000101222000122222220" + ] + }, + { + "input": "The components tyrosine phosphorylated subsequent to cell adhesion include paxillin , pp125FAK , and the SH2 domain containing tyrosine kinase Syk .", + "output": [ + "0000000001010001222220" + ] + }, + { + "input": "In contrast , integrin ligation with antibodies induces tyrosine phosphorylation of Syk but not of FAK or paxillin .", + "output": [ + "0001001000010001010" + ] + }, + { + "input": "In adhering cells , pre - treatment with cytochalasin D suppresses tyrosine phosphorylation of FAK and paxillin but not of Syk , while IL - 1 beta message induction is unaffected .", + "output": [ + "00000000000000101000100122200000" + ] + }, + { + "input": "Inhibition of dexamethasone binding to human glucocorticoid receptor by New World primate cell extracts .", + "output": [ + "000001220000000" + ] + }, + { + "input": "B95 - 8 cytosol inhibited specific binding of [ 3H ] dexamethasone ( P < 0 . 01 ) when mixed with cytosol prepared from either a human lymphoid cell line ( HL ) or rat thymus .", + "output": [ + "00000000000000000000000000000000000000" + ] + }, + { + "input": "The inhibitory activity was heat labile and trypsin sensitive .", + "output": [ + "0000000100" + ] + }, + { + "input": "Peak inhibitory activity was found in the 150 - 200 kd fractions after Sephacryl G - 200 ultrafiltration .", + "output": [ + "0000000000000000000" + ] + }, + { + "input": "Scatchard analysis of [ 3H ] dexamethasone binding using mixed cytosol showed a diminished GR apparent binding affinity when compared to HL cytosol .", + "output": [ + "000000000000001000000000" + ] + }, + { + "input": "These data demonstrate that B95 - 8 cells contain a competitive inhibitor that prevents binding of dexamethasone to its cognate receptor .", + "output": [ + "0000000000000000000120" + ] + }, + { + "input": "Disruption of a GATA motif in the Duffy gene promoter abolishes erythroid gene expression in Duffy - negative individuals .", + "output": [ + "00012001220120000000" + ] + }, + { + "input": "The mRNA for the Duffy blood group antigen , the erythrocyte receptor for the Plasmodium vivax malaria parasite , has recently been cloned and shown to encode a widely expressed chemokine receptor .", + "output": [ + "010012220012000000000000000000120" + ] + }, + { + "input": "Here , we show that the Duffy antigen / chemokine receptor gene ( DARC ) is composed of a single exon and that most Duffy - negative blacks carry a silent FY * B allele with a single T to C substitution at nucleotide - 46 .", + "output": [ + "00000012222201000000100000000012222000000000000" + ] + }, + { + "input": "This mutation impairs the promoter activity in erythroid cells by disrupting a binding site for the GATA1 erythroid transcription factor .", + "output": [ + "000000000000120012220" + ] + }, + { + "input": "With the recent characterization of the FY * A and FY * B alleles , these findings provide the molecular basis of the Duffy blood group system and an explanation for the erythroid - specific repression of the DARC gene in Duffy - negative individuals .", + "output": [ + "0000001222222200000000000000000000000012000000" + ] + }, + { + "input": "Activation of pp90rsk and early growth response - 1 gene expression by pokeweed mitogen in human B cells .", + "output": [ + "0010122222001200000" + ] + }, + { + "input": "The present studies have examined the effects of pokeweed mitogen ( PWM ) on the induction of early growth response - 1 gene ( EGR - 1 ) in normal human B cells .", + "output": [ + "0000000012010000012222201220000000" + ] + }, + { + "input": "PWM regulates EGR - 1 gene expression by both transcriptional and post - transcriptional mechanisms .", + "output": [ + "1012200000000000" + ] + }, + { + "input": "Transient transfection assays with EGR - 1 promoter fragments linked to the chloramphenicol acetyltransferase ( CAT ) gene demonstrated that PWM induced EGR - 1 transcription is conferred by the CArG motif ( C C [ AT ] 6GG ) in the EGR - 1 promoter .", + "output": [ + "00001222200012222200101220000012012222200012220" + ] + }, + { + "input": "Taken together , these findings suggest that PWM is able to initiate an intracytoplasmic signalling cascade and EGR - 1 induction in normal human B cells .", + "output": [ + "000000010000000001220000000" + ] + }, + { + "input": "A conserved motif in the promoters of several cytokines expressed by human Th2 - type lymphocytes .", + "output": [ + "01200100100000000" + ] + }, + { + "input": "It contains a core sequence CTTGG . . . CCAAG which is present as part of larger palindromic sequences in each gene .", + "output": [ + "00012000000000000120000" + ] + }, + { + "input": "This suggest that they may interact with a new family of trans - acting factors .", + "output": [ + "0000000000012220" + ] + }, + { + "input": "In DNA mobility shift assays , this sequence can give either six different specific bands which are competed out by different parts of the sequence or one specific band which is competed out by each of the inverted repeats , depending on the reconstitution conditions .", + "output": [ + "0000000000000000000000000000000000000000000000" + ] + }, + { + "input": "Considering the strong positive regulatory effect of this element and its presence in several T - cell - expressed cytokine genes , it may be crucial to the coordinated expression of these cytokines in T helper cells .", + "output": [ + "00000000100000122222200000000000100000" + ] + }, + { + "input": "cDNA cloning of a NGFI - B / nur77 - related transcription factor from an apoptotic human T cell line .", + "output": [ + "100012222222200000000" + ] + }, + { + "input": "A human T lymphoid cell line , PEER , dies by apoptosis in the presence of PMA and calcium ionophore .", + "output": [ + "000000000000000000000" + ] + }, + { + "input": "A new gene , TINUR , was cloned from apoptotic PEER cells .", + "output": [ + "0010100000000" + ] + }, + { + "input": "The expression of the TINUR gene is induced within 1 h after the cross - linking of the T cell Ag receptor complex .", + "output": [ + "000012000000000000122220" + ] + }, + { + "input": "TINUR belongs to the NGFI - B / nur77 family of the steroid receptor superfamily and is an orphan receptor .", + "output": [ + "100012222200122000120" + ] + }, + { + "input": "TINUR binds to the same DNA sequence as NGFI - B / nur77 .", + "output": [ + "10000120122220" + ] + }, + { + "input": "We also propose that the NGFI - B / nur77 family can be classified into two subtypes .", + "output": [ + "000001222220000000" + ] + }, + { + "input": "BACKGROUND : The induction of vascular cell adhesion molecule - 1 ( VCAM - 1 ) and E - selectin by tumor necrosis factor - alpha ( TNF ) is mediated by mobilization of the transcription factor nuclear factor - kappa B ( NF - kappa B ) .", + "output": [ + "0000012222201220012201222201000000012122220122200" + ] + }, + { + "input": "Since salicylates have been reported to inhibit NF - kappa B activation by preventing the degradation of its inhibitor I kappa B , we studied a potential inhibition of this pathway by acetylsalicylate ( aspirin ) in human umbilical vein endothelial cells ( HUVECs ) .", + "output": [ + "0000000122200000000122000000000000000000000000" + ] + }, + { + "input": "METHODS AND RESULTS : Gel - shift analyses demonstrated dose - dependent inhibition of TNF - induced NF - kappa B mobilization by aspirin at concentrations ranging from 1 to 10 mmol / L .", + "output": [ + "00000000000000100122200000000000000" + ] + }, + { + "input": "Induction of VCAM - 1 and E - selectin surface expression by TNF was dose - dependently reduced by aspirin over the same range , while induction of intercellular adhesion molecule - 1 ( ICAM - 1 ) was hardly affected .", + "output": [ + "001220122000100000000000000012222012200000" + ] + }, + { + "input": "Aspirin appeared to prevent VCAM - 1 transcription , since it dose - dependently inhibited induction of VCAM - 1 mRNA by TNF .", + "output": [ + "000012200000000001222010" + ] + }, + { + "input": "As a functional consequence , adhesion of U937 monocytes to TNF - stimulated HUVECs was markedly reduced by aspirin due to suppression of VCAM - 1 and E - selectin upregulation .", + "output": [ + "00000000000000000000000122012200" + ] + }, + { + "input": "CONCLUSIONS : Our data suggest that aspirin inhibits NF - kappa B mobilization , induction of VCAM - 1 and E - selectin , and subsequent monocyte adhesion in endothelial cells stimulated by TNF , thereby providing an additional mechanism for therapeutic effects of aspirin .", + "output": [ + "0000000012220000122012200000000001000000000000" + ] + }, + { + "input": "Activation of NF - kappa B by phosphatase inhibitors involves the phosphorylation of I kappa B alpha at phosphatase 2A - sensitive sites .", + "output": [ + "001222010000012220122220" + ] + }, + { + "input": "In the present study , the role of serine / threonine phosphatases in the regulation of I kappa B alpha phosphorylation was investigated .", + "output": [ + "000000001222000012220000" + ] + }, + { + "input": "Our studies demonstrate that incubation of human T cells with low concentrations ( approximately 1 - 5 nM ) of calyculin A or okadaic acid , potent inhibitors of protein phosphatase type 1 ( PP - 1 ) and type 2A ( PP - 2A ) , induces the phosphorylation of I kappa B alpha even in the absence of any cellular stimulus .", + "output": [ + "0000000000000000000000000000012222222222201220000001222000000000" + ] + }, + { + "input": "This action of the phosphatase inhibitors , which is associated with the activation of the RelA . p50 NF - kappa B heterodimer , is not affected by agents that block the induction of I kappa B alpha phosphorylation by tumor necrosis factor alpha ( TNF - alpha ) .", + "output": [ + "00000000000000012222222000000000001222001222012200" + ] + }, + { + "input": "Furthermore , the phosphorylated I kappa B alpha from calyculin A - treated cells , but not that from TNF - alpha - stimulated cells , is sensitive to PP - 2A in vitro , suggesting the existence of fundamental differences in the phosphorylation of I kappa B alpha induced by the two different NF - kappa B inducers .", + "output": [ + "000122220000000000000000000001220000000000000122200000122200" + ] + }, + { + "input": "However , induction of I kappa B alpha phosphorylation by both TNF - alpha and the phosphatase inhibitors is associated with the subsequent degradation of I kappa B alpha .", + "output": [ + "000012220001220000000000012220" + ] + }, + { + "input": "We further demonstrate that TNF - alpha - and calyculin A - induced I kappa B alpha degradation exhibits similar but not identical sensitivities to a proteasome inhibitor .", + "output": [ + "00000000000000000000000000000" + ] + }, + { + "input": "Sp1 functions in a chromatin - dependent manner to augment human alpha - globin promoter activity .", + "output": [ + "10001000001222200" + ] + }, + { + "input": "We investigated the role of this G + C - rich region in augmenting alpha - globin promoter activity in the presence of the far - upstream alpha - globin enhancer , HS - 40 .", + "output": [ + "000000122222001222000000122222201220" + ] + }, + { + "input": "We show that in transiently transfected erythroid cells , deletion of the alpha - globin G + C - rich 5 ' flanking region has no effect on alpha - globin promoter activity .", + "output": [ + "0000000000001222222222220000122200" + ] + }, + { + "input": "However , upon stable integration into chromatin , deletion of this region causes a nearly 90 % decrease in promoter activity compared with expression from an alpha - globin promoter retaining this region .", + "output": [ + "0000001000000000000000000012220000" + ] + }, + { + "input": "These results suggest that the alpha - globin G + C - rich 5 ' flanking region augments alpha - globin promoter activity in a chromatin - dependent manner .", + "output": [ + "000001222222222220122200010000" + ] + }, + { + "input": "We further show that this G + C - rich region is required for the activation of alpha - globin gene expression during erythroid differentiation .", + "output": [ + "00000122222000000122200000" + ] + }, + { + "input": "Costimulation of human CD4 + T cells with LFA - 3 and B7 induce distinct effects on AP - 1 and NF - kappa B transcription factors .", + "output": [ + "0000000012201000000001222120" + ] + }, + { + "input": "We have earlier shown that stimulation of human CD4 + T cells with SEA presented on Chinese hamster ovary ( CHO ) - DR transfectants coexpressing either B7 or LFA - 3 resulted in distinct cytokine profiles .", + "output": [ + "00000000000000000000000000010122000100" + ] + }, + { + "input": "We now demonstrate that B7 , but not LFA - 3 , strongly costimulated IL - 2 transcription and mRNA expression in CD4 + T cells .", + "output": [ + "000010001220001220000000000" + ] + }, + { + "input": "Maximal increase in IL - 2 transcription was recorded with CHO - DR / B7 / LFA - 3 , suggesting a cooperative effect of B7 and LFA - 3 at the transcriptional level .", + "output": [ + "00012200001222222220000001012200000" + ] + }, + { + "input": "Gel - shift analysis demonstrated that stimulation of CD4 + T cells with CHO - DR and staphylococcal enterotoxin A was sufficient to induce significant amounts of NF - kappa B binding proteins , whereas induction of AP - 1 binding proteins required costimulation .", + "output": [ + "000000000000012200000000000122200000012222000" + ] + }, + { + "input": "The CHO - DR / B7 / LFA - 3 triple transfectant induced a further increase in AP - 1 and NF - kappa B binding proteins compared with the double transfectants .", + "output": [ + "000000000000000001220122212000000" + ] + }, + { + "input": "The level of Oct - 1 binding proteins remained similar in all samples .", + "output": [ + "00012222000000" + ] + }, + { + "input": "Super - shift analysis revealed that the NF - kappa B complex of costimulated CD4 + T cells contained large amounts of p50 , substantial amounts of p65 , and marginal levels of c - Rel proteins .", + "output": [ + "00000001222200000000001000010000012220" + ] + }, + { + "input": "The AP - 1 binding proteins contained c - Jun , Jun - D , and Fra - 1 , but marginal amounts of Jun - B and c - Fos .", + "output": [ + "01222201220122001220000012201220" + ] + }, + { + "input": "Our results indicate distinct effects of B7 and LFA - 3 costimulation on the activity of AP - 1 and NF - kappa B .", + "output": [ + "0000001012200000122012220" + ] + }, + { + "input": "These may partly account for the differential effects of B7 and LFA - 3 costimulation on IL - 2 expression .", + "output": [ + "000000000101220012200" + ] + }, + { + "input": "2 , 3 , 7 , 8 - tetrachlorodibenzo - p - dioxin ( TCDD ) inhibits murine and human B lymphocyte immunoglobulin production through an unknown mechanism .", + "output": [ + "00000000000000000000000000000" + ] + }, + { + "input": "This study investigated the effect of TCDD on expression of the CD19 gene in a human B lymphocyte cell line .", + "output": [ + "000000000001200000000" + ] + }, + { + "input": "Northern blot analysis showed that TCDD treatment decreased steady state levels of CD19 mRNA by 67 % in the IM - 9 cell line .", + "output": [ + "0000000000001200000000000" + ] + }, + { + "input": "Using a gel mobility shift assay , we identified a DNA - binding complex in IM - 9 nuclear extracts that by several criteria appears to be the Ah receptor .", + "output": [ + "0000000000122200000000000000120" + ] + }, + { + "input": "These results suggest that the AhR could interfere with BSAP - stimulated CD19 gene transcription by competition for a common DNA binding site .", + "output": [ + "000001000100120000001220" + ] + }, + { + "input": "Inhibitory action of nm23 proteins on induction of erythroid differentiation of human leukemia cells .", + "output": [ + "000120000000000" + ] + }, + { + "input": "nm23 genes encode proteins that participate in tumor metastasis regulation and in various fundamental cellular processes , although their mechanisms of action are still unknown .", + "output": [ + "12000000000000000000000000" + ] + }, + { + "input": "Although all nm23 proteins contain nucleoside diphosphate ( NDP ) kinase activity , it has not been established that the enzyme activity mediated the various functions of nm23 proteins .", + "output": [ + "001201222220000000000000000120" + ] + }, + { + "input": "Native human erythrocyte NDP kinase protein inhibited the induction of erythroid differentiation of HEL , KU812 and K562 cells , but not the induction of monocytic or granulocytic differentiation of HL - 60 , U937 and HEL / S cells .", + "output": [ + "12222200000000000000000000000000000000000" + ] + }, + { + "input": "The erythroid differentiation of HEL cells was inhibited by recombinant human nm23 - H1 , - H2 , mouse nm23 - M1 , and - M2 proteins .", + "output": [ + "0000000001222222222222222220" + ] + }, + { + "input": "Moreover , both the mutant nm23 - H2His protein and truncated nm23 - H2 protein containing N - terminal ( 1 - 60 ) peptide , which do not have NDP kinase activity , also inhibited erythroid differentiation of HEL cells .", + "output": [ + "000012222012222012222222200000120000000000" + ] + }, + { + "input": "These results suggest that ( 1 ) the differentiation inhibitory activity of I - factor / nm23 protein is not restricted to monocytic differentiation of M1 cells , ( 2 ) the inhibitory activity is exhibited without species specificity , and ( 3 ) the differentiation inhibitory activity of the nm23 / NDP kinase protein is independent of its enzyme activity and requires the presence of N - terminal peptides .", + "output": [ + "00000000000012222200000000000000000000000000000000122220000000000000000" + ] + }, + { + "input": "Lipopolysaccharide - induced E - selectin expression requires continuous presence of LPS and is inhibited by bactericidal / permeability - increasing protein .", + "output": [ + "00012200000000001222220" + ] + }, + { + "input": "Endothelial cells stimulated by LPS express E - selectin , which plays an important role in mediating neutrophil adhesion during inflammation .", + "output": [ + "0000001220000000000000" + ] + }, + { + "input": "E - selectin is induced within 1 - 2 h , peaks at 4 - 6 h , and gradually returns to basal level by 24 h .", + "output": [ + "1220000000000000000000000000" + ] + }, + { + "input": "rBPI21 , a recombinant N - terminal fragment of human bactericidal / permeability - increasing protein ( BPI ) , inhibited LPS - induced E - selectin expression when added at the same time as , and up to 6 h after , LPS .", + "output": [ + "100122220122222201000000122000000000000000000" + ] + }, + { + "input": "These results indicate that endothelial activation requires continuous presence of LPS , and rBPI21 acts to reverse LPS - mediated endothelial activation by interrupting the on - going LPS signal .", + "output": [ + "0000000000000100000000000000000" + ] + }, + { + "input": "So called costimulatory signals , mediated by other cell surface interactions or soluble cytokines produced by antigen presenting cells , are also required for complete T cell activation .", + "output": [ + "00000000000012000000000000000" + ] + }, + { + "input": "High levels of cytokine gene expression in T cells also required both TCR and costimulatory signals .", + "output": [ + "00010000000010000" + ] + }, + { + "input": "The granulocyte - macrophage colony - stimulating factor requires sequences in the promoter as well as a powerful enhancer located 3kb upstream to respond to TCR - like signals .", + "output": [ + "012222220000100000100000010000" + ] + }, + { + "input": "These promoter and enhancer regions are mainly activated by the transcription factor nuclear factor of activated T cells ( NFAT ) .", + "output": [ + "0122200000122222220100" + ] + }, + { + "input": "The activation of NFAT by TCR signals has been well described for interleukin - 2 ( IL - 2 ) and IL - 4 gene transcription in T cells .", + "output": [ + "000101000000000012200000000000" + ] + }, + { + "input": "This region is termed the CK - 1 or CD28RE and appears to bind specific members of the NF - kappa B family of transcription factors .", + "output": [ + "000001220100000000122220120" + ] + }, + { + "input": "We have found that the HTLV - 1 transactivator protein , tax , acts as a costimulatory signal for GM - CSF and IL - 2 gene transcription , in that it can cooperate with TCR signals to mediate high level gene expression .", + "output": [ + "00000122220100000000000000000000000100000000" + ] + }, + { + "input": "Tax activates the GM - CSF promoter through the CK - 1 / CD28RE region and also activates nuclear factor - kappa B binding to this region .", + "output": [ + "0001222001221200001222200000" + ] + }, + { + "input": "However , other transcription factors or coactivators of NF - kappa B are required for tax activation but these remain to be identified .", + "output": [ + "000120001222000100000000" + ] + }, + { + "input": "The CK - 1 / CD28RE of GM - CSF shows a high degree of similarity to the IL - 2 CD28RE and the IL - 3 gene also contains a related region .", + "output": [ + "0122120122000000001221001222000000" + ] + }, + { + "input": "Danazol decreases transcription of estrogen receptor gene in human monocytes .", + "output": [ + "00001220000" + ] + }, + { + "input": "1 . Administration of danazol for over one month reduced the levels of estrogen receptor ( ER ) and its mRNA to approximately 50 and 20 % , respectively in monocytes .", + "output": [ + "00000000000001201000100000000000" + ] + }, + { + "input": "2 . Danazol did not alter the degradation rate of ER mRNA in monocytes .", + "output": [ + "000000000012000" + ] + }, + { + "input": "4 . Danazol may release estrogen predominance via the reduction of transcription for ER gene , which leads to the reduction of ER mRNA and ER expressions in monocytes .", + "output": [ + "000000000000012000000012010000" + ] + }, + { + "input": "Functional characterization of novel IL - 2 transcriptional inhibitors .", + "output": [ + "0000122000" + ] + }, + { + "input": "IL - 2 - mediated T cell proliferation is a critical early event in the inflammatory process .", + "output": [ + "122000000000000000" + ] + }, + { + "input": "Using a cell line that is stably transfected with a trimer of the NFAT - 1 regulatory element linked to a lac - Z reporter gene , we screened for inhibitors of NFAT - 1 - mediated beta - galactosidase activity .", + "output": [ + "000000000000012222000122220000001000012200" + ] + }, + { + "input": "WIN 61058 and WIN 53071 were identified as microM inhibitors .", + "output": [ + "00000000000" + ] + }, + { + "input": "These compounds also inhibited beta - galactosidase mRNA levels .", + "output": [ + "0000122200" + ] + }, + { + "input": "Similar inhibition of NFAT - 1 - mediated gene expression was observed in a second cell line , which is stably transfected with NFAT - 1 regulatory elements linked to the reporter gene for sCD8 .", + "output": [ + "000100000000000000000001222200012220" + ] + }, + { + "input": "At 10 microM , both compounds inhibited IL - 2 mRNA and protein levels in the NFAT - 1 - linked lac - Z transfectants , and in human lymphocytes .", + "output": [ + "0000000000000000000000000000000" + ] + }, + { + "input": "Both compounds inhibited the mixed lymphocyte reaction , and this inhibition was reversed by exogenous IL - 2 .", + "output": [ + "0000000000000001220" + ] + }, + { + "input": "Conversely , calcium - independent anti - CD28 Ab and PMA - induced IL - 2 production was resistant .", + "output": [ + "00122222200001220000" + ] + }, + { + "input": "Both compounds altered the NFAT - 1 transcriptional complex , causing its retarded mobility on gels .", + "output": [ + "00001222200000000" + ] + }, + { + "input": "By these functional criteria , we believe we have identified two structurally distinct , novel inhibitors of NFAT - 1 - mediated transcription .", + "output": [ + "000000000000000001000000" + ] + }, + { + "input": "Transcriptional regulation of the vacuolar H ( + ) - ATPase B2 subunit gene in differentiating THP - 1 cells .", + "output": [ + "000012222222220000000" + ] + }, + { + "input": "Monocyte - macrophage differentiation was used as a model system for studying gene regulation of the human vacuolar H ( + ) - ATPase ( V - ATPase ) .", + "output": [ + "000000000000000012222222012200" + ] + }, + { + "input": "We have begun to examine the structure of the B2 subunit promoter region .", + "output": [ + "00000000012220" + ] + }, + { + "input": "Isolation and sequencing of the first exon and 5 ' - flanking region of this gene reveal a TATA - less promoter with a high G + C content .", + "output": [ + "000001201222200000122200000000" + ] + }, + { + "input": "We found that sequences downstream from the transcriptional start site were sufficient to confer increased expression during THP - 1 differentiation .", + "output": [ + "0000000000000000000000" + ] + }, + { + "input": "DNase I footprinting and sequence analysis revealed the existence of multiple AP2 and Sp1 binding sites in the 5 ' - untranslated and proximal coding regions .", + "output": [ + "120000000001222200122222220" + ] + }, + { + "input": "Synergy between signal transduction pathways is obligatory for expression of c - fos in B and T cell lines : implication for c - fos control via surface immunoglobulin and T cell antigen receptors .", + "output": [ + "00000000001220000000001220012012220" + ] + }, + { + "input": "Expression of the protooncogene c - fos is controlled by three main regulatory pathways involving kinase C , cAMP , and calcium .", + "output": [ + "00012220000000012000000" + ] + }, + { + "input": "Kinase C mediates its effects via phosphorylation of serum response factor ( SRF ) which interacts with the serum response element ( SRE ) ; cAMP and calcium mediate their effects via phosphorylation of CREB ( cAMP regulatory element binding protein ) presumably by activation of a protein kinase A or calmodulin - regulated kinase .", + "output": [ + "12000000122010000012201000000000001012222000000122012220" + ] + }, + { + "input": "We have found that stimulation of any one of these pathways alone has little or no effect on c - fos induction .", + "output": [ + "00000000000000000012200" + ] + }, + { + "input": "However , kinase C activation ( PMA stimulation ) combined with either cAMP ( forskolin plus MIX ) or calcium stimulation ( ionophore ) leads to greatly enhanced c - fos induction .", + "output": [ + "001200000000000000000000000012200" + ] + }, + { + "input": "By contrast , cAMP in the presence of calcium shows no synergy in c - fos induction .", + "output": [ + "000000000000012200" + ] + }, + { + "input": "Analysis of AP - 1 activity using gel mobility shift assays confirms that the requirements for synergy in c - fos mRNA induction are paralleled by requirements for synergy in induction of AP - 1 activity .", + "output": [ + "0012200000000000001222000000000012200" + ] + }, + { + "input": "Signaling in B cells due to anti - Ig stimulation involves both kinase C activation and release of intracellular calcium , and results in c - fos mRNA induction .", + "output": [ + "000000122000120000000000122200" + ] + }, + { + "input": "Our results indicate that synergy between the kinase C activation and calcium is needed for efficient c - fos induction since neither of these two alone induces c - fos well .", + "output": [ + "00000001200000001220000000012200" + ] + }, + { + "input": "That synergy of signaling pathways is relevant for the anti - Ig induction of c - fos is supported by the fact that cAMP - inducing agents and okadaic acid further enhance anti - Ig induction of c - fos .", + "output": [ + "00000000012200122000000000000000122001220" + ] + }, + { + "input": "The human granulocyte - macrophage CSF ( GM - CSF ) gene is expressed in T cells in response to TCR activation that can be mimicked by treatment of the cells with PMA and Ca2 + ionophore .", + "output": [ + "01222222222200000000100000000000000000" + ] + }, + { + "input": "The gene contains a proximal functional promoter region ( - 620 to + 34 ) , as well as a powerful enhancer located 3 kb upstream , both of which are involved in the response of the gene to TCR activation .", + "output": [ + "000012220122220000000100000000000000000100" + ] + }, + { + "input": "The proximal promoter contains a region termed CLEO ( - 54 to - 31 ) that consists of a purine - rich element abutting an activator protein - 1 ( AP - 1 ) - like site , as well as an upstream nuclear factor - kappa B ( NF - kappa B ) site ( - 85 to - 76 ) and a CK - 1 element ( - 101 to - 92 ) .", + "output": [ + "0120000101222200000122200122222222222000001222222222222012222000122201222200" + ] + }, + { + "input": "We show in this work that mutations in either the purine - rich region of the CLEO element or the NF - kappa B site result in reduced PMA / Ca2 + activation of a 620 - bp human GM - CSF promoter - luciferase reporter construct in Jurkat T cells by 65 % and 50 % , respectively .", + "output": [ + "000000000012220012001222200000000001222222222220000000000000" + ] + }, + { + "input": "The major inducible protein complex that binds to the human CLEO ( hCLEO ) element is an AP - 1 - like complex that is inducible by PMA alone , but shows increased binding in response to PMA together with Ca2 + ionophore .", + "output": [ + "00122000012222200122222000000000000000000000" + ] + }, + { + "input": "Although the binding of this complex is not cyclosporin - sensitive , promoter induction is inhibited by cyclosporin treatment .", + "output": [ + "00000000000000000000" + ] + }, + { + "input": "A second weak inducible complex resembling nuclear factor of activated T cells ( NF - AT ) was also observed binding to the hCLEO region .", + "output": [ + "00000012222201220000000120" + ] + }, + { + "input": "By using recombinant proteins , we confirmed that AP - 1 , NF - ATp , and a higher order NF - ATp / AP - 1 complex could all form with the hCLEO element , and we have also defined the sequence requirements for binding of each of these complexes .", + "output": [ + "0012000012201220000012222222000001200000000000000000" + ] + }, + { + "input": "We found that expression of a constitutively active form of calcineurin could substitute for Ca2 + ionophore and synergize with PMA to activate the GM - CSF promoter , and conversely that mutant - activated Ras could substitute for PMA and cooperate with Ca2 + ionophore .", + "output": [ + "00000000001000000000000012220000122200000000000" + ] + }, + { + "input": "Co - expression of Ras and calcineurin , however , did not activate the GM - CSF promoter , but required the additional expression of NF - kappa B p65 .", + "output": [ + "0000101000000012220000000122220" + ] + }, + { + "input": "IL - 10 induces the tyrosine phosphorylation of tyk2 and Jak1 and the differential assembly of STAT1 alpha and STAT3 complexes in human T cells and monocytes .", + "output": [ + "0000000010100000120120000000" + ] + }, + { + "input": "IL - 10 affects monocytes and T cells by driving the progression of immune responsiveness such that Th2 lymphocyte - mediated effects predominate .", + "output": [ + "122000000000000000000000" + ] + }, + { + "input": "Moreover , monocytes express a novel IL - 10 - stimulated STAT protein with an M ( r ) of 70 kDa that is recognized by the anti - STAT3 Ab but is not observed in T cells .", + "output": [ + "000000122222200000001200000122200000000" + ] + }, + { + "input": "Use of new biologic markers in the ovulation induction .", + "output": [ + "0000000000" + ] + }, + { + "input": "Biological markers of ovulation , after a great in the past , have been fallen into disuse for the large diffusion of biochemical and biophysical ones .", + "output": [ + "000000000000000000000000000" + ] + }, + { + "input": "To explore the modifications of not reproductive target tissues as ovulation markers we studied the behaviour of Albuminemia , Platelet Factor IV ( as indicator of Platelet Aggregation ) , Type II estrogenic receptors in 42 ovulation induced women , undergoing our observation .", + "output": [ + "00000000000000000001220000000012220000000000" + ] + }, + { + "input": "33 of them had ovulation and 9 developed a LUF syndrome , constituting two biological models of an opposite situation for the three markers observed .", + "output": [ + "00000000000000000000000000" + ] + }, + { + "input": "All the markers considered were sufficiently sensitive , but among them , Platelet Factor IV was the most reliable to the hormonal ovulatory situation .", + "output": [ + "0000000000001220000000000" + ] + }, + { + "input": "Abnormal regulation of the IL - 2 promoter in lpr CD4 - CD8 - T lymphocytes results in constitutive expression of a novel nuclear factor of activated T cells - binding factor .", + "output": [ + "000012220000000000000012222222220" + ] + }, + { + "input": "The inert quality of MRL - Ipr / Ipr ( Ipr ) peripheral CD4 - CD8 - ( CD4 - 8 - ) T cells manifests primarily as an inability to proliferate or produce IL - 2 in response to TCR or mitogenic stimulation .", + "output": [ + "000000000000000000000000000000000012200010000" + ] + }, + { + "input": "Yet these same cells do initiate early TCR - mediated signaling events , such as generation of inositol phosphates and increased intracellular calcium .", + "output": [ + "000000010000000000000000" + ] + }, + { + "input": "We , therefore , compared the activation state of the IL - 2 gene promoter region in freshly isolated and stimulated Ipr CD4 - 8 - T cells with that of normal T lymphocytes .", + "output": [ + "00000000001222220000000000000000000" + ] + }, + { + "input": "Upon stimulation with mitogens , formation of the transactivating complex , nuclear factor of activated T cells ( NF - AT ) , occurs with normal kinetics in Ipr CD4 - 8 - T cells .", + "output": [ + "000000000001222220122000000000000000" + ] + }, + { + "input": "Yet , the levels of the activating NF - AT complex never reach those observed in similarly stimulated normal T cells .", + "output": [ + "0000000122200000000000" + ] + }, + { + "input": "Furthermore , nuclear extracts from Ipr CD4 - 8 - T cells display high levels of a novel specific binding activity at the NF - AT site , which is present at much lower levels in freshly isolated normal T lymphocytes .", + "output": [ + "000000000000000000000001222000000000000000" + ] + }, + { + "input": "Upon mitogenic stimulation , the binding activity of the novel NF - AT - binding factor is rapidly down - regulated in normal T cells , but persists at high levels in Ipr CD4 - 8 - T cells .", + "output": [ + "0000000000122222000000000000000000000000" + ] + }, + { + "input": "These two abnormalities at the NF - AT site provide a potential mechanism to account for the defect in IL - 2 production from Ipr CD4 - 8 - T cells .", + "output": [ + "00000122200000000001220000000000" + ] + }, + { + "input": "Cross - linking of CD30 induces HIV expression in chronically infected T cells .", + "output": [ + "00001000000000" + ] + }, + { + "input": "CD30 , a member of the tumor necrosis factor ( TNF ) receptor family , is expressed constitutively on the surface of the human T cell line ACH - 2 , which is chronically infected with human immunodeficiency virus type - 1 ( HIV ) - 1 .", + "output": [ + "100000000000000000000000000000000000000000000000" + ] + }, + { + "input": "CD30 cross - linking does not alter proliferation of ACH - 2 cells and the induction of HIV expression is not mediated by endogenous TNF alpha / beta .", + "output": [ + "10000000000000000000000012220" + ] + }, + { + "input": "Furthermore , cross - linking of CD30 leads to NF - kappa B activation and enhanced HIV transcription .", + "output": [ + "0000001001222000000" + ] + }, + { + "input": "Thus , CD30 - CD30L interactions mediate the induction of HIV expression by a kappa B - dependent pathway that is independent of TNF .", + "output": [ + "0011200000000000000000010" + ] + }, + { + "input": "This mechanism may be important in the activation of HIV expression from latently infected CD4 + T cells , especially in lymphoid organs where cell to cell contact is conducive to receptor - ligand interactions .", + "output": [ + "000000000000000000000000000000000000" + ] + }, + { + "input": "Human MHC class II gene transcription directed by the carboxyl terminus of CIITA , one of the defective genes in type II MHC combined immune deficiency .", + "output": [ + "012220000120100001200010000" + ] + }, + { + "input": "Four distinct complementation groups have been identified .", + "output": [ + "00000000" + ] + }, + { + "input": "Recently , the defective gene in group II type II MHC CID has been isolated and termed CIITA .", + "output": [ + "0001200000100000010" + ] + }, + { + "input": "The specificity of CIITA for three major MHC class II genes , DR , DQ and DP , is mediated by its remaining C - terminal residues ( amino acids 317 - 1130 ) .", + "output": [ + "00010001222010101000000122201222200" + ] + }, + { + "input": "The transactivation of multiple cis elements , especially S and X2 , of the DR alpha proximal promoter in group II CID cells is CIITA dependent .", + "output": [ + "000122001010001222000000100" + ] + }, + { + "input": "Since CIITA overexpression in normal cells did not increase class II expression , we propose that initiation of CIITA expression serves as the on - off switch , while availability of downstream interactor ( s ) limits transcription .", + "output": [ + "010000000000000000100000000000000000000" + ] + }, + { + "input": "Monocyte tethering by P - selectin regulates monocyte chemotactic protein - 1 and tumor necrosis factor - alpha secretion .", + "output": [ + "00012201222201222200" + ] + }, + { + "input": "Signal integration and NF - kappa B translocation [ see comments ]", + "output": [ + "000122200000" + ] + }, + { + "input": "Adhesion molecules that tether circulating leukocytes to endothelial cells may also transduce or modulate outside - in signals for cellular activation , providing an initial regulatory point in the inflammatory response .", + "output": [ + "12000000000000000000000000000000" + ] + }, + { + "input": "Adhesion of human monocytes to P - selectin , the most rapidly expressed endothelial tethering factor , increased the secretion of monocyte chemotactic protein - 1 ( MCP - 1 ) and tumor necrosis factor - alpha ( TNF - alpha ) by the leukocytes when they were stimulated with platelet - activating factor .", + "output": [ + "0000012200000122000001222201220012222012200000000012220" + ] + }, + { + "input": "Increased cytokine secretion was specifically inhibited by G1 , an anti - P - selectin mAb that prevents P - selectin from binding to its ligand ( P - selectin glycoprotein ligand - 1 ) on myeloid cells .", + "output": [ + "000000010012222200122000000122222200000" + ] + }, + { + "input": "Moreover , tethering by P - selectin specifically enhanced nuclear translocation of nuclear factor - kappa B ( NF - kappa B ) , a transcription factor required for expression of MCP - 1 , TNF - alpha , and other immediate - early genes .", + "output": [ + "0000122000001222201222000120000122012200012220" + ] + }, + { + "input": "Functional roles of in vivo footprinted DNA motifs within an alpha - globin enhancer .", + "output": [ + "000122220012220" + ] + }, + { + "input": "Erythroid lineage and developmental stage specificities .", + "output": [ + "0000000" + ] + }, + { + "input": "Transcriptional regulation of the human alpha - like globin genes , embryonic zeta 2 and adult alpha , during erythroid development is mediated by a distal enhancer , HS - 40 .", + "output": [ + "00001222220122012000000001201220" + ] + }, + { + "input": "Previous protein - DNA binding studies have shown that HS - 40 consists of multiple nuclear factor binding motifs that are occupied in vivo in an erythroid lineage - and developmental stage - specific manner .", + "output": [ + "000000000122000122200000000000000000" + ] + }, + { + "input": "We have systematically analyzed the functional roles of these factor binding motifs of HS - 40 by site - directed mutagenesis and transient expression assay in erythroid cell cultures .", + "output": [ + "000000000122012200000000000000" + ] + }, + { + "input": "Three of these HS - 40 enhancer motifs , 5 ' NF - E2 / AP1 , GT II , and GATA - 1 ( c ) , positively regulate the zeta 2 - globin promoter activity in embryonic / fetal erythroid K562 cells and the adult alpha - globin promoter activity in adult erythroid MEL cells .", + "output": [ + "0001222201222222012001222220000122220000000000122220000000" + ] + }, + { + "input": "On the other hand , the 3 ' NF - E2 / AP1 motif is able to exert both positive and negative regulatory effects on the zeta 2 - globin promoter activity in K562 cells , and this dual function appears to be modulated through differential binding of the ubiquitous AP1 factors and the erythroid - enriched NF - E2 factor .", + "output": [ + "00000012222222000000000000122220000000000000000001220012222220" + ] + }, + { + "input": "Mutation in the GATA - 1 ( d ) motif , which exhibits an adult erythroid - specific genomic footprint , decreases the HS - 40 enhancer function in dimethyl sulfoxide - induced MEL cells but not in K562 cells .", + "output": [ + "00012222220000122222000122200000000000000" + ] + }, + { + "input": "These studies have defined the regulatory roles of the different HS - 40 motifs .", + "output": [ + "000000000012220" + ] + }, + { + "input": "The remarkable correlation between genomic footprinting data and the mutagenesis results also suggests that the erythroid lineage - and developmental stage - specific regulation of human alpha - like globin promoters is indeed modulated by stable binding of specific nuclear factors in vivo .", + "output": [ + "00000000000000000000000001222220000000122000" + ] + }, + { + "input": "Nitric oxide - stimulated guanine nucleotide exchange on p21ras .", + "output": [ + "0000000010" + ] + }, + { + "input": "The protooncogene p21ras , a monomeric G protein family member , plays a critical role in converting extracellular signals into intracellular biochemical events .", + "output": [ + "012001222200000000000000" + ] + }, + { + "input": "The mechanism of activation is due to S - nitrosylation of a critical cysteine residue which stimulates guanine nucleotide exchange .", + "output": [ + "000000000000000000000" + ] + }, + { + "input": "Interleukin - 2 promoter activity in Epstein - Barr virus - transformed B lymphocytes is controlled by nuclear factor - chi B .", + "output": [ + "12220000000000000122220" + ] + }, + { + "input": "The regulation of interleukin ( IL ) - 2 gene expression has been investigated mainly in T lymphocytes , the predominant producers of IL - 2 .", + "output": [ + "000122222200000000000001220" + ] + }, + { + "input": "However , B cells can also synthesize IL - 2 .", + "output": [ + "00000001220" + ] + }, + { + "input": "An IL - 2 promoter bearing a defective NF - chi B site was completely inactive in EBV - transformed B cells , while it still had activity in Jurkat T cells .", + "output": [ + "012220001222200000000000000000000" + ] + }, + { + "input": "Similarly , a human immunodeficiency virus promoter , whose activity is controlled through chi B factors , was found to be active in the IL - 2 producing EBV - B cells , but inactive in the non - IL - 2 - producing cells .", + "output": [ + "0001222000000122000000000000000000000000000000" + ] + }, + { + "input": "Electrophoretic mobility shift assays using protein extracts from EBV - B cells and the IL - 2 NF - chi B probe revealed the constitutive generation of chi B complexes in IL - 2 - secreting cells consisting mainly of heterodimeric p50 / p65 complexes .", + "output": [ + "0000000000000012212220000001220000000000122220" + ] + }, + { + "input": "A weaker chi B complex formation and faster - migrating complexes were detected in non - IL - 2 - secreting cells .", + "output": [ + "00120000000000000000000" + ] + }, + { + "input": "These results demonstrate that the IL - 2 NF - chi B site is indispensable for the activity of the IL - 2 promoter in EBV - transformed B cells , whereas other transcription factors appear to be less important for IL - 2 expression in these cells .", + "output": [ + "0000012222222000000012220000000001200000012200000" + ] + }, + { + "input": "The normal cell cycle is regulated by several molecules , such as the tumor - suppressor protein pRb , the G1 cyclins , the cyclin - dependent kinases , and their inhibitors .", + "output": [ + "000000000000012222001200122200000" + ] + }, + { + "input": "These regulators are targeted by negative growth regulatory signals , such as that provided by TGF - beta .", + "output": [ + "0000000000000001220" + ] + }, + { + "input": "Chemical cross - linking with 125I - labeled TGF - beta 1 showed an essentially normal TGF - beta receptor profile in EBV - positive and EBV - negative Burkitt ' s lymphoma cell lines , and these receptors were shown to be functional in transducing signals , as evidenced by the TGF - beta 1 - mediated modulation of junB gene expression .", + "output": [ + "0000012222220000122200000000000000000000000000000000122200001200" + ] + }, + { + "input": "However , TGF - beta 1 did not induce dephosphorylation of pRb in EBV ( or LMP - 1 ) - positive cells as opposed to EBV - negative cells , suggesting a dichotomy in the TGF - beta 1 signaling pathway leading to separable gene regulatory and growth inhibitory responses .", + "output": [ + "0012220000010000000000000000000000001222000000000000" + ] + }, + { + "input": "Furthermore , LMP - 1 was found to induce the expression of cyclin D2 ; normal B cells or EBV - negative Burkitt ' s lymphoma cells do not express D - type cyclins .", + "output": [ + "00122000000012000000000000000012220" + ] + }, + { + "input": "Taken together , these data point to a potential mechanism underlying EBV - mediated B cell transformation whereby constitutive induction of key cell cycle regulators by LMP - 1 can lead to pRb hyperphosphorylation and uncontrolled cell proliferation .", + "output": [ + "000000000000000000000122201220001000000" + ] + }, + { + "input": "The effect of treatment on thyroid antibody production and T cell reactivity to thyroid antigens was studied in 15 patients with Graves ' disease ( GD ) before and after thyroidectomy , 19 patients with GD before and after radioactive iodine ( RAI ) therapy , and 9 patients maintained euthyroid on antithyroid drugs ( ATD ) .", + "output": [ + "0000000000000000000000000000000000000000000000000000000000" + ] + }, + { + "input": "Twenty subjects matched for age and sex without known thyroid disease served as controls .", + "output": [ + "000000000000000" + ] + }, + { + "input": "In GD patients , the responses of peripheral blood mononuclear cells ( PBMC ) and TSH receptor ( TSHR ) - specific T cell lines to recombinant human TSHR extracellular domain , thyroglobulin , and TSHR peptides were examined on the day of surgery or RAI therapy ( day 0 ) and also 6 - 8 weeks and 3 - 6 months thereafter .", + "output": [ + "0000000000000000000000000012222010010000000000000000000000000000" + ] + }, + { + "input": "Reactivity to TSHR peptides before surgery was heterogeneous and spanned the entire extracellular domain .", + "output": [ + "001000000000120" + ] + }, + { + "input": "Six to 8 weeks after subtotal thyroidectomy , the number of patients ' PBMC responding to any peptide and the average number of recognized peptides decreased .", + "output": [ + "000000000000000000000000000" + ] + }, + { + "input": "The responses of PBMC from Graves ' patients before RAI therapy were less than those in the presurgical group .", + "output": [ + "00000000000000000000" + ] + }, + { + "input": "Three to 6 months after RAI , T cell responses to TSHR peptides were less than those 6 - 8 weeks after RAI therapy , but still higher than the values on day 0 .", + "output": [ + "00000000000100000000000000000000000" + ] + }, + { + "input": "Responses of PBMC from patients with GD , maintained euthyroid on ATD , were lower than those before surgery or RAI therapy .", + "output": [ + "00000000000000000000000" + ] + }, + { + "input": "The difference in the number of recognized peptides by patients ' PBMC before RAI and surgery may reflect the effect of long term therapy with ATD in the patients before RAI vs . the shorter period in patients before surgery .", + "output": [ + "00000000000000000000000000000000000000000" + ] + }, + { + "input": "The decreased T cell reactivity to thyroid antigens after thyroidectomy could be the result of removal of a major part of the thyroid gland or redistribution of suppressor - inducer T cells .", + "output": [ + "000000120000000000000000000000000" + ] + }, + { + "input": "The increased T cell response after RAI therapy is probably epitope specific , rather than a response to the whole TSHR molecule .", + "output": [ + "00000000000000000000100" + ] + }, + { + "input": "Synchronous recognition of peptides 158 - 176 and 248 - 263 is important for the development of GD , and the loss of recognition of one of these epitopes may be an early sign of immune remission and a predictor of euthyroidism .", + "output": [ + "0000000000000000000000000000100000000000000" + ] + }, + { + "input": "Circumvention of tolerance for the nuclear T cell protein TCF - 1 by immunization of TCF - 1 knock - out mice .", + "output": [ + "00000122212200012200000" + ] + }, + { + "input": "Molecular events that underlie the well - defined phenotypic changes of the differentiating thymocyte are poorly understood .", + "output": [ + "000000000000000000" + ] + }, + { + "input": "A candidate gene to control thymocyte differentiation , T cell factor - 1 ( TCF - 1 ) * encodes a DNA - binding protein .", + "output": [ + "00000000122220122000012220" + ] + }, + { + "input": "Its mRNA expression pattern is complex during embryogenesis , yet restricted to lymphocytes postnatally .", + "output": [ + "000000000000000" + ] + }, + { + "input": "Expression studies on TCF - 1 protein have been hampered by the difficulty to raise antibodies due to extreme evolutionary conservation .", + "output": [ + "0001222000000001000000" + ] + }, + { + "input": "TCF - 1 knock - out mice , generated recently in our laboratory , have strongly decreased numbers of thymocytes , but are otherwise normal .", + "output": [ + "12200000000000000000000000" + ] + }, + { + "input": "We have used these mice to generate anti - TCF - 1 antibodies .", + "output": [ + "00000001222220" + ] + }, + { + "input": "By immunization with a recombinant fusion protein , we show that TCF - 1 knock - out mice readily yield antiserum titers against human and mouse TCF - 1 protein .", + "output": [ + "0000122000012200000000000000000" + ] + }, + { + "input": "Wild - type littermates remain unresponsive to TCF - 1 while they mount a high - titer antibody response to the fusion protein , Maltose Binding Protein ( MBP ) .", + "output": [ + "0000000122000000000001201220100" + ] + }, + { + "input": "Subsequently , TCF - 1 - specific hybridomas could be prepared from the spleens of immunized knock - out mice .", + "output": [ + "000000000000000000000" + ] + }, + { + "input": "This study illustrates the almost complete tolerance of mice for human TCF - 1 and demonstrates that this tolerance is readily broken by gene knock - out .", + "output": [ + "0000000000122200000000000000" + ] + }, + { + "input": "Furthermore , the usefulness of knock - out mice for the generation of monoclonal antibodies against the gene product of interest is underscored .", + "output": [ + "000000000000012000000000" + ] + }, + { + "input": "The transcription factor , Nm23H2 , binds to and activates the translocated c - myc allele in Burkitt ' s lymphoma .", + "output": [ + "0120100000001222000000" + ] + }, + { + "input": "The PuF site on the silent normal c - myc allele was unoccupied .", + "output": [ + "01200122222000" + ] + }, + { + "input": "We demonstrated by electrophoretic mobility shift assay , electrophoretic mobility shift assay with antibody , UV cross - linking followed by SDS - gel electrophoresis , and Western analysis that Nm23H2 in B cell nuclear extracts bound to the c - myc PuF site .", + "output": [ + "000000000000000000000000000000100000000000120" + ] + }, + { + "input": "Access to this site is blocked in the normal silent c - myc allele ; these data suggest that the Nm23H2 protein is involved in deregulation of the translocated c - myc allele in Burkitt ' s lymphoma cells .", + "output": [ + "0000000012222200000010000000012220000000" + ] + }, + { + "input": "Identification of two novel regulatory elements within the 5 ' - untranslated region of the human A gamma - globin gene .", + "output": [ + "0000120012222001222220" + ] + }, + { + "input": "Interaction between the stage selector element ( SSE ) in the proximal gamma - globin promoter and hypersensitivity site 2 in the locus control region partly mediates the competitive silencing of the beta - globin promoter in the fetal developmental stage .", + "output": [ + "000122000001222201220012200000001222000000" + ] + }, + { + "input": "We have now demonstrated that a second SSE - like element in the 5 ' - untranslated region of the gamma - gene also contributes to this competitive silencing of the beta - gene .", + "output": [ + "00000001222001222200122000000001220" + ] + }, + { + "input": "Utilizing transient transfection assays in the fetal erythroid cell line , K562 , we have shown that the core enhancer of hypersensitivity site 2 can preferentially interact with the proximal gamma - promoter in the absence of the SSE , completely silencing a linked beta - promoter .", + "output": [ + "000000000000000000120122000001222000001000012220" + ] + }, + { + "input": "Mutation of a 20 - base pair sequence of the gamma - gene 5 ' - untranslated region ( UTR ) led to derepression of beta - promoter activity .", + "output": [ + "000000000012222222010000012200" + ] + }, + { + "input": "A marked activation of gamma - promoter activity was also observed with this mutation , suggesting the presence of a repressor .", + "output": [ + "0000122000000000000000" + ] + }, + { + "input": "Fine mutagenesis dissected these activities to different regions of the 5 ' - UTR .", + "output": [ + "000000000012220" + ] + }, + { + "input": "The stage selector activity was localized to a region centered on nucleotides + 13 to + 15 .", + "output": [ + "000000000001222220" + ] + }, + { + "input": "The repressor activity of the 5 ' - UTR was localized to tandem GATA - like sites , which appear to bind a complex of two proteins , one of which is the erythroid transcription factor GATA - 1 .", + "output": [ + "0000012220000122200000000000000001221220" + ] + }, + { + "input": "Coupling of a signal response domain in I kappa B alpha to multiple pathways for NF - kappa B activation .", + "output": [ + "000122012220000122200" + ] + }, + { + "input": "The eukaryotic transcription factor NF - kappa B plays a central role in the induced expression of human immunodeficiency virus type 1 and in many aspects of the genetic program mediating normal T - cell activation and growth .", + "output": [ + "012212220000000000000000000000000000000" + ] + }, + { + "input": "The nuclear activity of NF - kappa B is tightly regulated from the cytoplasmic compartment by an inhibitory subunit called I kappa B alpha .", + "output": [ + "0000122200000000012012220" + ] + }, + { + "input": "This cytoplasmic inhibitor is rapidly phosphorylated and degraded in response to a diverse set of NF - kappa B - inducing agents , including T - cell mitogens , proinflammatory cytokines , and viral transactivators such as the Tax protein of human T - cell leukemia virus type 1 .", + "output": [ + "00000000000000012222220012222120012000120000000000" + ] + }, + { + "input": "To explore these I kappa B alpha - dependent mechanisms for NF - kappa B induction , we identified novel mutants of I kappa B alpha that uncouple its inhibitory and signal - transducing functions in human T lymphocytes .", + "output": [ + "0001222000012220000000122200000000000000" + ] + }, + { + "input": "Specifically , removal of the N - terminal 36 amino acids of I kappa B alpha failed to disrupt its ability to form latent complexes with NF - kappa B in the cytoplasm .", + "output": [ + "0000012222201222000000000012220000" + ] + }, + { + "input": "Growth regulation and cellular changes during differentiation of human prostatic cancer LNCaP cells as induced by T lymphocyte - conditioned medium .", + "output": [ + "0000000000000000000000" + ] + }, + { + "input": "Addition of CM caused a greater than 70 % reduction of cell proliferation by cell counting and cell cycle .", + "output": [ + "00000000000000000000" + ] + }, + { + "input": "These cells showed G1 phase arrest and the clonogenicity was reduced .", + "output": [ + "000000000000" + ] + }, + { + "input": "The growth - modulating effect was dose - dependent and not due to cell lysis or apoptosis .", + "output": [ + "000000000000000000" + ] + }, + { + "input": "The binding of androgen to androgen receptor on these cells showed approximately 50 % reduction , underlining a proliferation reduction mechanism .", + "output": [ + "0000012000000000000000" + ] + }, + { + "input": "The prostate - specific antigen ( PSA ) was downregulated to approximately 75 % during the process .", + "output": [ + "012220100000000000" + ] + }, + { + "input": "The expression of several cytoskeleton and intracellular proteins increased as determined by immunostaining on slides and by ELISA procedures .", + "output": [ + "00001222000000000000" + ] + }, + { + "input": "From these cellular changes , we can infer that the cell growth was modulated along with induction of terminal differentiation .", + "output": [ + "000000000000000000000" + ] + }, + { + "input": "Activated T cells were demonstrated to be important in providing the modulating activity .", + "output": [ + "00000000000000" + ] + }, + { + "input": "This growth modulator was semipurified and had an estimated molecular weight 13 , 000 to 24 , 000 Da .", + "output": [ + "01200000000000000000" + ] + }, + { + "input": "The activity was determined to be distinct from TGF , TNF , and some commonly known lymphokines .", + "output": [ + "000000001010000010" + ] + }, + { + "input": "The interaction between lymphoid and prostatic cells in growth and development is described .", + "output": [ + "00000000000000" + ] + }, + { + "input": "Platelet - activating factor stimulates transcription of the heparin - binding epidermal growth factor - like growth factor in monocytes .", + "output": [ + "122200001222222222000" + ] + }, + { + "input": "Correlation with an increased kappa B binding activity .", + "output": [ + "000000000" + ] + }, + { + "input": "The PAF - induced up - regulation of HB - EGF mRNA was accompanied by an increase in kappa B binding activity .", + "output": [ + "01000000122200000000000" + ] + }, + { + "input": "Pretreatment of monocytes with pertussis toxin inhibited these functions of PAF , whereas cholera toxin had no inhibitory effect .", + "output": [ + "00000000001000000000" + ] + }, + { + "input": "Pyrrolidine dithiocarbamate , an inhibitor for NF - kappa B activation , markedly reduced PAF - stimulated kappa B binding activity as well as up - regulation of HB - EGF mRNA .", + "output": [ + "000000122200001000000000000012220" + ] + }, + { + "input": "These results suggest a potential role of PAF in HB - EGF expression and provide evidence that this stimulation may occur through increased kappa B binding activity .", + "output": [ + "0000000101220000000000000000" + ] + }, + { + "input": "Mapping of the interaction site of the defective transcription factor in the class II major histocompatibility complex mutant cell line clone - 13 to the divergent X2 - box .", + "output": [ + "000120012200000000000000012220" + ] + }, + { + "input": "We have previously described a mutant B lymphoblastoid cell line , Clone - 13 , that expresses HLA - DQ in the absence of HLA - DR and - DP .", + "output": [ + "0000000000000000012200001222220" + ] + }, + { + "input": "Indeed , transient transfection of HLA - DRA and DQB reporter constructs indicated that the affected factor operates via cis - elements located between - 141 base pairs and the transcription initiation site .", + "output": [ + "0000012222220000000122001222001220" + ] + }, + { + "input": "A series of hybrid DRA / DQB reporter constructs was generated to further map the relevant cis - elements in this system .", + "output": [ + "00012222200000001220000" + ] + }, + { + "input": "Insertion of oligonucleotides spanning the DQB X - box ( but not the DQB - W region or the DQB Y - box ) upstream of - 141 in a DRA reporter plasmid rescued expression to nearly wild - type levels .", + "output": [ + "000001222000012220012220122200122000000000" + ] + }, + { + "input": "Substitution promoters were then generated where the entire X - box , or only the X1 - or X2 - boxes of HLA - DRA were replaced with the analogous regions of HLA - DQB .", + "output": [ + "000000001220000122222012200000001220" + ] + }, + { + "input": "None of the hybrid reporter constructs were defective when transfected into the wild - type , HLA - DR / - DQ positive parental cell line , Jijoye .", + "output": [ + "00012200000012200000000000000" + ] + }, + { + "input": "These studies suggest that the divergent X2 - box of the class II major histocompatibility complex promoters plays an important role in influencing differential expression of the human class II isotypes .", + "output": [ + "00000122200122222000000000012220" + ] + }, + { + "input": "Restoration of the Epstein - Barr virus ZEBRA protein ' s capacity to disrupt latency by the addition of heterologous activation regions .", + "output": [ + "00012222200000000001220" + ] + }, + { + "input": "The ZEBRA protein has a unique biological function among herpesviral proteins .", + "output": [ + "012000000120" + ] + }, + { + "input": "It is responsible for the disruption of Epstein - Barr virus ( EBV ) latency and the induction of the lytic cycle .", + "output": [ + "00000000000000000000000" + ] + }, + { + "input": "We have employed the ZEBRA / EBV biological system to test whether a heterologous activation domain can substitute for another activation domain ( the ZEBRA domain ) .", + "output": [ + "0000100000000122000000001200" + ] + }, + { + "input": "The ZEBRA activation region was replaced with the potent acid activation region from the herpes simplex virus VP16 protein or with the activation region of the EBV R protein .", + "output": [ + "012200000122001222200012001220" + ] + }, + { + "input": "Activation was not target - or cell - type dependent , nor was it dependent on the presence of virus .", + "output": [ + "000000000000000000000" + ] + }, + { + "input": "These studies suggest that the specificities of some of the known biological functions of ZEBRA are not dependent upon the nature of the activation domain present within ZEBRA .", + "output": [ + "00000000000000100000000122010" + ] + }, + { + "input": "Interleukin 4 activates a signal transducer and activator of transcription ( Stat ) protein which interacts with an interferon - gamma activation site - like sequence upstream of the I epsilon exon in a human B cell line .", + "output": [ + "120000000122220000122222220001220000000" + ] + }, + { + "input": "Evidence for the involvement of Janus kinase 3 and interleukin - 4 Stat .", + "output": [ + "00000122012220" + ] + }, + { + "input": "Germ line C transcripts can be induced by IL - 4 in the human B cell line , BL - 2 .", + "output": [ + "1222000012200000000000" + ] + }, + { + "input": "Utilizing a IFN - gamma activation site - like DNA sequence element located upstream of the I epsilon exon , we demonstrated by gel mobility shift assays that IL - 4 induced a binding activity in the cytosol and nucleus of BL - 2 cells .", + "output": [ + "0012222222220000122000000000122000000000000000" + ] + }, + { + "input": "This factor was designated IL - 4 NAF ( IL - 4 - induced nuclear - activating factors ) and was identified as a tyrosine phosphoprotein , which translocates from the cytosol to the nucleus upon IL - 4 treatment .", + "output": [ + "00001222012222222200000012000000000012200" + ] + }, + { + "input": "Congruous with the involvement of a Stat protein , IL - 4 induced robust Janus kinase 3 ( JAK3 ) activity in BL - 2 cells .", + "output": [ + "000000120122001220100000000" + ] + }, + { + "input": "Cotransfection of JAK3 with IL - 4 Stat into COS - 7 cells produced an intracellular activity which bound the same IFN - gamma activation site - like sequence and comigrated with IL - 4 NAF in electrophoretic mobility shift assay .", + "output": [ + "001012220000000000000122222220001222000000" + ] + }, + { + "input": "These results show that IL - 4 NAF is IL - 4 Stat , which is activated by JAK3 in response to IL - 4 receptor engagement .", + "output": [ + "0000122201222000001000122000" + ] + }, + { + "input": "Does activation of the TAL1 gene occur in a majority of patients with T - cell acute lymphoblastic leukemia ? A pediatric oncology group study .", + "output": [ + "00001200000000000000000000" + ] + }, + { + "input": "Almost 25 % of patients with T - cell acute lymphoblastic leukemia ( T - ALL ) have tumor - specific rearrangements of the TAL1 gene .", + "output": [ + "000000000000000000000000120" + ] + }, + { + "input": "Although TAL1 expression has not been observed in normal lymphocytes , TAL1 gene products are readily detected in leukemic cells that harbor a rearranged TAL1 allele .", + "output": [ + "010000000001220000000001220" + ] + }, + { + "input": "Hence , it has been proposed that ectopic expression of TAL1 promotes the development of T - ALL .", + "output": [ + "0000000000100000000" + ] + }, + { + "input": "In this report , we show that TAL1 is expressed in the leukemic cells of most patients with T - ALL , including many that do not display an apparent TAL1 gene alteration .", + "output": [ + "0000000100000000000000000000001200" + ] + }, + { + "input": "A polymorphic dinucleotide repeat in the transcribed sequences of TAL1 was used to determine the allele specificity of TAL1 transcription in primary T - ALL cells .", + "output": [ + "000000000100000000100000000" + ] + }, + { + "input": "Thus , TAL1 activation in these patients may result from subtle alterations in cis - acting regulatory sequences ( affecting expression of a single TAL1 allele ) or changes in trans - acting factors that control TAL1 transcription ( affecting expression of both TAL1 alleles ) .", + "output": [ + "00100000000001222200000122000000000010000001200" + ] + }, + { + "input": "To clarify properties of the blast cells in M7 and TMD cases , we examined erythroid markers expression in blasts from six cases with M7 and seven cases with TMD in this study .", + "output": [ + "0000000000000000000000000000000000" + ] + }, + { + "input": "We also found that mRNAs encoding GATA - 1 and GATA - 2 are expressed in all these cases .", + "output": [ + "00001012201220000000" + ] + }, + { + "input": "Expression of Ah receptor ( TCDD receptor ) during human monocytic differentiation .", + "output": [ + "0012012000000" + ] + }, + { + "input": "We have previously found a high expression of human Ah receptor ( TCDD receptor ) mRNA in peripheral blood cells of individuals .", + "output": [ + "00000000122222220000000" + ] + }, + { + "input": "Then the expression levels of AhR mRNA in various hematopoietic cell lines were examined together with those of Arnt and P450IA1 .", + "output": [ + "0000012000000000001010" + ] + }, + { + "input": "AhR was expressed at high levels in monocytoid U937 , THP1 , and HEL / S cells , and at moderate levels in promyelocytic HL60 cells and erythroblastic HEL cells .", + "output": [ + "1000000000000000000000000000000" + ] + }, + { + "input": "However , it was not detected in lymphoid cells MOLT4 ( T cell ) and BALL1 ( B cell ) , nor in K562 erythroblasts .", + "output": [ + "00000000000000000000000000" + ] + }, + { + "input": "Furthermore , a specific induction of AhR during monocytic differentiation was investigated in HL60 and HEL cells .", + "output": [ + "000000100000000000" + ] + }, + { + "input": "HL60 cells were induced to differentiate toward monocytes - macrophages by incubation with phorbol ester , showing a 5 - to 2 - fold increase of AhR mRNA .", + "output": [ + "00000000000000000000000000120" + ] + }, + { + "input": "The HEL cells also exhibited a similar elevation of AhR mRNA level , when they had differentiated toward monocyte - macrophage cells by these combined inducers , but little change in the mRNA level was observed when the cells were induced to differentiate into other cell types .", + "output": [ + "000000000120000000000000000000000000000000000000" + ] + }, + { + "input": "Treatment of the differentiated HL60 cells with 3 - methylcholanthrene , a ligand of AhR , induced the expression of the P450IA1 gene .", + "output": [ + "000000000000001000000100" + ] + }, + { + "input": "These results indicated that expression of AhR mRNA was significantly induced during monocytic differentiation and that the differentiated cells were responsive to xenobiotics .", + "output": [ + "000000120000000000000000" + ] + }, + { + "input": "Our results suggest that AhR may play an important role in the function of monocytes and also in the eventual activation of environmental carcinogens .", + "output": [ + "0000100000000000000000000" + ] + }, + { + "input": "Neutrophils and monocytes express high levels of PU . 1 ( Spi - 1 ) but not Spi - B .", + "output": [ + "000000012201220001220" + ] + }, + { + "input": "PU . 1 ( the Spi - 1 oncogene ) and Spi - B are closely related members of the ets transcription factor family , sharing similar DNA binding specificities mediated by similar DNA binding domains .", + "output": [ + "1220012220012200000012220000000001220" + ] + }, + { + "input": "PU . 1 and Spi - B have been previously described as being predominantly expressed coordinately in macrophages and B cells , but their expression in early hematopoietic stages and during the course of myeloid differentiation to monocytes and macrophages or to neutrophils has not been extensively investigated .", + "output": [ + "1220122000000000000000000000000000000000000000000" + ] + }, + { + "input": "Here , we report that PU . 1 mRNA is upregulated during myeloid differentiation of human purified CD34 + cells and murine multipotential FDCP - mix A4 cells , suggesting that PU . 1 is upregulated as an early event during differentiation of multipotential progenitor cells .", + "output": [ + "00000122200000000000000000000001220000000000000" + ] + }, + { + "input": "PU . 1 expression is maintained at stable levels during differentiation of myeloid cell lines U937 and HL - 60 to monocytic and neutrophilic cells .", + "output": [ + "12200000000000000000000000" + ] + }, + { + "input": "PU . 1 is expressed at highest levels in mature human monocytes and human peripheral blood neutrophils .", + "output": [ + "122000000000000000" + ] + }, + { + "input": "In contrast to PU . 1 , significant levels of Spi - B mRNA and protein are found only in some B - cell lines and spleen but are not found in myeloid cell lines , neutrophils , or macrophages .", + "output": [ + "00012200001222000000000000000000000000000" + ] + }, + { + "input": "Therefore , although PU . 1 and Spi - B may bind to similar DNA control elements and have redundancy of transactivation function in vitro , the lack of significant levels of Spi - B in myeloid cells makes it unlikely that Spi - B plays a significant role in myeloid lineage development and gene expression .", + "output": [ + "000122012200000000000000000000001220000000122000000000000" + ] + }, + { + "input": "Identification of a major positive regulatory element located 5 ' to the human zeta - globin gene .", + "output": [ + "000012200000122220" + ] + }, + { + "input": "The function of the zeta - globin promoter was studied using a series of zeta - globin promoter deletion constructs to drive luciferase expression in transiently transfected human erythroleukemia cells .", + "output": [ + "0000122200000012222200100000000" + ] + }, + { + "input": "When the constructs were transfected into OCIM1 cells , which do not express zeta - globin , the zeta - globin promoters were at best 20 % as active as the alpha - globin promoters .", + "output": [ + "000000000000012200122200000000012220" + ] + }, + { + "input": "When sequences from - 417 to - 207 5 ' to the zeta - globin mRNA cap site were deleted , up to 95 % of the zeta - globin promoter activity was lost in K562 cells .", + "output": [ + "01222222220012222200000000012220000000" + ] + }, + { + "input": "Reinsertion of these sequences into zeta - luciferase constructs missing the - 417 to - 207 region showed that the sequences lack classical enhancer activity .", + "output": [ + "00000122200000000000000000" + ] + }, + { + "input": "Point mutation of a GATA - 1 site at - 230 reduced promoter activity by 37 % .", + "output": [ + "000012220000000000" + ] + }, + { + "input": "Point mutation of a CCACC site at - 240 had no effect .", + "output": [ + "0000120000000" + ] + }, + { + "input": "Electrophoretic mobility shift assays indicated that the - 230 GATA - 1 site has a relatively low affinity for GATA - 1 .", + "output": [ + "00000001222220000001220" + ] + }, + { + "input": "These experiments show the presence of a strong positive - acting element , located between - 417 and - 207 bp 5 ' to the zeta - globin mRNA cap site , is necessary for high - level promoter activity in K562 cells .", + "output": [ + "00000000122200012222222001222220000000000000" + ] + }, + { + "input": "Analysis of the role of protein kinase C - alpha , - epsilon , and - zeta in T cell activation .", + "output": [ + "0000012222222222200000" + ] + }, + { + "input": "T cells express multiple isotypes of protein kinase C ( PKC ) and although it is well accepted that PKCs have an important role in T cell activation , little is known about the function of individual PKC isotypes .", + "output": [ + "0000001220100000000100000000000000000120" + ] + }, + { + "input": "p21ras plays an essential role in T cell activation .", + "output": [ + "1000000000" + ] + }, + { + "input": "The data indicate that PKC - epsilon and , to a lesser extent PKC - alpha but not - zeta , can regulate the transcription factors AP - 1 and nuclear factor of activated T cells ( NF - AT - 1 ) .", + "output": [ + "00001220000001220012000012122001222201222200" + ] + }, + { + "input": "PKC - epsilon , but not PKC - alpha nor activated p21ras , was able to induce NF - KB activity .", + "output": [ + "1220001220010000012200" + ] + }, + { + "input": "Phorbol esters induce expression of CD69 whereas none of the activated PKC isotypes tested were able to have this effect .", + "output": [ + "000001000012200000000" + ] + }, + { + "input": "Activated Src and p21ras were able to induce CD69 expression .", + "output": [ + "01010000100" + ] + }, + { + "input": "Although glucocorticosteroids are a very effective treatment for asthma and other chronic inflammatory diseases , a small proportion of patients are resistant to their therapeutic effects .", + "output": [ + "000000000000000000000000000" + ] + }, + { + "input": "The molecular mechanism for this steroid resistance is unclear .", + "output": [ + "0000000000" + ] + }, + { + "input": "Steroid resistance can not be explained by pharmacokinetic mechanisms , by a defect in the binding of steroids to glucocorticoid receptors , nor by defective nuclear translocation of this receptor , thereby suggesting that the molecular abnormality lies distal to nuclear translocation .", + "output": [ + "0000000000000000000120000000000000000000000" + ] + }, + { + "input": "The binding of the glucocorticoid receptor to DNA in these patients was also studied using Scatchard analysis .", + "output": [ + "000012000000000000" + ] + }, + { + "input": "Dexamethasone induced a significant rapid and sustained twofold increase in GRE binding in PBMCs from steroid - sensitive asthmatic patients and nonasthmatic individuals , but this was markedly reduced in steroid - resistant asthmatic patients .", + "output": [ + "000000000010000000000000000000000000" + ] + }, + { + "input": "These results suggest that the ability of the glucocorticoid receptor to bind to GRE is impaired in steroid - resistant patients because of a reduced number of receptors available for binding to DNA .", + "output": [ + "0000000012000100000000000001000000" + ] + }, + { + "input": "At present , not much is known about the molecular mechanisms by which interleukin - 5 ( IL - 5 ) exerts its diverse biologic effects .", + "output": [ + "000000000000012201220000000" + ] + }, + { + "input": "Human eosinophils are one of the most important target cells for IL - 5 and were used here to study IL - 5 signaling in a primary human cell .", + "output": [ + "000000000001220000001220000000" + ] + }, + { + "input": "IL - 5 induced rapid and transient tyrosine phosphorylation of JAK2 .", + "output": [ + "122000000010" + ] + }, + { + "input": "Moreover , IL - 5 induced at least two DNA - binding complexes , using nuclear extracts from normal human eosinophils and the IL - 6 / interferon - gamma response element of the ICAM - 1 promoter ( ICAM - 1 pIRE ) in an electromobility shift assay .", + "output": [ + "00122000012220000000000122222222001222012220000000" + ] + }, + { + "input": "Both DNA - binding complexes were inhibited by a phosphotyrosine antibody ( 4G10 ) , suggesting that tyrosine phosphorylation is required for complex formation .", + "output": [ + "0122200001201000000000000" + ] + }, + { + "input": "IL - 3 and granulocyte - macrophage colony - stimulating factor induced , similar to IL - 5 , two DNA - binding complexes in human eosinophils , including Stat1 alpha .", + "output": [ + "12201222222000012200122200000120" + ] + }, + { + "input": "These data show for the first time that molecular mechanisms of IL - 5 signaling in human eosinophils involve members of the JAK kinase family as well as members of the Stat family .", + "output": [ + "0000000000012200000000122000000120" + ] + }, + { + "input": "Infection and replication of Tat - human immunodeficiency viruses : genetic analyses of LTR and tat mutations in primary and long - term human lymphoid cells .", + "output": [ + "000000000000010120000000000" + ] + }, + { + "input": "Tat is an essential regulatory protein for the replication of human immunodeficiency virus ( HIV ) .", + "output": [ + "10001200000000000" + ] + }, + { + "input": "Mutations in the tat gene have been shown to block HIV replication in human T cells .", + "output": [ + "00012000000000000" + ] + }, + { + "input": "Several studies have established that Tat releases an elongation block to the transcription of HIV long terminal repeat ( LTR ) ; however , it is not known whether this mechanism alone is sufficient to explain the block to HIV replication in human T cells when Tat is absent .", + "output": [ + "00000100120000122201000000000000000000000000001000" + ] + }, + { + "input": "It is possible that Tat is also needed for other functions during HIV replication .", + "output": [ + "000010000000000" + ] + }, + { + "input": "To test these hypotheses , we studied several tat mutants , including two stop codon mutants and one deletion mutant using replication - competent HIV - 1 constructs carrying wild - type or mutant LTRs with modifications in the NF - kappa B and / or Sp1 binding sites .", + "output": [ + "00000000120001220012012222220122222000012222222220" + ] + }, + { + "input": "In this study , we show that Tat - HIV - 1 with wild - type LTRs can replicate in HeLa cells , and the virus produced from HeLa cells can infect primary peripheral blood lymphocytes and macrophages .", + "output": [ + "000000000000012220000000000000000000000" + ] + }, + { + "input": "Large amounts of viral RNA and particles were synthesized in infections established using the tat mutants that contain modified LTRs .", + "output": [ + "000120000000001200120" + ] + }, + { + "input": "However , this efficient propagation of the LTR - modified tat mutants was restricted to some lymphoid cell lines that have been transformed with other viruses .", + "output": [ + "000000012222000000000000000" + ] + }, + { + "input": "Thus , despite its essential role for releasing an elongation block , Tat is not otherwise absolutely required for synthesis of full - length HIV transcripts and assembly of virus particles .", + "output": [ + "00000000012010000000012222000000" + ] + }, + { + "input": "Direct sequencing of the viral genomes and reinfection kinetics showed no evidence of wild - type reversion even after prolonged infection with the Tat - virus .", + "output": [ + "000012000000000000000001000" + ] + }, + { + "input": "The implications for in vivo HIV - 1 replication and potential application of this system to the study of alternative Tat function are discussed .", + "output": [ + "0000000000000000000010000" + ] + }, + { + "input": "Functional roles of the transcription factor Oct - 2A and the high mobility group protein I / Y in HLA - DRA gene expression .", + "output": [ + "0000122220012221220122200" + ] + }, + { + "input": "The class II major histocompatibility complex gene HLA - DRA is expressed in B cells , activated T lymphocytes , and in antigen - presenting cells .", + "output": [ + "012222212200000000000000000" + ] + }, + { + "input": "In addition , HLA - DRA gene expression is inducible in a variety of cell types by interferon - gamma ( IFN - gamma ) .", + "output": [ + "00012220000000000122012200" + ] + }, + { + "input": "Coexpression of HMG I / Y and Oct - 2 in cell lines lacking Oct - 2 results in high levels of HLA - DRA gene expression , and in vitro DNA - binding studies reveal that HMG I / Y stimulates Oct - 2A binding to the HLA - DRA promoter .", + "output": [ + "00122201220000122000001222000000000000122012200012220" + ] + }, + { + "input": "Thus , Oct - 2A and HMG I / Y may synergize to activate HLA - DRA expression in B cells .", + "output": [ + "0012201222000012200000" + ] + }, + { + "input": "By contrast , Oct - 2A is not involved in the IFN - gamma induction of the HLA - DRA gene in HeLa cells , but antisense HMG I / Y dramatically decreases the level of induction .", + "output": [ + "00012200000122000122200000122220000000" + ] + }, + { + "input": "Heterogeneous expression of Epstein - Barr virus latent proteins in endemic Burkitt ' s lymphoma .", + "output": [ + "0001222220000000" + ] + }, + { + "input": "Epstein - Barr virus ( EBV ) - infected cells may sustain three distinct forms of virus latency .", + "output": [ + "0000000000000000000" + ] + }, + { + "input": "This form of latency , termed latency III , is also encountered in some posttransplant lymphoproliferative disorders .", + "output": [ + "000000000000000000" + ] + }, + { + "input": "We have studied the expression of EBV proteins in 17 cases of EBV - positive endemic BL by immunohistology .", + "output": [ + "00000012000000000000" + ] + }, + { + "input": "The activation of the Jak - STAT 1 signaling pathway by IL - 5 in eosinophils .", + "output": [ + "00001122000122000" + ] + }, + { + "input": "The intracellular signal transduction of IL - 5 in eosinophils is unknown .", + "output": [ + "0000012200000" + ] + }, + { + "input": "The objective of this study was to investigate the involvement of the newly discovered Jak - STAT pathway in the IL - 5 signal transduction mechanism .", + "output": [ + "000000000000001120001220000" + ] + }, + { + "input": "The involvement of Jak 2 was investigated by immunoprecipitation followed by immunoblotting for tyrosine phosphorylation .", + "output": [ + "0001200000000000" + ] + }, + { + "input": "The activation of Jak 2 was studied by autophosphorylation of the immunoprecipitated kinase .", + "output": [ + "00012000000120" + ] + }, + { + "input": "Jak 2 was tyrosine phosphorylated within 1 to 3 min after stimulation of eosinophils with IL - 5 .", + "output": [ + "1200000000000001220" + ] + }, + { + "input": "Further , the immunoprecipitated Jak 2 obtained from IL - 5 - stimulated cells underwent autophosphorylation .", + "output": [ + "00012200000000000" + ] + }, + { + "input": "Jak 2 coprecipitated with the beta - subunit of the IL - 5 receptor , suggesting a physical association of the kinase with the receptor .", + "output": [ + "12000000001222000000010000" + ] + }, + { + "input": "The nuclear factor STAT - 1 ( p91 ) was investigated by immunoprecipitation followed by immunoblotting for tyrosine phosphorylation .", + "output": [ + "01222201000000000000" + ] + }, + { + "input": "STAT - 1 was tyrosine phosphorylated within 15 min of IL - 5 stimulation .", + "output": [ + "122000000012200" + ] + }, + { + "input": "The presence of STAT - 1 in the nuclear extract was studied by electrophoretic mobility shift assay .", + "output": [ + "000122000000000000" + ] + }, + { + "input": "IL - 5 induced two proteins that bound to the gamma - activating sequence .", + "output": [ + "122000000012220" + ] + }, + { + "input": "In the presence of an anti - STAT - 1 Ab , the band was supershifted .", + "output": [ + "00000122222000000" + ] + }, + { + "input": "Thus , we demonstrated that IL - 5 activated the Jak 2 - STAT 1 signaling pathway in eosinophils .", + "output": [ + "00000122001212200000" + ] + }, + { + "input": "We speculate that the Jak 2 - STAT 1 pathway may be involved in the activation of IL - 5 - inducible genes in eosinophils .", + "output": [ + "00001212200000000122222000" + ] + }, + { + "input": "Reduced mitogenic stimulation of peripheral blood mononuclear cells as a prognostic parameter for the course of breast cancer : a prospective longitudinal study .", + "output": [ + "000000000000000000000000" + ] + }, + { + "input": "In the present study , the proliferation of peripheral blood mononuclear cells ( PBMCs ) in response to mitogenic stimulation with phytohaemagglutinin ( PHA ) was assessed prospectively in 90 patients with stage I - III breast cancer .", + "output": [ + "000000000000000000000101000000000000000" + ] + }, + { + "input": "After an additional 6 months ( i . e . 12 months after surgery ) , PHA - induced proliferation of PBMCs was similar in patients after adjuvant chemotherapy with CMF and in those receiving continued adjuvant tamoxifen treatment ( P > 0 . 1 ) , but in all patients still significantly decreased as compared with healthy controls ( P < 0 . 001 ) .", + "output": [ + "0000000000000000100000000000000000000000000000000000000000000000000" + ] + }, + { + "input": "When data obtained preoperatively and after 12 months were compared , it was found that out of 23 patients whose PBMCs had experienced a drop in their PHA - induced proliferation , 14 ( 61 % ) had developed metastatic disease within the subsequent 24 months ( i . e . 36 months after surgery ) .", + "output": [ + "000000000000000000000000000100000000000000000000000000000" + ] + }, + { + "input": "In contrast , out of 59 patients whose PBMCs showed an increase in their PHA - induced proliferation within the first 12 months after surgery , only one ( 2 % ) presented with disease progression .", + "output": [ + "0000000000000010000000000000000000000" + ] + }, + { + "input": "Activation of transcription by binding of NF - E1 ( YY1 ) to a newly identified element in the first exon of the human DR alpha gene .", + "output": [ + "0000001220100000000000012220" + ] + }, + { + "input": "Mutations in this DNA - binding site abolished binding of a nuclear factor in human B cell nuclear extract and decreased the activity of the DR alpha promoter to a basal level .", + "output": [ + "000122200001200000000000012200000" + ] + }, + { + "input": "Significant sequence homology of this element was found in the DNA of the DR beta , DP alpha and - beta , and DQ alpha genes , always located downstream of the transcriptional start site .", + "output": [ + "000001000000012222222222220000001220" + ] + }, + { + "input": "It was identified as NF - E1 ( YY1 ) .", + "output": [ + "00001220100" + ] + }, + { + "input": "This protein , previously identified by its binding to the Ig kappa 3 ' enhancer and the Ig heavy chain mu E1 site , thus also appears to be quite important in the regulation of MHC class II gene expression .", + "output": [ + "00000000001222200122222000000000000122200" + ] + }, + { + "input": "Transcriptional activity of core binding factor - alpha ( AML1 ) and beta subunits on murine leukemia virus enhancer cores .", + "output": [ + "000122222222200122220" + ] + }, + { + "input": "Core binding factor ( CBF ) , also known as polyomavirus enhancer - binding protein 2 and SL3 enhancer factor 1 , is a mammalian transcription factor that binds to an element termed the core within the enhancers of the murine leukemia virus family of retroviruses .", + "output": [ + "12201000001222220122200012200000000001000000000" + ] + }, + { + "input": "The core elements of the SL3 virus are important genetic determinants of the ability of this virus to induce T - cell lymphomas and the transcriptional activity of the viral long terminal repeat in T lymphocytes .", + "output": [ + "0120000000000000000000000000012220000" + ] + }, + { + "input": "CBF consists of two subunits , a DNA binding subunit , CBF alpha , and a second subunit , CBF beta , that stimulates the DNA binding activity of CBF alpha .", + "output": [ + "10000001220120000001200000000120" + ] + }, + { + "input": "This locus is rearranged by chromosomal translocations in human myeloproliferative disorders and leukemias .", + "output": [ + "00000000000000" + ] + }, + { + "input": "An exogenously expressed Cbf alpha 2 - encoded subunit ( CBF alpha 2 - 451 ) stimulated transcription from the SL3 enhancer in P19 and HeLa cells .", + "output": [ + "0001222220122220000012010000" + ] + }, + { + "input": "Activity was mediated through the core elements .", + "output": [ + "00000120" + ] + }, + { + "input": "The longest form , CBF beta - 187 , increased the transcriptional stimulation by CBF alpha 2 - 451 twofold in HeLa cells , although it had no effect in P19 cells .", + "output": [ + "000012220000001222200000000000000" + ] + }, + { + "input": "Transcriptional activation by CBF beta required binding to the CBF alpha subunit , as a form of CBF beta that lacked binding ability , CBF beta - 148 , failed to increase activity .", + "output": [ + "0001200001220000012000001222000000" + ] + }, + { + "input": "They also provided support for the hypothesis that CBF is a factor in T lymphocytes that is responsible for recognition of the SL3 cores .", + "output": [ + "0000000010000000000000120" + ] + }, + { + "input": "This difference strongly affects transcription in T cells and leukemogenicity of SL3 .", + "output": [ + "0000000000010" + ] + }, + { + "input": "Thus , a complete understanding of how T cells recognize the SL3 core remains to be elucidated .", + "output": [ + "000000000001200000" + ] + }, + { + "input": "Interleukin ( IL ) - 10 inhibits nuclear factor kappa B ( NF kappa B ) activation in human monocytes .", + "output": [ + "122222012220122000000" + ] + }, + { + "input": "IL - 10 and IL - 4 suppress cytokine synthesis by different mechanisms .", + "output": [ + "12201220100000" + ] + }, + { + "input": "Our previous studies in human monocytes have demonstrated that interleukin ( IL ) - 10 inhibits lipopolysaccharide ( LPS ) - stimulated production of inflammatory cytokines , IL - 1 beta , IL - 6 , IL - 8 , and tumor necrosis factor ( TNF ) - alpha by blocking gene transcription .", + "output": [ + "000000000122222000000000120122201220122001222222200000" + ] + }, + { + "input": "This selective inhibition by IL - 10 of NF kappa B activation occurs rapidly and in a dose - dependent manner and correlates well with IL - 10 ' s cytokine synthesis inhibitory activity in terms of both kinetics and dose responsiveness .", + "output": [ + "0000122012200000000000000122001000000000000" + ] + }, + { + "input": "IL - 4 , another cytokine that inhibits cytokine mRNA accumulation in monocytes , shows little inhibitory effect on LPS - induced NF kappa B activation .", + "output": [ + "122001001200000000000012200" + ] + }, + { + "input": "Further examination reveals that , unlike IL - 10 , IL - 4 enhances mRNA degradation and does not suppress cytokine gene transcription .", + "output": [ + "000000122012201000000000" + ] + }, + { + "input": "These data indicate that IL - 10 and IL - 4 inhibit cytokine production by different mechanisms .", + "output": [ + "000012201220100000" + ] + }, + { + "input": "LMP - 1 activates NF - kappa B by targeting the inhibitory molecule I kappa B alpha .", + "output": [ + "122012220001222220" + ] + }, + { + "input": "LMP - 1 , an Epstein - Barr virus membrane protein expressed during latent infection , has oncogenic properties , as judged from its ability to transform B lymphocytes and rodent fibroblasts .", + "output": [ + "122001222220000000000000000000000" + ] + }, + { + "input": "LMP - 1 induces the expression of bcl2 , an oncogene which protects cells from apoptosis , as well as of genes encoding other proteins involved in cell regulation and growth control .", + "output": [ + "122000010010000000000000000000000" + ] + }, + { + "input": "The mechanisms by which LMP - 1 upregulates these proteins is unknown , but it is plausible that LMP - 1 modifies signal transduction pathways that result in the activation of one or more transcription factors that ultimately regulate transcription of oncogenic genes .", + "output": [ + "00001220000000000012200000000000001200000120" + ] + }, + { + "input": "NF - kappa B , a transcription factor controlling the expression of genes involved in cell activation and growth control , has been shown to be activated by LMP - 1 .", + "output": [ + "12220012000010000000000000001220" + ] + }, + { + "input": "The mechanism ( s ) regulating this activation remains unknown .", + "output": [ + "00000000000" + ] + }, + { + "input": "Our data indicate that increased NF - kappa B DNA binding and functional activity are present in B - lymphoid cells stably or transiently expressing LMP - 1 .", + "output": [ + "00000122200000000000000001220" + ] + }, + { + "input": "I kappa B alpha is selectively modified in LMP - 1 - expressing B cells .", + "output": [ + "1222000000000000" + ] + }, + { + "input": "A phosphorylated form of I kappa B alpha and increased protein turnover - degradation correlate with increased NF - kappa B nuclear translocation .", + "output": [ + "000012220000000001222000" + ] + }, + { + "input": "This results in increased transcription of NF - kappa B - dependent - genes , including those encoding p105 and I kappa B alpha ( MAD3 ) .", + "output": [ + "0000001222222200001012220100" + ] + }, + { + "input": "These results indicate that LMP - 1 activates NF - kappa B in B - cell lines by targeting I kappa B alpha .", + "output": [ + "000012201222000000012220" + ] + }, + { + "input": "Identification of the pathways activated by LMP - 1 to result in posttranslational modifications of I kappa B alpha will aid in determining the role of this virus - host cell protein interaction in Epstein - Barr virus - mediated oncogenesis .", + "output": [ + "000000122000000122200000000000000000000000" + ] + }, + { + "input": "Identification of human TR2 orphan receptor response element in the transcriptional initiation site of the simian virus 40 major late promoter [ published erratum appears in J Biol Chem 1995 Nov 3 ; 270 ( 44 ) : 26721 ]", + "output": [ + "0012222200122001222220000000000000000000" + ] + }, + { + "input": "A DNA response element ( TR2RE - SV40 ) for the TR2 orphan receptor , a member of the steroid - thyroid hormone receptor superfamily , has been identified in the simian virus 40 ( SV40 ) + 55 region ( nucleotide numbers 368 - 389 , 5 ' - GTTAAGGTTCGTAGGTCATG - 3 ' ) .", + "output": [ + "01220122000122000001222220000001222222220122220000000000" + ] + }, + { + "input": "Electrophoretic mobility shift assay , using in vitro translated TR2 orphan receptor with a molecular mass of 67 kilodaltons , showed a specific binding with high affinity ( dissociation constant = 9 nM ) for this DNA sequence .", + "output": [ + "000000000122000001200000000000000000000" + ] + }, + { + "input": "DNA - swap experiments using chloramphenicol acetyl - transferase assay demonstrated that androgen can suppress the transcriptional activities of SV40 early promoter via the interaction between this TR2RE - SV40 and the chimeric receptor AR / TR2 / AR with the DNA - binding domain of the TR2 orphan receptor flanked by the N - terminal and androgen - binding domains of the androgen receptor .", + "output": [ + "000001222000000000012200000122001222222001222001220001222222200120" + ] + }, + { + "input": "Together , these data suggest the TR2RE - SV40 may represent the first identified natural DNA response element for the TR2 orphan receptor that may function as a repressor for the SV40 gene expression .", + "output": [ + "00000012200000012200122000000000000" + ] + }, + { + "input": "Detection of the chromosome 16 CBF beta - MYH11 fusion transcript in myelomonocytic leukemias .", + "output": [ + "000122222220000" + ] + }, + { + "input": "Karyotypic detection of chromosomal 16 abnormalities classically associated with AML M4Eo can be difficult .", + "output": [ + "000000000000000" + ] + }, + { + "input": "Characterization of the two genes involved in the inv ( 16 ) ( p13q22 ) , CBF beta and MYH11 , has allowed the detection of fusion transcripts by reverse - transcriptase polymerase chain reaction ( RT - PCR ) .", + "output": [ + "00000000000000001201000000120000000000000" + ] + }, + { + "input": "All 11 typical AML M4Eo were CBF beta - MYH11 positive .", + "output": [ + "000000121200" + ] + }, + { + "input": "The single case of AML M4 with distinctive eosinophil abnormalities was negative by karyotype , RT - PCR and fluorescent in situ hybridization ( FISH ) .", + "output": [ + "000000000000000000000000000" + ] + }, + { + "input": "Three of 29 ( 10 % ) AML M4 without abnormal eosinophils were CBF beta - MYH11 positive , 1 of which did not show any apparent chromosome 16 abnormalities by classical metaphase analysis ( 2 not tested ) .", + "output": [ + "0000000000000121200000000001200000000000" + ] + }, + { + "input": "None of the other leukemias were RT - PCR positive .", + "output": [ + "00000000000" + ] + }, + { + "input": "These data show that CBF beta - MYH11 fusion transcripts occur not only in the vast majority of typical AML M4Eo , but also in approximately 10 % of AML M4 without eosinophilic abnormalities , a much higher incidence than the sporadic reports of chromosome 16 abnormalities in AML M4 would suggest .", + "output": [ + "00001222220000000000000000000000000000000000120000000" + ] + }, + { + "input": "Taken together with the detection of CBF beta - MYH11 transcripts in the absence of apparent chromosome 16 abnormalities by classical banding techniques , these data show that additional screening by either RT - PCR or FISH should be performed in all AML M4 , regardless of morphologic features , to allow accurate evaluation of the prognostic importance of this fusion transcript .", + "output": [ + "000000120120000012000000000000000000000000000000000000000000120" + ] + }, + { + "input": "This study demonstrates that human immunodeficiency virus type 1 ( HIV - 1 ) Tat protein amplifies the activity of tumor necrosis factor ( TNF ) , a cytokine that stimulates HIV - 1 replication through activation of NF - kappa B .", + "output": [ + "0000122222222222000012201000000000000012220" + ] + }, + { + "input": "A similar potentiation of TNF effects was observed in Jurkat T cells and HeLa cells treated with soluble Tat protein .", + "output": [ + "000010000000000000120" + ] + }, + { + "input": "TNF - mediated activation of NF - kappa B and cytotoxicity involves the intracellular formation of reactive oxygen intermediates .", + "output": [ + "10000122200000000000" + ] + }, + { + "input": "Therefore , Tat - mediated effects on the cellular redox state were analyzed .", + "output": [ + "00100000000000" + ] + }, + { + "input": "In both T cells and HeLa cells HIV - 1 Tat suppressed the expression of Mn - dependent superoxide dismutase ( Mn - SOD ) , a mitochondrial enzyme that is part of the cellular defense system against oxidative stress .", + "output": [ + "00000001222000012222012200012000000000000" + ] + }, + { + "input": "Decreased Mn - SOD expression was associated with decreased levels of glutathione and a lower ratio of reduced : oxidized glutathione .", + "output": [ + "0122000000000000000000" + ] + }, + { + "input": "A truncated Tat protein ( Tat1 - 72 ) , known to transactivate the HIV - 1 long terminal repeat ( LTR ) , no longer affected Mn - SOD expression , the cellular redox state or TNF - mediated cytotoxicity .", + "output": [ + "001201220000001222220100000122000000010000" + ] + }, + { + "input": "Thus , our experiments demonstrate that the C - terminal region of HIV - 1 Tat is required to suppress Mn - SOD expression and to induce pro - oxidative conditions reflected by a drop in reduced glutathione ( GSH ) and the GSH : oxidized GSH ( GSSG ) ratio .", + "output": [ + "0000000122201222000012200000000000000001000000000000" + ] + }, + { + "input": "Molecular , cellular , and clinical considerations .", + "output": [ + "00000000" + ] + }, + { + "input": "However , optimal agents , doses , and / or schedules have yet to be defined despite extensive clinical application .", + "output": [ + "000000000000000000000" + ] + }, + { + "input": "These suggest that prolonged , i . e . 28 day , glucocorticoid therapy may be unnecessary as exposure to glucocorticoid induces down - regulation of glucocorticoid receptors .", + "output": [ + "00000000000000000000000000120" + ] + }, + { + "input": "Dexamethasone may be superior to prednisone in conventional equi - effective doses .", + "output": [ + "0000000000000" + ] + }, + { + "input": "Increasing success in the treatment of childhood acute lymphoblastic leukemia has led to increasing awareness of avascular necrosis of bone as a potentially disabling sequela of glucocorticoid therapy , especially in adolescent and young adult patients .", + "output": [ + "0000000000000000000000000000000000000" + ] + }, + { + "input": "Epstein - Barr virus nuclear protein 2 transactivation of the latent membrane protein 1 promoter is mediated by J kappa and PU . 1 .", + "output": [ + "1222222000122220001201220" + ] + }, + { + "input": "The previously characterized factors J kappa , PU . 1 , and AML1 bind to the LMP - 1 E2RE , along with six other unidentified factors ( LBF2 to LBF7 ) .", + "output": [ + "000012012200100012220000000010100" + ] + }, + { + "input": "Binding sites were mapped for each factor .", + "output": [ + "00000000" + ] + }, + { + "input": "LBF4 has a molecular mass of 105 kDa and is probably unrelated to PU . 1 .", + "output": [ + "10000000000001220" + ] + }, + { + "input": "LBF2 was found only in epithelial cell lines , whereas LBF3 , LBF5 , LBF6 , and LBF7 were not cell type specific .", + "output": [ + "100000000010101001000000" + ] + }, + { + "input": "Mutations of the AML1 - or LBF4 - binding sites had no effect on EBNA - 2 transactivation , whereas mutation of the PU . 1 - binding site completely eliminated EBNA - 2 responses .", + "output": [ + "000122222200001220000001222220012200" + ] + }, + { + "input": "A gst - EBNA - 2 fusion protein specifically depleted PU . 1 from nuclear extracts and bound in vitro translated PU . 1 , providing biochemical evidence for a direct EBNA - 2 - PU . 1 interaction .", + "output": [ + "0122222200122000000001220000000122122200" + ] + }, + { + "input": "Thus , EBNA - 2 transactivation of the LMP - 1 promoter is dependent on interaction with at least two distinct sequence - specific DNA - binding proteins , J kappa and PU . 1 .", + "output": [ + "001220001222000000000000122201201220" + ] + }, + { + "input": "LBF3 , LBF5 , LBF6 , or LBF7 may also be involved , since their binding sites also contribute to EBNA - 2 responsiveness .", + "output": [ + "1010100100000000000012200" + ] + }, + { + "input": "Lymphocyte glucocorticoid receptor : predictor of sertraline response in adolescent major depressive disorder ( MDD ) .", + "output": [ + "12200000000000000" + ] + }, + { + "input": "Major depressive disorder ( MDD ) in adolescents demonstrates resistance to tricyclic antidepressants and absence of hypercortisolemia .", + "output": [ + "000000000000000000" + ] + }, + { + "input": "In an open - label study , adolescents ( n = 20 ) meeting DSM - III - R criteria for MDD showed baseline lymphocyte GCII sites per cell ( sites / cell ) values of 793 + / - 106 versus 2 , 563 + / - 499 ( + / - SEM ) for matched controls ( n = 18 ) ( t = 3 . 5 ; df = 36 ; p < . 001 ) .", + "output": [ + "00000000000000000000000012200000000000000000000000000000000000000000000000000000" + ] + }, + { + "input": "GCII was bimodally distributed , with SRI responders differing from nonresponders ( t = 3 . 9 ; df = 14 ; p < . 001 ) .", + "output": [ + "1000000000000000000000000000" + ] + }, + { + "input": "GCII accurately classified 90 percent of sertraline responders and 80 percent of nonresponders .", + "output": [ + "10000000000000" + ] + }, + { + "input": "Only SRI responders showed GCII sites / cell upregulated after 6 weeks of treatment ( t = 2 . 1 , df = 10 ; p < . 05 ) .", + "output": [ + "0000100000000000000000000000000" + ] + }, + { + "input": "The tumor necrosis factor - alpha ( TNF alpha ) gene is an immediate early gene in activated T cells , in that it is rapidly induced without a requirement for protein synthesis .", + "output": [ + "0122222222200000000000000000000000" + ] + }, + { + "input": "Maximal induction of TNF alpha mRNA can be induced by treatment of T cells with calcium ionophores alone , via a calcineurin - dependent process that is blocked by cyclosporin A .", + "output": [ + "00012200000000000000010000000000" + ] + }, + { + "input": "We have previously identified a promoter element , kappa 3 , that is required for calcium - stimulated , cyclosporin A - sensitive induction of the TNF alpha gene in activated T cells .", + "output": [ + "0000012012000000000000000012200000" + ] + }, + { + "input": "Here , we demonstrate that the kappa 3 binding factor contains NFATp , a cyclosporin - sensitive DNA - binding protein required for interleukin - 2 gene transcription .", + "output": [ + "00000012220100122222200122200" + ] + }, + { + "input": "NFATp binds to two sites within the kappa 3 element , and occupancy of both sites is required for TNF alpha gene induction .", + "output": [ + "100000012200000000010000" + ] + }, + { + "input": "The involvement of NFATp in transcriptional activation of both the interleukin - 2 and TNF alpha genes suggests that this factor plays an important role in the coordinate induction of multiple cytokine genes , starting at the earliest stages of T cell activation .", + "output": [ + "00010000001220122000000000000001200000000000" + ] + }, + { + "input": "Regulation and specificity of MNDA expression in monocytes , macrophages , and leukemia / B lymphoma cell lines .", + "output": [ + "0000100000000000000" + ] + }, + { + "input": "The expression of the human myeloid cell nuclear differentiation antigen ( MNDA ) was observed specifically in cells of the granulocyte - macrophage lineage in our earlier reports .", + "output": [ + "00001222220100000000000000000" + ] + }, + { + "input": "The specificity of MNDA expression for cells in the granulocyte - macrophage lineage was reexamined in cell lines established from patients with Philadelphia chromosome - positive chronic myeloid leukemia .", + "output": [ + "000100000000000000000000000000" + ] + }, + { + "input": "Cell lines that expressed MNDA exhibited myeloid cell features and granulocyte or monocyte differentiation could be induced in vitro , while cell lines exhibiting properties of very early stage cells or multipotential cells did not express MNDA .", + "output": [ + "00001000000000000000000000000000000010" + ] + }, + { + "input": "Cells originating from cases of Burkitt ' s lymphoma were negative .", + "output": [ + "000000000000" + ] + }, + { + "input": "As we reported previously , MNDA mRNA level in adherent monocytes is elevated by IFN - alpha ; in this study , we further assessed MNDA expression in in vitro monocyte - derived macrophages .", + "output": [ + "00000120000000122000000001000000000" + ] + }, + { + "input": "Three additional agents ( endotoxin , phytohemagglutinin , and phorbol ester ) and other conditions that affect function , cytokine production , differentiation , and / or growth of monocytes were examined for their ability to alter MNDA expression .", + "output": [ + "0000001000000000000100000000000000000100" + ] + }, + { + "input": "The results also reveal a discordance in certain MNDA positive cells between steady - state levels or changes in levels of protein and mRNA indicating that the regulation of MNDA expression occurs at more than one point .", + "output": [ + "00000000000000000000000100000100000000" + ] + }, + { + "input": "Changes in MNDA expression are consistent with a role in opposing macrophage differentiation and activation of monocytes / macrophages .", + "output": [ + "00100000000000000000" + ] + }, + { + "input": "DNA - binding studies of the Epstein - Barr virus nuclear antigen 2 ( EBNA - 2 ) : evidence for complex formation by latent membrane protein gene promoter - binding proteins in EBNA - 2 - positive cell lines .", + "output": [ + "00000012222220122000000012222222000000000" + ] + }, + { + "input": "The Epstein - Barr virus ( EBV ) nuclear antigen 2 ( EBNA - 2 ) protein is essential for the immortalization of human primary B cells by EBV .", + "output": [ + "012222222220122000000000000000" + ] + }, + { + "input": "EBNA - 2 trans - activates cellular and viral genes like CD23 , c - fgr , latent membrane protein 1 ( LMP1 ) and terminal protein 1 ( TP1 ) .", + "output": [ + "12200012220101220122201001220100" + ] + }, + { + "input": "Trans - activation of the TP1 promoter and of the BamHI C promoter has already been investigated in detail and appears to be mediated via protein - protein interactions and not by direct binding of EBNA - 2 type A ( of EBV type 1 ) to the DNA .", + "output": [ + "00000120001220000000000000000000000122220000000000" + ] + }, + { + "input": "To determine whether EBNA - 2 also trans - activates the LMP promoter by protein - protein interactions , we performed a series of gel retardation assays and competition experiments with LMP promoter fragments of different sizes .", + "output": [ + "00012200000120000000000000000001220000" + ] + }, + { + "input": "We determined that the protein - binding region on the LMP promoter was within a 42 bp fragment encompassing nucleotides - 135 to - 176 relative to the LMP transcriptional start site .", + "output": [ + "000012220012000122000000000012220" + ] + }, + { + "input": "None of the DNA fragments investigated indicated interaction of EBNA - 2 with the DNA via protein - protein interactions .", + "output": [ + "000000000122000000000" + ] + }, + { + "input": "No significant differences between EBNA - 2 - positive and EBNA - 2 - negative nuclear extracts could be seen in the gel retardation assay under conditions that clearly showed binding of EBNA - 2A to the TP1 promoter .", + "output": [ + "0000122000122000000000000000000012200120" + ] + }, + { + "input": "However , analysis of sucrose gradient fractions in the gel retardation assay provided evidence that the LMP promoter - binding proteins form a complex of higher M ( r ) in EBNA - 2 - positive cell extracts .", + "output": [ + "000000000000000012222000000000000000000" + ] + }, + { + "input": "We deduce from these results that EBNA - 2 - positive cells might indeed contain specific complexes bound to the LMP promoter which are , however , too labile to be detected in a standard gel retardation assay .", + "output": [ + "000000000000000120001200000000000000000" + ] + }, + { + "input": "Simultaneous activation of Ig and Oct - 2 synthesis and reduction of surface MHC class II expression by IL - 6 .", + "output": [ + "0001012200000122001220" + ] + }, + { + "input": "Terminal differentiation of B cells to plasma cells in vivo is characterized by secretion of Ig and extinction of MHC class II expression on the cell surface .", + "output": [ + "0000000000000001000122000000" + ] + }, + { + "input": "We show that IL - 6 signaling leads to marked increases in the synthesis and secretion of Ig in clonal human B cell lines and newly isolated polyclonal B lymphocytes in vitro .", + "output": [ + "000122000000000001000000000000000" + ] + }, + { + "input": "The IL - 6 - induced cells resemble plasma cells in ultrastructure and in reduced expression of surface MHC class II .", + "output": [ + "0000000000000000012220" + ] + }, + { + "input": "Coordinate with temporal changes in Ig synthesis , the DNA - binding activity and the synthesis of the B cell - enriched transcription factor Oct - 2 are regulated .", + "output": [ + "000001000000000000122222122000" + ] + }, + { + "input": "T - cell functional regions of the human IL - 3 proximal promoter .", + "output": [ + "12222001222220" + ] + }, + { + "input": "The human interleukin - 3 ( IL - 3 ) gene is expressed almost exclusively in activated T cells .", + "output": [ + "01222222222000000000" + ] + }, + { + "input": "Its expression is regulated at both the transcriptional and post - transcriptional level .", + "output": [ + "00000000000000" + ] + }, + { + "input": "To define the regions of the gene required for transcription activation , we generated a series of reporter constructs containing different regions of the IL - 3 gene 5 ' and 3 ' flanking sequences .", + "output": [ + "000000000000000000000000122222222220" + ] + }, + { + "input": "Both positive and negative regulatory elements were identified in the proximal 5 ' flanking region of the IL - 3 gene .", + "output": [ + "0122220000122220012220" + ] + }, + { + "input": "The promoter region between - 173 and - 60 contained the strongest activating elements .", + "output": [ + "012012222000120" + ] + }, + { + "input": "The transcription factor AP - 1 could bind to this positive activator region of the promoter .", + "output": [ + "01212200000000000" + ] + }, + { + "input": "Expression of the Runt domain - encoding PEBP2 alpha genes in T cells during thymic development .", + "output": [ + "00012222220000000" + ] + }, + { + "input": "The PEBP2 alpha A and PEBP2 alpha B genes encode the DNA - binding subunit of a murine transcription factor , PEBP2 , which is implicated as a T - cell - specific transcriptional regulator .", + "output": [ + "012222222001222001220100000012222220" + ] + }, + { + "input": "These two related genes share the evolutionarily conserved region encoding the Runt domain .", + "output": [ + "00000000000120" + ] + }, + { + "input": "PEBP2 alpha B is the murine counterpart of human AML1 , which is located at the breakpoints of the 8 ; 21 and 3 ; 21 chromosome translocations associated with acute myeloid leukemia .", + "output": [ + "1220012012000000000122222222000000" + ] + }, + { + "input": "Northern ( RNA ) blots of various adult mouse tissues revealed that the levels of expression of both genes were most prominent in the thymus .", + "output": [ + "00000000000000000000000000" + ] + }, + { + "input": "Furthermore , transcripts of PEBP2 alpha A and mouse AML1 / PEBP2 alpha B were detected in T lymphocytes in the thymuses from day 16 embryos and newborns , as well as 4 - week - old adult mice , by in situ hybridization .", + "output": [ + "000012201222220000000000000000000000000000000" + ] + }, + { + "input": "The expression of the genes persisted in peripheral lymph nodes of adult mice .", + "output": [ + "00000000000000" + ] + }, + { + "input": "The transcripts were detected in all the CD4 - CD8 - , CD4 + CD8 + , CD4 + CD8 - , and CD4 - CD8 + cell populations .", + "output": [ + "000000000000000000000000000000" + ] + }, + { + "input": "The results indicated that both genes are expressed in T cells throughout their development , supporting the notion that PEBP2 is a T - cell - specific transcription factor .", + "output": [ + "000000000000000000010012222220" + ] + }, + { + "input": "Transcripts of mouse AML1 / PEBP2 alpha B were also detected in day 12 fetal hematopoietic liver and in the bone marrow cells of newborn mice .", + "output": [ + "001222220000000000000000000" + ] + }, + { + "input": "The implication of mouse AML1 / PEBP2 alpha B expression in hematopoietic cells other than those of T - cell lineage is discussed in relation to myeloid leukemogenesis .", + "output": [ + "00001222200000000000000000000" + ] + }, + { + "input": "Effects of glucocorticoids on transcription factor activation in human peripheral blood mononuclear cells .", + "output": [ + "00000000000000" + ] + }, + { + "input": "The interaction of the transcription factors , activator protein - 1 ( AP - 1 ) , nuclear factor kappa B ( NF kappa B ) , and cAMP - responsive element binding protein ( CREB ) with DNA and glucocorticoid receptors ( GR ) was analyzed in human peripheral blood mononuclear cells by gel mobility shift assays .", + "output": [ + "00001201222012200122201220001222220100001201000000000000000" + ] + }, + { + "input": "Dexamethasone produced a rapid and sustained increase in glucocorticoid response element binding and a concomitant 40 - 50 % decrease in AP - 1 , NF kappa B , and CREB DNA binding that was blocked by combined dexamethasone and cytokine or PMA treatment .", + "output": [ + "000000001220000000000000000000000000000010000" + ] + }, + { + "input": "These latter effects were due to increases in the nuclear localization of GR , not to reduced amounts of the other transcription factors .", + "output": [ + "000000000000100000000120" + ] + }, + { + "input": "This suggests that in these cells GR within the nucleus interacts with cytokine - stimulated transcription factors by the process of cross coupling .", + "output": [ + "000000100000122220000000" + ] + }, + { + "input": "Differential induction of the NF - AT complex during restimulation and the induction of T - cell anergy .", + "output": [ + "0000122200000000000" + ] + }, + { + "input": "Stimulation of human CD4 + T - cell clones through the T - cell receptor ( TcR ) by high doses of specific peptide results in the induction of a long - lived state of nonresponsiveness that has been called anergy .", + "output": [ + "000000000001222010000000000000000000000000" + ] + }, + { + "input": "The amount of TcR at the cell surface is downmodulated , whereas the CD2 and CD25 receptors are increased .", + "output": [ + "00010000000001222000" + ] + }, + { + "input": "In this study , we have compared the ability of various transcription factors to bind to their appropriate site on DNA .", + "output": [ + "0000000000012000000000" + ] + }, + { + "input": "Factors were isolated from the nuclei of T cells that were in the induction phase of anergy or were undergoing activation .", + "output": [ + "0000000000000000000000" + ] + }, + { + "input": "The pattern of binding activity in restimulated T cells is consistent with the pattern that has previously been shown to regulate T - cell - specific expression of the IL - 2 and the beta chain of the TcR genes .", + "output": [ + "00000000000000000000000000000122000000120" + ] + }, + { + "input": "The measured binding to a TCF - 1 site is the same in the nuclei of resting , activated , and anergized cells .", + "output": [ + "000001222000000000000000" + ] + }, + { + "input": "The inducible factors NK - kappa B , beta E2 , CD28RC , and AP - 1 are not expressed in resting cells and are twofold lower in anergized as compared with activated cells .", + "output": [ + "01212220120100122000000000000000000" + ] + }, + { + "input": "In contrast , anergic T cells express approximately eightfold lower amounts of NF - AT , a member of the class of inducible factors that regulates IL - 2 gene transcription .", + "output": [ + "00000000000012200000001200122200" + ] + }, + { + "input": "The number of glucocorticoid receptors in peripheral human lymphocytes is elevated by a zinc containing trace element preparation .", + "output": [ + "0001200000000000000" + ] + }, + { + "input": "A trace element preparation ( Beres Drops Plus , BDP ) elevates the number of glucocorticoid receptors ( gcR ) in peripheral lymphocytes isolated both from healthy blood donors and rheumatoid arthritis patients .", + "output": [ + "0000000000000001201000000000000000" + ] + }, + { + "input": "This enhancement by BDP was found either for constitutive expression of gcRs or in experiments when the lymphocytes were stimulated by interleukin ( IL ) - 6 .", + "output": [ + "0000000000010000000001222220" + ] + }, + { + "input": "There was no significant effect of BDP on IL - 1 and tumour necrosis factor alpha ( TNF alpha ) - induced changes of gcRs .", + "output": [ + "00000000122012220120000010" + ] + }, + { + "input": "The DNA and steroid binding domains of the glucocorticoid receptor are not altered in mononuclear cells of treated CLL patients .", + "output": [ + "000122001200000000000" + ] + }, + { + "input": "The aim of this study was to investigate whether mutations in the glucocorticoid receptor could account for the increasing unresponsiveness of patients with chronic lymphatic leukemia ( CLL ) to combination chemotherapy .", + "output": [ + "000000000000120000000000000000000" + ] + }, + { + "input": "The receptor was tested immunocytochemically , in steroid binding assays , and by a mutation screening ( denaturing gradient gel electrophoresis ) of the receptor - cDNA .", + "output": [ + "0000000000000000000000001220" + ] + }, + { + "input": "In one individual who had not been treated before analysis a silent mutation was found in one receptor allele .", + "output": [ + "00000000000000000000" + ] + }, + { + "input": "The results suggest that mechanisms other than altered ligand or DNA binding of the receptor may be responsible for the lack of response to chemotherapy .", + "output": [ + "00000000000000000000000000" + ] + }, + { + "input": "This conclusion is discussed in relation to the mechanism of corticoid resistance in mouse and human lymphoma cells in culture .", + "output": [ + "000000000000000000000" + ] + }, + { + "input": "An AP1 binding site upstream of the kappa immunoglobulin intron enhancer binds inducible factors and contributes to expression .", + "output": [ + "0122000122201200000" + ] + }, + { + "input": "A new protein - DNA interaction has been identified upstream of the intron enhancer , within the matrix - associated region of the J - C intron .", + "output": [ + "0000000000001200012220012220" + ] + }, + { + "input": "The binding activity is greatly inducible in pre - B cells by bacterial lipopolysaccharide and interleukin - 1 but specific complexes are found at all stages of B cell development tested .", + "output": [ + "00000000000000012200000000000000" + ] + }, + { + "input": "The footprinted binding site is homologous to the consensus AP1 motif .", + "output": [ + "012200001220" + ] + }, + { + "input": "The protein components of this complex are specifically competed by an AP1 consensus motif and were shown by supershift to include c - Jun and c - Fos , suggesting that this binding site is an AP1 motif and that the Jun and Fos families of transcription factors play a role in the regulation of the kappa light chain gene .", + "output": [ + "0000000000012200000001220122000012001200012220120000000012220" + ] + }, + { + "input": "Mutation of the AP1 motif in the context of the intron enhancer was shown to decrease enhancer - mediated activation of the promoter in both pre - B cells induced with LPS and constitutive expression in mature B cells .", + "output": [ + "0001200000120000000000000000000000000000" + ] + }, + { + "input": "Distinct DNase - I hypersensitive sites are associated with TAL - 1 transcription in erythroid and T - cell lines .", + "output": [ + "012222000122000000000" + ] + }, + { + "input": "The tal - 1 gene , frequently activated in human T - cell acute lymphoblastic leukemia ( T - ALL ) , is expressed in the erythroid , megakaryocytic , and mast cell lineages during normal hematopoiesis .", + "output": [ + "01222000000000000000000000000000000000" + ] + }, + { + "input": "To gain further insight into the molecular mechanisms that control tal - 1 expression , we investigated tal - 1 chromatin structure in erythroid / megakaryocytic cell lines and in T - cell lines either with or without tal - 1 rearrangements .", + "output": [ + "0000000000122000012200000000000000000012220" + ] + }, + { + "input": "Tal - 1 transcription was shown to be monoallelic in Jurkat , a T - cell line that expresses tal - 1 in the absence of apparent genomic alteration of the locus .", + "output": [ + "000000000000000000012200000000000" + ] + }, + { + "input": "Five major DNase - I hypersensitive sites ( HS ) were mapped in the tal - 1 locus .", + "output": [ + "0012222010000012200" + ] + }, + { + "input": "HS I , IV , and V were exclusively observed in the erythroid / megakaryocytic cell lines that express tal - 1 from the promoters 1a and 1b .", + "output": [ + "12222220000000000001220012220" + ] + }, + { + "input": "HS II was weak in hematopoietic cell lines , absent in Hela , and greatly enhanced in Jurkat , suggesting that this region might be implicated in the cis - activation of tal - 1 promoter 1b in this cell line .", + "output": [ + "120000000000000000000000000000001222200000" + ] + }, + { + "input": "HS III was weak in HEL and Jurkat , and greatly enhanced in DU528 , a T - cell line that bears a t ( 1 ; 14 ) and initiates tal - 1 transcription within exon 4 .", + "output": [ + "120000000000000000000012222220012200120" + ] + }, + { + "input": "These results suggest that distinct regulatory elements are associated with the use of the different tal - 1 promoters .", + "output": [ + "00000120000000012220" + ] + }, + { + "input": "Erythropoietin - dependent induction of hemoglobin synthesis in a cytokine - dependent cell line M - TAT .", + "output": [ + "100001000000000000" + ] + }, + { + "input": "We cultured M - TAT cells long term ( > 1 year ) in the continuous presence of erythropoietin ( EPO ) , granulocyte - macrophage colony - stimulating factor ( GM - CSF ) , or stem cell factor ( SCF ) .", + "output": [ + "00000000000000000010100122222201220001220100" + ] + }, + { + "input": "These long term cultures are referred to as M - TAT / EPO , M - TAT / GM - CSF , and M - TAT / SCF cells , respectively .", + "output": [ + "00000000000000000000000000000000" + ] + }, + { + "input": "Hemoglobin concentration and gamma - globin and erythroid delta - aminolevulinate synthase mRNA levels were significantly higher in M - TAT / EPO cells than in M - TAT / GM - CSF cells .", + "output": [ + "10012201222220000000000000000000000" + ] + }, + { + "input": "When the supplemented cytokine was switched from GM - CSF to EPO , hemoglobin synthesis in M - TAT / GM - CSF cells increased rapidly ( within 5 h ) , and the level of GATA - 1 mRNA increased .", + "output": [ + "000100012201010000000000000000000000122200" + ] + }, + { + "input": "Thus , erythroid development of M - TAT cells is promoted by EPO and suppressed by GM - CSF .", + "output": [ + "00000000000010001220" + ] + }, + { + "input": "These results support the hypothesis that EPO actively influences the programming of gene expression required for erythroid progenitor cell differentiation .", + "output": [ + "000000100000000000000" + ] + }, + { + "input": "The role of cellular transcription factor E2F in the regulation of cdc2 mRNA expression and cell cycle control of human hematopoietic cells .", + "output": [ + "00012220000120000000000" + ] + }, + { + "input": "cdc2 mRNA transcripts were detected in immature bone marrow cells and became undetectable along with differentiation .", + "output": [ + "12200000000000000" + ] + }, + { + "input": "Peripheral blood resting cells did not express cdc2 mRNA , but it was induced in T - lymphocytes when the cells reentered the cell cycle in response to specific mitogens .", + "output": [ + "0000000120000000000000000000000" + ] + }, + { + "input": "In contrast , cdc2 mRNA could not be induced in granulocytes and monocytes even after the culture with the appropriate stimulants .", + "output": [ + "0001200000000000000000" + ] + }, + { + "input": "In order to investigate the mechanism of the regulation of cdc2 mRNA expression in hematopoietic cells , we isolated the 5 ' - flanking sequence of the cdc2 gene and found the putative E2F binding site at the position of nucleotides - 124 to - 117 .", + "output": [ + "00000000001200000000122220012000001200001222220" + ] + }, + { + "input": "The binding of E2F at this region was detected by a gel - retardation assay and DNaseI footprinting in phytohemagglutinin - stimulated T - lymphocytes , which was coincident with the expression of cdc2 mRNA .", + "output": [ + "000100000000000010000000000000000120" + ] + }, + { + "input": "E2F binding was not observed in both granulocytes and monocytes .", + "output": [ + "10000000000" + ] + }, + { + "input": "The induction of E2F activity preceded the appearance of cdc2 mRNA , which is consistent with the role of E2F in the regulation of cdc2 mRNA expression .", + "output": [ + "0001000001200000000100000000" + ] + }, + { + "input": "These results suggest that cdc2 mRNA expression is related to the cell cycling of normal human hematopoietic cells and that E2F plays some roles in the regulation of its expression .", + "output": [ + "0000120000000000000010000000000" + ] + }, + { + "input": "A wide spectrum of levels of HIV - 1 expression have been demonstrated in various cells , both in cell culture and in vivo .", + "output": [ + "0000000000000000000000000" + ] + }, + { + "input": "Molecular mechanisms leading to restricted HIV - 1 replication may differ between certain cell types .", + "output": [ + "0000000000000000" + ] + }, + { + "input": "It is now demonstrated that HIV - 1 proviral latency in the monocytic cell line U1 , in which only extremely low levels of HIV - 1 expression are detected in the baseline unstimulated state , is associated with alterations in nuclear factor - kappa B ( NF - kappa B ) moieties demonstrated in these cells by electrophoretic mobility shift assays ( EMSAs ) and in situ UV cross - linking studies .", + "output": [ + "00000000000000000000000000000000000000000012222222222000000000000000000000" + ] + }, + { + "input": "A predominance of p50 NF - kappa B moieties and possibly p50 homodimers or closely related species , rather than the p50 - p56 heterodimer of NF - kappa B that is the predominant NF - kappa B species in most T lymphocytic and monocytic cells , is demonstrated in the nuclei of U1 cells .", + "output": [ + "00012222200120000000012220122200001222000000000000000000" + ] + }, + { + "input": "This pattern of NF - kappa B - related moieties differs from the latently infected T lymphocytic cell line ACH - 2 , and from the U937 monocytic line , the parental cell line of the U1 cellular clone .", + "output": [ + "0001222222000000000000000000000000000000" + ] + }, + { + "input": "As such , these data suggest that different proximal mechanisms may lead to restricted HIV - 1 replication in various cell types .", + "output": [ + "00000000000000000000000" + ] + }, + { + "input": "[ Regulation of transcription of the interleukin - 2 gene in B - lymphocytes ]", + "output": [ + "000000122200000" + ] + }, + { + "input": "Since most B cell clones immortalized with EBV virus can be induced to produce interleukin - 2 , a typical T cell cytokine , we studied the role of different elements of the IL - 2 promoter in such clones by transfection .", + "output": [ + "0000000000000012200012200000000001222000000" + ] + }, + { + "input": "It was found , in particular , that the element TCEd , which binds the transcription factor NF - kB , is very active in all three B clones tested .", + "output": [ + "0000000000100001212200000000000" + ] + }, + { + "input": "This element has no activity in T cells of the Jurkat line .", + "output": [ + "0000000000000" + ] + }, + { + "input": "Different elements thus contribute to IL - 2 promoter activity in different cells .", + "output": [ + "00000122200000" + ] + }, + { + "input": "Regulation of I kappa B alpha and p105 in monocytes and macrophages persistently infected with human immunodeficiency virus .", + "output": [ + "0012220100000000000" + ] + }, + { + "input": "The mechanisms regulating human immunodeficiency virus ( HIV ) persistence in human monocytes / macrophages are partially understood .", + "output": [ + "0000000000000000000" + ] + }, + { + "input": "Persistent HIV infection of U937 monocytic cells results in NF - kappa B activation .", + "output": [ + "000000000122200" + ] + }, + { + "input": "Whether virus - induced NF - kappa B activation is a mechanism that favors continuous viral replication in macrophages remains unknown .", + "output": [ + "0000122200000000000000" + ] + }, + { + "input": "To further delineate the molecular mechanisms involved in the activation of NF - kappa B in HIV - infected monocytes and macrophages , we have focused on the regulation of the I kappa B molecules .", + "output": [ + "000000000001222000000000000000000000" + ] + }, + { + "input": "First , we show that persistent HIV infection results in the activation of NF - kappa B not only in monocytic cells but also in macrophages .", + "output": [ + "000000000000000000000000000" + ] + }, + { + "input": "In HIV - infected cells , I kappa B alpha protein levels are decreased secondary to enhanced protein degradation .", + "output": [ + "00000012220000000000" + ] + }, + { + "input": "Another protein with I kappa B function , p105 , is also modified in HIV - infected cells : p105 and p50 steady - state protein levels are increased as a result of increased synthesis and proteolytic processing of p105 .", + "output": [ + "00000000100000000001010000000000000000010" + ] + }, + { + "input": "These results demonstrate the existence of a triple autoregulatory loop in monocytes and macrophages involving HIV , p105 and p50 , and MAD3 , with the end result of persistent NF - kappa B activation and viral persistence .", + "output": [ + "000000000000000001010010000000000000000" + ] + }, + { + "input": "Furthermore , persistent HIV infection of monocytes and macrophages provides a useful model with which to study concomitant modifications of different I kappa B molecules .", + "output": [ + "00000000000000000000012220" + ] + }, + { + "input": "Glucocorticoid - induced apoptosis of human leukemic cells is caused by the repressive function of the glucocorticoid receptor .", + "output": [ + "0000000000000000120" + ] + }, + { + "input": "Induction of apoptosis in lymphocytes , which may account for the therapeutic effects of glucocorticoids in various diseases including leukemia , depends on the glucocorticoid receptor .", + "output": [ + "000000000000000000000000120" + ] + }, + { + "input": "However , the events leading from the activated receptor to cell lysis are not understood .", + "output": [ + "0000000000000000" + ] + }, + { + "input": "A prevailing hypothesis postulates induction of so - called ' lysis genes ' by the activated receptor .", + "output": [ + "000000000012000120" + ] + }, + { + "input": "Furthermore , we show that retinoic acid can also induce apoptosis in these cells through the retinoic acid receptor , whose repressive functions but not target site specificity , are similar to those of the glucocorticoid receptor .", + "output": [ + "00000000000000001220000000000000000120" + ] + }, + { + "input": "Therefore , the primary effect of the receptor in glucocorticoid - mediated apoptosis correlates with transcriptional repression rather than activation and could be mediated by interference with other transcription factors required for cell survival .", + "output": [ + "00000000000000000000000000001200000" + ] + }, + { + "input": "NF - kappa B is a nuclear protein of the rel oncogene family capable of enhancing transcription of several cellular genes , including IL - 2 and the IL - 2 receptor , and viral genes transcribed from the HIV - 1 LTR .", + "output": [ + "12220012001220000012200122001222001200012220" + ] + }, + { + "input": "In this study the effects of HIV protease on NF - kappa B precursor activation were examined in Jurkat T cells by introducing a protease expression vector into the cells .", + "output": [ + "0000000001222000000000001220000" + ] + }, + { + "input": "Increased NF - kappa B activity was observed and this increased activity was blocked by a specific inhibitor of the viral protease .", + "output": [ + "01222000000000000000120" + ] + }, + { + "input": "Viral transcription , as measured using LTR - CAT assays , was only slightly enhanced in the HIV - protease expressing cells , while secretion of IL - 2 and expression of the IL - 2 receptor were not affected .", + "output": [ + "00000011200000000000000000122000012200000" + ] + }, + { + "input": "The limited activation of NF - kappa B by HIV protease appears unlikely to have a significant effect on virus expression or T cell function .", + "output": [ + "00001222012000000000000000" + ] + }, + { + "input": "Inhibition of human immunodeficiency virus type 1 replication by a Tat - activated , transduced interferon gene : targeted expression to human immunodeficiency virus type 1 - infected cells .", + "output": [ + "000000000012222220000000000000" + ] + }, + { + "input": "We have examined the feasibility of using interferon ( IFN ) gene transfer as a novel approach to anti - human immunodeficiency virus type 1 ( HIV - 1 ) therapy in this study .", + "output": [ + "00000001010000000000000000000000000" + ] + }, + { + "input": "To limit expression of a transduced HIV - 1 long terminal repeat ( LTR ) - IFNA2 ( the new approved nomenclature for IFN genes is used throughout this article ) hybrid gene to the HIV - 1 - infected cells , HIV - 1 LTR was modified .", + "output": [ + "0000001222222222200000012000000120000000001222000" + ] + }, + { + "input": "Deletion of the NF - kappa B elements of the HIV - 1 LTR significantly inhibited Tat - mediated transactivation in T - cell lines , as well as in a monocyte line , U937 .", + "output": [ + "000122220012220010000000000000000000" + ] + }, + { + "input": "Replacement of the NF - kappa B elements in the HIV - 1 LTR by a DNA fragment derived from the 5 ' - flanking region of IFN - stimulated gene 15 ( ISG15 ) , containing the IFN - stimulated response element , partially restored Tat - mediated activation of LTR in T cells as well as in monocytes .", + "output": [ + "0001222200122200120001222201222201000012222000100001000000000" + ] + }, + { + "input": "ISG15 - LTR - IFN hybrid gene inserted into the retrovirus vector was transduced into Jurkat and U937 cells .", + "output": [ + "12222220001200000000" + ] + }, + { + "input": "Enhancement of IFNA synthesis observed upon HIV - 1 infection resulted in significant inhibition of HIV - 1 replication for a period of at least 30 days .", + "output": [ + "0010000000000000000000000000" + ] + }, + { + "input": "Virus isolated from IFNA - producing cells was able to replicate in the U937 cells but did not replicate efficiently in U937 cells transduced with the IFNA gene .", + "output": [ + "00000000000000000000000000120" + ] + }, + { + "input": "These results suggest that targeting IFN synthesis to HIV - 1 - infected cells is an attainable goal and that autocrine IFN synthesis results in a long - lasting and permanent suppression of HIV - 1 replication .", + "output": [ + "00000100000000000000010000000000000000" + ] + }, + { + "input": "Chromosomal localization of two KOX zinc finger genes on chromosome bands 7q21 - q22 .", + "output": [ + "000012220121220" + ] + }, + { + "input": "Human cDNAs encoding Kruppel - type zinc finger domains , designated KOX 1 - 32 , have been cloned from human T lymphocyte cell line libraries .", + "output": [ + "120122222001222000001222220" + ] + }, + { + "input": "We report here the regional localizations by in situ hybridization of KOX 18 and KOX 25 on chromosome bands 7q21q22 .", + "output": [ + "000000000001201201220" + ] + }, + { + "input": "Pulse - field gel electrophoresis ( PFGE ) analysis showed that these genes are physically located within a DNA fragment of 250 kb .", + "output": [ + "000000000000000000120120" + ] + }, + { + "input": "The genes KOX 4 and KOX 9 , mapped on chromosome 8q24 , were found to be located within a DNA fragment of 450 kb .", + "output": [ + "00120120001200000000120000" + ] + }, + { + "input": "From the present and previous data , eighteen different KOX genes have been located at least two by two within nine DNA fragments of 200 to 580 kb .", + "output": [ + "00000000012000000000012000000" + ] + }, + { + "input": "Influence of age on the production of Fos and Jun by influenza virus - exposed T cells .", + "output": [ + "000000010100000000" + ] + }, + { + "input": "This study investigated age - related T cell responses after in vitro exposure to influenza A virus .", + "output": [ + "000000000000000000" + ] + }, + { + "input": "Mononuclear leukocytes from young or elderly persons were sham - exposed or exposed to influenza virus for 1 , 24 , and 72 h .", + "output": [ + "0000000000000000000000000" + ] + }, + { + "input": "Immunofluorescent staining and flow cytometric analysis were then used to detect T cells producing the transcriptional regulating proteins Fos and Jun .", + "output": [ + "0000000000000001221010" + ] + }, + { + "input": "Fewer virus - exposed cells from elderly donors stained for Fos and Jun at each data point compared with cells from young donors .", + "output": [ + "000000000010100000000000" + ] + }, + { + "input": "Thus , failure of virus - exposed T cells to produce Fos and Jun could contribute to the increase in illness due to influenza virus in the elderly .", + "output": [ + "00000000000101000000000000000" + ] + }, + { + "input": "OBJECTIVES : To analyze the effect of retinoic acids ( RA ) on HIV - 1 expression and correlate this effect with expression levels of RA receptors ( RARs ) in T - lymphoid and monocytoid cell lines .", + "output": [ + "000000000000000000000000012010000000000" + ] + }, + { + "input": "DESIGN AND METHODS : The effect of all - trans and 9 - cis RA on HIV - 1 production in T - lymphoid ( H9 , CEM ) and monocytoid ( U937 , THP - 1 ) cell lines was measured during acute and chronic infection .", + "output": [ + "000000000000000000000000000000000000000000000000" + ] + }, + { + "input": "The expression levels of human RAR alpha ( hRAR alpha , receptor for all - trans RA ) and the human retinoid - X receptor alpha ( hRXR alpha receptor for 9 - cis RA ) were determined by Northern blot analysis .", + "output": [ + "0000122012220000000012222201220000000000000" + ] + }, + { + "input": "RESULTS : Both all - trans and 9 - cis RA inhibited virus replication in HIV - 1 IIIB - infected monocytoid cells , in the presence and absence of the co - stimulatory agent phorbol myristate acetate ( PMA ) .", + "output": [ + "000000000000000000000000000000000000000000" + ] + }, + { + "input": "The retinoids had weak or no stimulatory effects on HIV production by T - cell lines .", + "output": [ + "00000000000000000" + ] + }, + { + "input": "HIV production by PMA - stimulated T - cell lines was inhibited by these retinoids .", + "output": [ + "0000000000000000" + ] + }, + { + "input": "The 9 - cis RA was generally more effective than all - trans RA in inhibiting HIV production and in combination generally more effective than the single agents alone .", + "output": [ + "000000000000000000000000000000" + ] + }, + { + "input": "Human RAR alpha was expressed in H9 , U937 and THP - 1 cells , but almost undetectable in CEM cells .", + "output": [ + "1220000000000000000000" + ] + }, + { + "input": "Human RXR alpha was significantly expressed in U937 and THP - 1 cells , weakly expressed in H9 cells and not detectable in CEM cells .", + "output": [ + "12200000000000000000000000" + ] + }, + { + "input": "After stimulation by PMA , RXR alpha expression increased in H9 and U937 cells but not in CEM cells .", + "output": [ + "00000120000000000000" + ] + }, + { + "input": "Human RAR alpha expression was unchanged in H9 and CEM cells , and elevated in U937 cells , after PMA stimulation .", + "output": [ + "0000000000000000000000" + ] + }, + { + "input": "CONCLUSION : The effect of RA on HIV - 1 expression was cell - type - dependent and partially correlated with cellular expression of RARs .", + "output": [ + "00000000000000000000000010" + ] + }, + { + "input": "Endogenous or exogenously administered RA may have a significant role in HIV regulation .", + "output": [ + "00000000000000" + ] + }, + { + "input": "Functions of glutathione and glutathione disulfide in immunology and immunopathology .", + "output": [ + "00000000000" + ] + }, + { + "input": "At low GSSG levels , T cells can not optimally activate the immunologically important transcription factor NF kappa B , whereas high GSSG levels inhibit the DNA binding activity of NF kappa B .", + "output": [ + "0000000000000012122000000000001220" + ] + }, + { + "input": "The effects of GSSG are antagonized by reduced thioredoxin ( TRX ) .", + "output": [ + "0000000010100" + ] + }, + { + "input": "As the protein tyrosine kinase activities p56lck and p59fyn are activated in intact cells by hydrogen peroxide , they are likely targets for GSSG action .", + "output": [ + "00122010100000000000000000" + ] + }, + { + "input": "These redox - regulated enzymes trigger signal cascades for NF kappa B activation and transduce signals from the T cell antigen receptor , from CD4 and CD8 molecules , and from the IL - 2 receptor beta - chain .", + "output": [ + "0122200001220000001222001012000012222220" + ] + }, + { + "input": "The effector phase of cytotoxic T cell responses and IL - 2 - dependent functions are inhibited even by a partial depletion of the intracellular GSH pool .", + "output": [ + "0000000001220000000000000000" + ] + }, + { + "input": "As HIV - infected patients and SIV - infected rhesus macaques have , on the average , significantly decreased plasma cyst ( e ) ine and intracellular GSH levels , we also hypothesize that AIDS may be the consequence of a GSSG deficiency as well .", + "output": [ + "0000000000000000000000000000000000000000000000" + ] + }, + { + "input": "T cells from renal cell carcinoma patients exhibit an abnormal pattern of kappa B - specific DNA - binding activity : a preliminary report .", + "output": [ + "0000000000000000000000000" + ] + }, + { + "input": "Recent data suggest that the poor induction of a T - cell response to human renal cell carcinoma ( RCC ) may be related to alterations in signal transduction pathways .", + "output": [ + "0000000000000000000000000000000" + ] + }, + { + "input": "We report that T cells from RCC patients have two alterations in kappa B motif - specific DNA - binding activity .", + "output": [ + "0000000000000000000000" + ] + }, + { + "input": "The first alteration involves the constitutive expression of substantial kappa B - binding activity in nuclear extracts , which was observed in the electrophoretic mobility shift assay .", + "output": [ + "0000000000000000000000000000" + ] + }, + { + "input": "The magnitude of kappa B activity in unstimulated patient T cells was similar to that observed in T cells from normal individuals that had been activated in vitro .", + "output": [ + "00000000000000000000000000000" + ] + }, + { + "input": "On the basis of Western blotting experiments using antibodies to kappa B / Rel family proteins , the kappa B - binding activity constitutively expressed in T cells from RCC patients is composed mostly of the NF - kappa B1 ( p50 ) subunit .", + "output": [ + "000000001012222200000000000000000000122222220" + ] + }, + { + "input": "Western blotting analysis did not detect any RelA in nuclear extracts either before or after stimulation of T cells .", + "output": [ + "00000001000000000000" + ] + }, + { + "input": "The altered kappa B - binding activity in T cells from RCC patients may impair their capacity to respond normally to various stimuli .", + "output": [ + "000000000000000000000000" + ] + }, + { + "input": "Hemoglobin switching in humans is accompanied by changes in the ratio of the transcription factors , GATA - 1 and SP1 .", + "output": [ + "1000000000000120122010" + ] + }, + { + "input": "BACKGROUND : Understanding the mechanism of developmental regulation of hemoglobin switching has scientific as well as clinical relevance because of the influence of fetal hemoglobin ( HbF ) production in adulthood on the clinical manifestation of thalassemia and sickle cell anemia .", + "output": [ + "000000000100000000000000101000000000000000" + ] + }, + { + "input": "We have previously found that the normal developmental patterns of globin gene expression are recapitulated in an experimental system of primary cultures that support differentiation of erythroid progenitors .", + "output": [ + "00000000001200000000000000000" + ] + }, + { + "input": "We further found that high activities of the transcriptional activators , GATA - 1 and SP1 , are associated with normal adult erythroid differentiation .", + "output": [ + "0000000012012201000000000" + ] + }, + { + "input": "MATERIALS AND METHODS : In the present work , we have studied , the activities of GATA - 1 and SP1 during differentiation of cultured erythroid progenitors derived from cord blood and from fetal livers , as well as from beta zero - thalassemia patients .", + "output": [ + "0000000000000000122010000000000000000000000000" + ] + }, + { + "input": "RESULTS : The results showed high GATA - 1 binding activity and very low SP1 activity in the fetal liver cultures .", + "output": [ + "0000001220000010000000" + ] + }, + { + "input": "This pattern was in contrast to cultures derived from normal adult peripheral blood , in which both GATA - 1 and SP1 activities were high .", + "output": [ + "00000000000000000122010000" + ] + }, + { + "input": "The progenitors derived from a beta zero - thalassemia patient with high HbF production showed ` ` fetal ' ' pattern .", + "output": [ + "0000000000001000000000" + ] + }, + { + "input": "On the other hand , in cultures of 2 beta zero - thalassemia patients without high HbF , ` ` adult ' ' pattern was observed .", + "output": [ + "000000000000000010000000000" + ] + }, + { + "input": "CONCLUSIONS : In the present work , we show that human fetal and adult erythroid progenitors are distinct in their transcription factors , and that the commitment to fetal or adult program occurs at a very early differentiation stage .", + "output": [ + "0000000000000000000012000000000000000000" + ] + }, + { + "input": "Transcription - independent turnover of I kappa B alpha during monocyte adherence : implications for a translational component regulating I kappa B alpha / MAD - 3 mRNA levels .", + "output": [ + "000001222000000000012222222200" + ] + }, + { + "input": "We identified I kappa B alpha / MAD - 3 as an immediate - early gene in human monocytes that is expressed in response to a variety of signals , including adhesion , lipopolysaccharide , and phorbol myristate acetate .", + "output": [ + "0012222222001222000000000000000000000000" + ] + }, + { + "input": "Within 5 min of monocyte adhesion , the level of the I kappa B alpha protein is markedly diminished but is rapidly replaced in a cycloheximide - sensitive manner within 20 min .", + "output": [ + "000000000001222200000000000000000" + ] + }, + { + "input": "Accompanying the rapid turnover of the I kappa B alpha protein is simultaneous translocation of NF - kappa B - related transcription factors to nuclei of adhered monocytes .", + "output": [ + "00000012222000012222222000000" + ] + }, + { + "input": "The demonstration that NF - kappa B can regulate I kappa B alpha / MAD - 3 gene transcription in other cell types suggested that the rapid increase in steady - state I kappa B alpha / MAD - 3 mRNA levels we observed within 30 min of monocyte adherence would result from NF - kappa B - dependent transcriptional stimulation of the I kappa B alpha / MAD - 3 gene .", + "output": [ + "0001222001222222220000000000000012222222200000000000012220000001222222220" + ] + }, + { + "input": "Nuclear run - on analyses indicated that , instead , while several immediate - early cytokine genes , such as the interleukin 1 beta ( IL - 1 beta ) gene , were transcriptionally activated during monocyte adhesion , the rate of I kappa B alpha / MAD - 3 gene transcription remained constant .", + "output": [ + "0000000000001222200001222222222000000000001222222220000" + ] + }, + { + "input": "The adherence - dependent increase in I kappa B alpha / MAD - 3 mRNA levels was also not a consequence of mRNA stabilization events .", + "output": [ + "00000012222222200000001000" + ] + }, + { + "input": "Interestingly , while increases in both IL - 1 beta and I kappa B alpha / MAD - 3 mRNA levels were detected in nuclei of adherent monocytes , cytoplasmic levels of IL - 1 beta mRNA increased during adherence whereas those of I kappa B alpha / MAD - 3 mRNA did not .", + "output": [ + "0000000000000000000000000000000012222000000122222222000" + ] + }, + { + "input": "We propose that adherent monocytes regulate nuclear processing ( or decay ) of I kappa B alpha / MAD - 3 mRNA , thereby increasing mRNA levels without stimulating I kappa B alpha / MAD - 3 gene transcription .", + "output": [ + "0000000000000122222222000000012222222200" + ] + }, + { + "input": "Moreover , since inhibition of protein synthesis leads to accumulation of I kappa B alpha / MAD - 3 mRNA without stimulating I kappa B alpha / MAD - 3 gene transcription , we suggest that low cytoplasmic levels of I kappa B alpha / MAD - 3 mRNA are maintained by a translation - dependent degradation mechanism .", + "output": [ + "00000000000122222222001222222220000000001222222220000000000" + ] + }, + { + "input": "Distinct roles of the molecular chaperone hsp90 in modulating dioxin receptor function via the basic helix - loop - helix and PAS domains .", + "output": [ + "000001200000000122220120" + ] + }, + { + "input": "The intracellular dioxin receptor mediates signal transduction by dioxin and functions as a ligand - activated transcription factor .", + "output": [ + "0122000000000122220" + ] + }, + { + "input": "It contains a basic helix - loop - helix ( bHLH ) motif contiguous with a Per - Arnt - Sim ( PAS ) homology region .", + "output": [ + "000122222222200012222222220" + ] + }, + { + "input": "We have reconstituted ligand - dependent activation of the receptor to a DNA - binding form by using the dioxin receptor and its bHLH - PAS partner factor Arnt expressed by in vitro translation in reticulocyte lysate .", + "output": [ + "00000000000012220001200122221000000000" + ] + }, + { + "input": "Deletion of the PAS domain of the receptor resulted in constitutive dimerization with Arnt .", + "output": [ + "000120000000010" + ] + }, + { + "input": "In contrast , this receptor mutant showed low levels of xenobiotic response element - binding activity , indicating that the PAS domain may be important for DNA - binding affinity and / or specificity of the receptor .", + "output": [ + "00000000000000000000120000000000000000" + ] + }, + { + "input": "At least two distinct domains of the receptor mediated interaction with hsp90 : the ligand - binding domain located within the PAS region and , surprisingly , the bHLH domain .", + "output": [ + "0000000000010012220001200000120" + ] + }, + { + "input": "Whereas ligand - binding activity correlated with association with hsp90 , bHLH - hsp90 interaction appeared to be important for DNA - binding activity but not for dimerization of the receptor .", + "output": [ + "00000000010001000000000000000000" + ] + }, + { + "input": "Several distinct roles for hsp90 in modulating dioxin receptor function are therefore likely : correct folding of the ligand - binding domain , interference with Arnt heterodimerization , and folding of a DNA - binding conformation of the bHLH domain .", + "output": [ + "00001001200000000000000001000000000000120" + ] + }, + { + "input": "Thus , the dioxin receptor system provides a complex and interesting model of the regulation of transcription factors by hsp90 .", + "output": [ + "000120000000000012010" + ] + }, + { + "input": "Aspirin - like drugs ( ALD ) induce calcium mobilization , an essential component of T cell activation , but do not induce the biosynthesis of IL - 2 .", + "output": [ + "000000000000000000000000001220" + ] + }, + { + "input": "To understand the extent to which ALD may mimic mitogenic stimulation , we studied cytoplasmic and nuclear signaling steps in ALD - treated T cells .", + "output": [ + "00000000000000000000000000" + ] + }, + { + "input": "We found that ALD induce a transient activation of protein kinase ( PKC ) but have no effect ( in comparison to anti - CD3 antibodies ) on protein tyrosine phosphorylation nor on PCL gamma 1 tyrosine phosphorylation .", + "output": [ + "000000000120100000000012220000000000000" + ] + }, + { + "input": "ALD - induced calcium mobilization and PKC activation are independent of tyrosine protein kinase activity as shown by the lack of effect of herbimycin , a tyrosine - protein kinase - specific inhibitor .", + "output": [ + "0000001000012200000000000012220000" + ] + }, + { + "input": "Although we detected no IL - 2 mRNA in ALD - treated cells , the nuclei of these cells contain proteins capable of binding to three regulatory sequences in the IL - 2 promoter region : NFAT , NF kappa B , and AP - 1 .", + "output": [ + "00001222000000000000000000120012222010122001220" + ] + }, + { + "input": "These binding activities are expressed only in activated T cells .", + "output": [ + "00000000000" + ] + }, + { + "input": "The expression of AP - 1 depended on calcium mobilization and PKC activation .", + "output": [ + "00012200000100" + ] + }, + { + "input": "These data suggest that ALD cause transient but significant changes in T cell transmembrane signaling , although some events induced by stimulation with anti - CD3 antibodies are not induced by ALD .", + "output": [ + "000000000000000000000001222000000" + ] + }, + { + "input": "The signal is transmitted to the nucleus and induces DNA - binding activity by several transcription factors .", + "output": [ + "000000000000000120" + ] + }, + { + "input": "However , the ALD stimulus is not capable of causing complete T cell activation .", + "output": [ + "000000000000000" + ] + }, + { + "input": "The aim of this present study was to investigate the role of protein kinase C ( PKC ) , downstream of p21ras , in activating interleukin - 2 ( IL - 2 ) gene expression .", + "output": [ + "000000000000122010000100012222222200" + ] + }, + { + "input": "It has been reported that PKC is an effector of p21ras in T cells .", + "output": [ + "000001001010000" + ] + }, + { + "input": "Reporter gene experiments demonstrated that NF - kappa B transcriptional activity is not affected by expression of activated p21ras .", + "output": [ + "00000122200000000010" + ] + }, + { + "input": "The C - terminus of the B cell activator Oct - 2 functions as an activation domain in yeast .", + "output": [ + "01220012212200012000" + ] + }, + { + "input": "Oct - 1 and Oct - 2 are human transcriptional activators that bind to the same DNA element but activate distinct sets of genes .", + "output": [ + "1220122001200000000000000" + ] + }, + { + "input": "We expressed these factors in S . cerevisiae and observed greater than 5 - fold stimulation of a lacZ reporter gene only with Oct - 2 .", + "output": [ + "000000000000000000122001220" + ] + }, + { + "input": "Transfer of the Oct - 2 C - terminal domain onto either Oct - 1 ( Oct1 . 2 ) or a nonactivating DNA - binding domain from GAL4 created activators capable of greater than 15 and 10 - fold stimulation of activity , respectively .", + "output": [ + "0001222222001220122000122220100000000000000000" + ] + }, + { + "input": "Thus , the C - terminus of Oct - 2 is sufficient to confer activation potential to nonactive DNA - binding fragments in yeast .", + "output": [ + "0001220122000000001222000" + ] + }, + { + "input": "Glucocorticoid - induced apoptosis of lymphoid cells .", + "output": [ + "00000000" + ] + }, + { + "input": "The induction of cell death in lymphoid cells by glucocorticoids is one of the earliest and most thoroughly studied models of apoptosis .", + "output": [ + "00000000000000000000000" + ] + }, + { + "input": "Although the exact mechanism by which apoptosis occurs in lymphocytes is unknown many biochemical and molecular changes have been shown to occur in these cells in response to glucocorticoids .", + "output": [ + "000000000000000000000000000000" + ] + }, + { + "input": "The role of chromatin degradation and endonucleases in the apoptotic process has been closely studied , as well as the involvement of several oncogenes in glucocorticoid - induced cell lysis .", + "output": [ + "0001001000000000000000010000000" + ] + }, + { + "input": "In addition , the clinical importance of glucocorticoid - induced apoptosis in the treatment of lymphoid neoplasms has recently received increased attention .", + "output": [ + "00000000000000000000000" + ] + }, + { + "input": "Interleukin - 2 induces tyrosine phosphorylation and nuclear translocation of stat3 in human T lymphocytes .", + "output": [ + "1220000000100000" + ] + }, + { + "input": "An early biochemical event associated with T cell activation through the interleukin - 2 receptor ( IL - 2R ) is tyrosine phosphorylation of several intracellular substrates .", + "output": [ + "0000000000012220122000000000" + ] + }, + { + "input": "The exact mechanism by which IL - 2 regulates transcription of different genes is presently unknown .", + "output": [ + "00000122000000000" + ] + }, + { + "input": "In contrast , stat1 proteins were not tyrosine phosphorylated after IL - 2 ligation , whereas tyrosine - phosphorylated stat1 proteins ( 91 and 84 kDa proteins ) were translocated to the nucleus following interferon - gamma treatment of HeLa cells .", + "output": [ + "000000000012200012222012222000000012200000" + ] + }, + { + "input": "Since IL - 2 induced nuclear translocation of the 84 kDa protein and stat3 followed identical kinetics , p84 is a candidate for a new , yet undefined , member of the STAT family .", + "output": [ + "01220000012201000010000000000000000" + ] + }, + { + "input": "Tax acts indirectly by inducing or modifying the action of various host transcription factors , including members of the NF - kappa B / Rel family of enhancer - binding proteins .", + "output": [ + "00000000000012000001222222012220" + ] + }, + { + "input": "In resting T cells , many of these NF - kappa B / Rel factors are sequestered in the cytoplasm by various ankyrin - rich inhibitory proteins , including I kappa B alpha .", + "output": [ + "0000000012222220000000122220012220" + ] + }, + { + "input": "HTLV - I Tax expression leads to the constitutive nuclear expression of biologically active NF - kappa B and c - Rel complexes ; however , the biochemical mechanism ( s ) underlying this response remains poorly understood .", + "output": [ + "122200000000001222012220000000000000000" + ] + }, + { + "input": "In this study , we demonstrate that Tax - stimulated nuclear expression of NF - kappa B in both HTLV - I - infected and Tax - transfected human T cells is associated with the phosphorylation and rapid proteolytic degradation of I kappa B alpha .", + "output": [ + "0000000100000122200000000000000000000000012220" + ] + }, + { + "input": "We further demonstrate that Tax induction of nuclear c - Rel expression is activated by the RelA ( p65 ) subunit of NF - kappa B , which activates transcription of the c - rel gene through an intrinsic kappa B enhancer element .", + "output": [ + "00001000122000001010001222000000122200012220" + ] + }, + { + "input": "In normal cells , the subsequent accumulation of nuclear c - Rel acts to inhibit its own continued production , indicating the presence of an autoregulatory loop .", + "output": [ + "0000000012220000000000000000" + ] + }, + { + "input": "Activation of NF - kappa B in vivo is regulated by multiple phosphorylations .", + "output": [ + "00122200000000" + ] + }, + { + "input": "The activation of nuclear factor kappa B ( NF - kappa B ) in intact cells is mechanistically not well understood .", + "output": [ + "0001222012220000000000" + ] + }, + { + "input": "In HeLa cells as well as in B cells , TNF - alpha rapidly induced nuclear translocation primarily of p50 - p65 , but not of c - rel .", + "output": [ + "000000000000000000012200001220" + ] + }, + { + "input": "Both NF - kappa B precursors and I kappa B alpha became strongly phosphorylated with the same kinetics .", + "output": [ + "0122200122200000000" + ] + }, + { + "input": "In addition to the inducible phosphorylation after stimulation , B lymphocytes containing constitutive nuclear NF - kappa B revealed constitutively phosphorylated p65 and I kappa B alpha .", + "output": [ + "0000000000000012220001012220" + ] + }, + { + "input": "Phosphorylation was accompanied by induced processing of the precursors p100 and p105 and by degradation of I kappa B alpha .", + "output": [ + "000000000101000012220" + ] + }, + { + "input": "As an in vitro model we show that phosphorylation of p105 impedes its ability to interact with NF - kappa B , as has been shown before for I kappa B alpha .", + "output": [ + "000000000010000001222000000012220" + ] + }, + { + "input": "Surprisingly , even p65 , but not c - rel , was phosphorylated after induction in vivo , suggesting that TNF - alpha selectively activates only specific NF - kappa B heteromers and that modifications regulate not only I kappa B molecules but also NF - kappa B molecules .", + "output": [ + "00010001220000000000122000012220000000122200122200" + ] + }, + { + "input": "In fact , cellular NF - kappa B activity was phosphorylation - dependent and the DNA binding activity of p65 - containing NF - kappa B was enhanced by phosphorylation in vitro .", + "output": [ + "000012220000000000012222220000000" + ] + }, + { + "input": "Furthermore , we found that the induction by hydrogen peroxide of NF - kappa B translocation to the nucleus , which is assumed to be triggered by reactive oxygen intermediates , also coincided with incorporation of phosphate into the same subunits that were modified after stimulation by TNF - alpha .", + "output": [ + "000000000001222000000000000000000000000000000001220" + ] + }, + { + "input": "Thus , phosphorylation appears to be a general mechanism for activation of NF - kappa B in vivo .", + "output": [ + "0000000000001222000" + ] + }, + { + "input": "Treatment of HL60 cells with various combinations of retinoids and 1 alpha , 25 dihydroxyvitamin D3 results in differentiation towards neutrophils or monocytes or a failure to differentiate and apoptosis .", + "output": [ + "0000000000000000000000000000000" + ] + }, + { + "input": "It is well documented that treatment of serum - grown HL60 cells with 10 ( - 7 ) M all - trans retinoic acid ( all - trans RA ) induces neutrophil differentiation , whereas treatment with 10 ( - 7 ) M 1 alpha , 25 dihydroxyvitamin D3 ( D3 ) induces differentiation towards monocytes .", + "output": [ + "000000000000000000000000000000000000000000000000000000000" + ] + }, + { + "input": "In recent investigations , using serum - free grown HL60 cells , we observed that all - trans RA , at 10 ( - 7 ) M , did not induce neutrophil differentiation and that all - trans RA , at 10 ( - 8 ) M , reduced the D3 concentration required for monocyte differentiation to 5 x 10 ( - 9 ) M .", + "output": [ + "000000000000000000000000000000000000000000000000000000000000000000" + ] + }, + { + "input": "In this study , co - operative interactions between all - trans and 9 - cis RA and D3 which promote neutrophil and monocyte differentiation of HL60 cells have been analysed in detail .", + "output": [ + "0000000000000000000000000000000000" + ] + }, + { + "input": "Treatment of serum - free grown HL60 cells with 5 x 10 ( - 7 ) M all - trans RA or 9 - cis RA resulted in sub - optimal neutrophil differentiation ( up to 25 % mature cells ) .", + "output": [ + "000000000000000000000000000000000000000000" + ] + }, + { + "input": "As shown for all - trans RA , 9 - cis RA cooperated with D3 to promote monocyte differentiation .", + "output": [ + "00000000000000000000" + ] + }, + { + "input": "Culture of HL60 cells in 5 x 10 ( - 7 ) M 9 - cis RA together with a wide range of concentrations of D3 resulted in promotion of neutrophil differentiation at 10 ( - 15 ) - 10 ( - 12 ) D3 , a failure to differentiate and apoptosis at 10 ( - 11 ) - 10 ( - 10 ) M D3 , followed by co - operativity between 9 - cis RA and 5 x 10 ( - 9 ) M D3 in inducing monocyte differentiation in the absence of neutrophil differentiation .", + "output": [ + "00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000" + ] + }, + { + "input": "Similar results were obtained when HL60 cells were treated with 5 x 10 ( - 7 ) all - trans RA together with a wide range of concentrations of D3 .", + "output": [ + "0000000000000000000000000000000" + ] + }, + { + "input": "Cross titration analyses of the effects of 9 - cis RA and D3 on HL60 cell differentiation were undertaken to determine the boundaries of the concentrations of each agent , alone and in combination , that give rise to optimal neutrophil and monocyte differentiation of HL60 cells .", + "output": [ + "000000000000000000000000000000000000000000000000" + ] + }, + { + "input": "The observed cooperativities between either 9 - cis RA or all - trans RA and D3 have important implications for the use of combinations of these agents in differentiation therapy .", + "output": [ + "0000000000000000000000000000000" + ] + }, + { + "input": "Transcriptional control of steroid - regulated gene networks by nuclear receptor proteins results in the coordinate expression of a limited number of target genes .", + "output": [ + "0001222201220000000000120" + ] + }, + { + "input": "Using this technique we have isolated several differentially expressed sequence tags ( DESTs ) from the mouse thymocyte cell line WEHI 7 . 2 .", + "output": [ + "0000000122201000000000000" + ] + }, + { + "input": "Two of these DESTs , GIG10 and GIG18 , are rapidly induced by dexamethasone within 2 h of treatment .", + "output": [ + "00010101000000000000" + ] + }, + { + "input": "We also used DDPCR to isolate DESTs from androgen - modulated rat ventral prostate tissue , one of which we characterized and found to correspond to the 3 ' end of prostatic spermine binding protein mRNA , a known androgen - regulated gene .", + "output": [ + "00000010000000000000000000012201222200012220" + ] + }, + { + "input": "Modifications of the original DDPCR protocol , which we found can potentially decrease the frequency of isolating false - positive DESTs , are described and the merits of DDPCR , relative to other differential cDNA cloning strategies , are discussed .", + "output": [ + "00000000000000000000100000000000000000000" + ] + }, + { + "input": "Activation of human thymocytes after infection by EBV .", + "output": [ + "000000000" + ] + }, + { + "input": "The discovery of EBV in certain T cell malignancies and the expression of the EBV receptor , CR2 / CD21 , on a population of immature thymocytes , T lymphoblastoid cell lines , and childhood acute T lymphoblastic leukemia cells suggested that EBV - receptor interactions on T cells may be of importance .", + "output": [ + "000000000000001201220000000000000000000000000000000000" + ] + }, + { + "input": "Triggering through CD2 is mitogenic for mature , but not immature , T cells .", + "output": [ + "001000000000000" + ] + }, + { + "input": "However , during infection by EBV , ligation of CD2 caused thymocytes to proliferate in the absence of exogenous cytokines .", + "output": [ + "000000000100000000120" + ] + }, + { + "input": "Immature thymocytes were infected by EBV , as determined by the internalization of the viral genome and its transcriptional activity .", + "output": [ + "000000000000001200000" + ] + }, + { + "input": "In addition , components of the viral replicative pathway were expressed during infection of thymocytes .", + "output": [ + "0000000000000000" + ] + }, + { + "input": "These components included transcription of BZLF - 1 , an early gene that characterizes EBV - infected B cells after disruption of latency .", + "output": [ + "000001220012000000000000" + ] + }, + { + "input": "The consequences of EBV infection of T cells at an early stage of differentiation may lead to failure of normal T cell repertoire development , autoimmunity , or malignancy .", + "output": [ + "000000000000000000000000000000" + ] + }, + { + "input": "Effects of intranasal glucocorticoids on endogenous glucocorticoid peripheral and central function .", + "output": [ + "000000000000" + ] + }, + { + "input": "Glucocorticoids are among the most potent antiinflammatory agents that can be used in the treatment of rhinitis .", + "output": [ + "000000000000000000" + ] + }, + { + "input": "Their mechanisms of action are multiple and complex and a number of reports describe significant systemic effects of locally administered glucocorticoids .", + "output": [ + "0000000000000000000000" + ] + }, + { + "input": "In order to evaluate the short - term systemic effects of intranasally administered glucocorticoids , 14 normal healthy subjects were treated with two doses of either budesonide ( BUD ) or fluticasone propionate ( FP ) for 2 weeks .", + "output": [ + "0000000000000000000000000000000000000000" + ] + }, + { + "input": "Before treatment , at regular intervals during the treatment , 1 week and finally 6 weeks after termination of treatment , the effects on glucocorticoid receptor ( GR ) and methallothionein ( MTIIa ) mRNA expression levels were examined in peripheral lymphocytes using a solution hybridization assay .", + "output": [ + "000000000000000000000000000000000000000000000000" + ] + }, + { + "input": "Serum cortisol , osteocalcin and urinary cortisol levels were also determined .", + "output": [ + "000000000000" + ] + }, + { + "input": "An insulin tolerance test ( ITT ) was performed at the end of the second week of treatment and at the end of the 6 - week washout period with no statistically significant change in cortisol response .", + "output": [ + "00000000000000000000000000000000000000" + ] + }, + { + "input": "In peripheral lymphocytes , GR mRNA levels were significantly down - regulated .", + "output": [ + "0000120000000" + ] + }, + { + "input": "MTIIa mRNA levels increased significantly .", + "output": [ + "120000" + ] + }, + { + "input": "Serum osteocalcin decreased significantly during treatment with both BUD and FP .", + "output": [ + "010000000000" + ] + }, + { + "input": "Serum cortisol decreased after 1 week of treatment whereas urinary cortisol was not affected until the second week of treatment .", + "output": [ + "000000000000000000000" + ] + }, + { + "input": "In conclusion , intranasal glucocorticoids at clinically recommended doses have not only significant systemic effects on adrenal function , but also have an effect on specific gene expression in peripheral lymphocytes .", + "output": [ + "00000000000000000000000000000000" + ] + }, + { + "input": "These effects are receptor - dependent , reversible , and according to serum and urinary cortisol levels and ITT , leave the hypothalamic - pituitary - adrenal function intact .", + "output": [ + "000000000000000000000000000000" + ] + }, + { + "input": "Finally , these short - term systemic effects were not associated with any of the noticeable side - effects usually observed during long - term treatment with glucocorticoids .", + "output": [ + "00000000000000000000000000000" + ] + }, + { + "input": "Biphasic control of nuclear factor - kappa B activation by the T cell receptor complex : role of tumor necrosis factor alpha .", + "output": [ + "00012222000122200012220" + ] + }, + { + "input": "Only p50 NF - kappa B protein bound the kappa B element of interleukin - 2 receptor ( IL - 2R ) alpha chain promoter on resting T cells .", + "output": [ + "012222200122012222222222200000" + ] + }, + { + "input": "However , immediately after TcR / CD3 cross - linking ( after approximately 1 h ; immediate ) binding of p50 . p65 heterodimers was observed .", + "output": [ + "000012200000000000001222000" + ] + }, + { + "input": "This regulation takes place mainly at the level of nuclear translocation of p65 and c - rel , at immediate and early time points .", + "output": [ + "0000000000001012200000000" + ] + }, + { + "input": "Activation also induced c - rel and p105 / p50 mRNA synthesis , but not p65 mRNA whose expression was constitutive .", + "output": [ + "0000000000000001200000" + ] + }, + { + "input": "Interestingly , all those early and late events , but not the immediate ones , were inhibited by a neutralizing anti - tumor necrosis factor alpha ( TNF - alpha ) monoclonal antibody .", + "output": [ + "0000000000000000000012222222222220" + ] + }, + { + "input": "Similarly , cycloheximide prevented the p65 and c - rel translocation and consequent formation of active binding heterodimers , at early and late times .", + "output": [ + "0000010122000000000000000" + ] + }, + { + "input": "Cyclosporin A impaired not only early and late , but also immediate events ; however , addition of TNF - alpha prevented all inhibition .", + "output": [ + "0000000000000000001220000" + ] + }, + { + "input": "TNF - alpha , therefore , emerges as the main factor responsible for a second phase of NF - kappa B regulation , controlling both translocation of p65 and c - rel , and new mRNA synthesis for c - rel and p105 / p50 .", + "output": [ + "1220000000000000012220000001012200010012201220" + ] + }, + { + "input": "The transcription factor Sp1 is required for induction of the murine GM - CSF promoter in T cells .", + "output": [ + "0122000000122220000" + ] + }, + { + "input": "GM - kappa B defines a binding site for NF - kappa B , and GC - box defines a binding site for three ( A1 , A2 , B ) constitutive proteins .", + "output": [ + "1222000001222001220000000101010120" + ] + }, + { + "input": "The major GC - box binding activity A1 was purified and identified as the transcription factor Sp1 .", + "output": [ + "001220010000001220" + ] + }, + { + "input": "We show that depletion of Sp1 ( A1 ) from nuclear extracts specifically decreases in vitro transcription activity on GM - CSF templates .", + "output": [ + "000001010000000000012200" + ] + }, + { + "input": "Since the human GM - CSF promoter has a base difference within the GC - box , we speculate that this may explain why the human promoter is weak and that an upstream enhancer is required for the induction of the human GM - CSF gene .", + "output": [ + "00122220000001220000000000000000120000000122220" + ] + }, + { + "input": "A novel DNA sequence element termed the J element involved in the regulated expression of class II major histocompatibility complex genes was recently described .", + "output": [ + "0012200120000001222220000" + ] + }, + { + "input": "To study this element and its role in class II gene regulation further , a cDNA library was screened with oligonucleotide probes containing both the S element and the nearby J element of the human DPA gene .", + "output": [ + "00000000122000012000000001200012001220" + ] + }, + { + "input": "Several DNA clones were obtained by this procedure , one of which , clone 18 , is reported and characterized here .", + "output": [ + "0120000000000120000000" + ] + }, + { + "input": "The 160 N - terminal amino acids in the nonfinger region of clone 18 are highly homologous with similar regions of several other human , mouse , and Drosophila sequences , defining a subfamily of Kruppel - like zinc finger proteins termed TAB ( tramtrack [ ttk ] - associated box ) here .", + "output": [ + "012222200120120000000001222222000000001220101222222000" + ] + }, + { + "input": "An acidic activation domain is located between the N - terminal conserved region of clone 18 and its zinc fingers .", + "output": [ + "012200001222201200120" + ] + }, + { + "input": "Antisense cDNA to clone 18 inhibited the expression of a reporter construct containing the DPA promoter , indicating its functional importance in the expression of this class II gene .", + "output": [ + "000120000000001200000000001220" + ] + }, + { + "input": "Separation of oxidant - initiated and redox - regulated steps in the NF - kappa B signal transduction pathway .", + "output": [ + "00000000000012220000" + ] + }, + { + "input": "Studies presented here show that overall NF - kappa B signal transduction begins with a parallel series of stimuli - specific pathways through which cytokines ( tumor necrosis factor alpha ) , oxidants ( hydrogen peroxide and mitomycin C ) , and phorbol ester ( phorbol 12 - myristate 13 - acetate ) individually initiate signaling .", + "output": [ + "000000122200000000000000101222000000000000000000000000000" + ] + }, + { + "input": "We distinguish the stimuli - specific pathways by showing that the oxidative stimuli trigger NF - kappa B activation in only one of two human T - cell lines ( Wurzburg but not Jurkat ) , whereas tumor necrosis factor alpha and phorbol 12 - myristate 13 - acetate readily stimulate in both lines .", + "output": [ + "0000000000000012220000000000000000000122200000000000000" + ] + }, + { + "input": "We propose the common pathway as the simplest way of accounting for the common requirements and properties of the signaling pathway .", + "output": [ + "0000000000000000000000" + ] + }, + { + "input": "We include a redox - regulatory mechanism ( s ) in this common pathway to account for the previously demonstrated redox regulation of NF - kappa B activation in Jurkat cells ( in which oxidants do n ' t activate NF - kappa B ) ; we put tyrosine phosphorylation in the common pathway by showing that kinase activity ( inhibitable by herbimycin A and tyrphostin 47 ) is required for NF - kappa B activation by all stimuli tested in both cell lines .", + "output": [ + "0000000000000000000000012220000000000000122200000000000000000000000000012220000000000" + ] + }, + { + "input": "Since internal sites of oxidant production have been shown to play a key role in the cytokine - stimulated activation of NF - kappa B , and since tyrosine kinase and phosphatase activities are known to be altered by oxidants , these findings suggest that intracellular redox status controls NF - kappa B activation by regulating tyrosine phosphorylation event ( s ) within the common step of the NF - kappa B signal transduction pathway .", + "output": [ + "0000000000000000100001222000000000000000000000000122200000000000000012220000" + ] + }, + { + "input": "Deleted chromosome 20 from a patient with Alagille syndrome isolated in a cell hybrid through leucine transport selection : study of three candidate genes .", + "output": [ + "0120000000000000000000000" + ] + }, + { + "input": "Alagille syndrome ( AGS ) is a well - defined genetic entity assigned to the short arm of Chromosome ( Chr ) 20 by a series of observations of AGS patients associated with microdeletions in this region .", + "output": [ + "00000000000000012012222000000000000000" + ] + }, + { + "input": "By fusing lymphoblastoid cells of an AGS patient that exhibited a microdeletion in the short arm of Chr 20 encompassing bands p11 . 23 to p12 . 3 with rodent thermosensitive mutant cells ( CHOtsH1 - 1 ) deficient in - leucyl - tRNA synthetase , we isolated a somatic cell hybrid segregating the deleted human Chr 20 .", + "output": [ + "00000000000000122220012222220000000000012222200000000000120" + ] + }, + { + "input": "This hybrid clone , designated NR2 , was characterized by several methods , including PCR , with eight pairs of oligonucleotides mapped to Chr 20 : D20S5 , D20S41 , D20S42 , D20S56 , D20S57 , D20S58 , adenosine deaminase ( ADA ) , and Prion protein ( PRIP ) ; Restriction Fragment Length Polymorphism ( RFLP ) analyses with four genomic anonymous probes ( D20S5 , cD3H12 , D20S17 , D20S18 ) ; and fluorescent in situ hybridization ( FISH ) with total human DNA and D20Z1 , a sequence specific to the human Chr 20 centromere , as probes .", + "output": [ + "000000000000000000000001201010101010101201000120100000001000012201010101000000000001220100000012220000" + ] + }, + { + "input": "The NR2 hybrid allowed us to exclude three candidate genes for AGS : hepatic nuclear factor 3 beta ( HNF3 beta ) , paired box 1 ( PAX1 ) , and cystatin C ( CST3 ) as shown by their localization outside of the deletion .", + "output": [ + "0000000012000122220120012201000120100000000000" + ] + }, + { + "input": "The NR2 hybrid is a powerful tool for the mapping of new probes of this region , as well as for obtaining new informative probes specific for the deletion by subtractive cloning of the region .", + "output": [ + "000000000000000000000000000000000000" + ] + }, + { + "input": "Such markers will be useful for linkage analysis and screening of cDNA libraries .", + "output": [ + "00000000000120" + ] + }, + { + "input": "Positive and negative regulation of the composite octamer motif of the interleukin 2 enhancer by AP - 1 , Oct - 2 , and retinoic acid receptor .", + "output": [ + "0000001220012201220122001220" + ] + }, + { + "input": "The differentiating agent retinoic acid ( RA ) has been previously reported to interfere with 12 - O - tetradecanoyl - phorbol - 13 - acetate ( TPA ) / Ca ( 2 + ) - induced signals for the regulation of the - 96 to - 66 - bp octamer motif found in the enhancer for the interleukin ( IL ) - 2 gene , which encodes a major T lymphocyte growth factor .", + "output": [ + "000000000000000000000000000000000000000000012222222200000012222220000012220" + ] + }, + { + "input": "The IL - 2 octamer motif is a composite cis - element which binds Oct - 1 and Oct - 2 as well as a TPA / Ca ( 2 + ) - inducible nuclear factor , previously termed octamer - associated protein ( OAP40 ) .", + "output": [ + "01222200012200122012200001222222222200012220100" + ] + }, + { + "input": "We show here that Oct - 2 , despite the presence of an active transcriptional activation domain , requires TPA / Ca ( 2 + ) - induced signals to strongly transactivate the IL - 2 octamer motif in Jurkat T cells .", + "output": [ + "0000122000000000000000000000000001222200000" + ] + }, + { + "input": "The presence of an intact COOH - terminal domain of Oct - 2 contributes to both TPA / Ca ( 2 + ) - induced transactivation and the RA - mediated repression .", + "output": [ + "000012222012200000000000000000000" + ] + }, + { + "input": "Furthermore , transfected c - jun , jun - B , jun - D , c - fos , or Fos - B expression vectors partially substitute for TPA and Ca2 + and cooperate with Oct - 2 for the transactivation of the combined OAP / octamer cis - element .", + "output": [ + "000122222222222222222222200000000001220000001222220" + ] + }, + { + "input": "Mutations of the genuine octamer - binding site abrogate both the binding of Oct - 1 and Oct - 2 and the TPA / Ca ( 2 + ) - induced transactivation of the OAP / octamer motif .", + "output": [ + "000122220000012201220000000000000012220" + ] + }, + { + "input": "Furthermore , retinoic acid receptor ( RAR ) alpha is able to inhibit in vitro the formation of the complex between the nuclear AP - 1 / OAP and its specific binding site , resulting in the interference with Oct - 2 - dependent cis - regulatory function of this AP - 1 element .", + "output": [ + "0012201000000000000000012212000000000001220000000012200" + ] + }, + { + "input": "Missense mutation in exon 7 of the common gamma chain gene causes a moderate form of X - linked combined immunodeficiency .", + "output": [ + "0001200122200000000000" + ] + }, + { + "input": "Clinical and immunologic features of a recently recognized X - linked combined immunodeficiency disease ( XCID ) suggested that XCID and X - linked severe combined immunodeficiency ( XSCID ) might arise from different genetic defects .", + "output": [ + "0000000000000000000000000000000000000" + ] + }, + { + "input": "The recent discovery of mutations in the common gamma chain ( gamma c ) gene , a constituent of several cytokine receptors , in XSCID provided an opportunity to test directly whether a previously unrecognized mutation in this same gene was responsible for XCID .", + "output": [ + "000000012222222000001200000000000000000000000" + ] + }, + { + "input": "The status of X chromosome inactivation in blood leukocytes from obligate carriers of XCID was determined from the polymorphic , short tandem repeats ( CAG ) , in the androgen receptor gene , which also contains a methylation - sensitive HpaII site .", + "output": [ + "0001200000000000000000000000012200000122220" + ] + }, + { + "input": "In addition , X chromosome inactivation in PMNs was variable .", + "output": [ + "00012000000" + ] + }, + { + "input": "Findings from this analysis prompted sequencing of the gamma c gene in this pedigree .", + "output": [ + "000000001220000" + ] + }, + { + "input": "A missense mutation in the region coding for the cytoplasmic portion of the gamma c gene was found in three affected males but not in a normal brother .", + "output": [ + "00000000000001220000000000000" + ] + }, + { + "input": "Therefore , this point mutation in the gamma c gene leads to a less severe degree of deficiency in cellular and humoral immunity than that seen in XSCID .", + "output": [ + "00000001220000000000000000000" + ] + }, + { + "input": "Posttranscriptional regulation of macrophage tissue factor expression by antioxidants .", + "output": [ + "0000120000" + ] + }, + { + "input": "Tissue factor ( TF ) expression by cells of monocyte / macrophage lineage represents an important mechanism underlying the initiation of fibrin deposition at sites of extravascular inflammation .", + "output": [ + "12010000000000000000010000000" + ] + }, + { + "input": "Recent evidence suggests a role for oxidant stress in the signalling pathway of various cell types by virtue of its ability to induce DNA binding of various transcription factors , including nuclear factor kappa B and AP - 1 .", + "output": [ + "0000000000000000000000000001200122201220" + ] + }, + { + "input": "The effect of antioxidant treatment on lipopolysaccharide ( LPS ) - induced TF expression was examined in murine peritoneal macrophages and human monocytes .", + "output": [ + "000000000000100000000000" + ] + }, + { + "input": "Northern blot analysis showed that neither of these agents reduced LPS - stimulated TF mRNA accumulation , thereby suggesting a posttranscriptional mechanism for the effect .", + "output": [ + "00000000000001000000000000" + ] + }, + { + "input": "Immunofluorescence studies of human monocytes using polyclonal anti - TF antibody showed that N - acetyl - cysteine treatment prevented the characteristic plasmalemmal localization of TF antigen that occurs in response to LPS .", + "output": [ + "0000000122200000000000000120000000" + ] + }, + { + "input": "Western blot analysis showed that N - acetyl - cysteine reduced the accumulation of the 47 - kD mature glycoprotein in LPS - treated cells , a finding consistent with the results of the immunofluorescence studies .", + "output": [ + "0000000000000001222200000000000000000" + ] + }, + { + "input": "Furthermore , these conditions did not result in an accumulation of the less mature forms of TF .", + "output": [ + "000000000000000010" + ] + }, + { + "input": "When considered together , these data suggest that antioxidants exert their effects by impairing translation and / or by causing degradation of newly translated protein .", + "output": [ + "00000000000000000000000120" + ] + }, + { + "input": "The effect of antioxidants on tumor necrosis factor appeared to be species specific , with no effect on LPS - induced tumor necrosis factor in murine cells , but with inhibition in human monocytes .", + "output": [ + "00000122000000000000000000000000000" + ] + }, + { + "input": "The posttranscriptional effect of antioxidants on TF expression data suggests a novel mechanism whereby these agents might modulate monocyte / macrophage activation .", + "output": [ + "00000010000000000000000" + ] + }, + { + "input": "Characterization of the CD48 gene demonstrates a positive element that is specific to Epstein - Barr virus - immortalized B - cell lines and contains an essential NF - kappa B site .", + "output": [ + "000120000000000000000000000122220" + ] + }, + { + "input": "Epstein - Barr virus ( EBV ) infection of mature , resting B cells drives them to become lymphoblasts expressing high levels of cell surface molecules , such as CD48 , characteristically expressed on normal activated B cells .", + "output": [ + "000000000000000000000000000001000000000" + ] + }, + { + "input": "Here , we report on the identification of an enhancer element in the CD48 gene which reproducibly confers strong transcriptional activity only in EBV - positive B - lymphoblastoid cell lines .", + "output": [ + "00000000012001200000000000000000" + ] + }, + { + "input": "The element is not activated upon infection of established EBV - negative B - cell lines , indicating that EBV fails to drive these cells to a fully lymphoblastoid phenotype .", + "output": [ + "0000000000000000000000000000000" + ] + }, + { + "input": "We have detected a specific nuclear protein complex that binds to the element and show that NF - kappa B1 ( p50 ) is a part of this complex .", + "output": [ + "000001220000000012220100000000" + ] + }, + { + "input": "The EBV - encoded latent membrane protein 1 is capable of transactivating the isolated CD48 NF - kappa B site but not the intact element , suggesting that the latent membrane protein 1 - driven activation of NF - kappa B / Rel must interact with other regulatory pathways to control expression of cellular genes as EBV drives resting B cells into the cell cycle .", + "output": [ + "012222220000001122220001200001222000012222200000000000000000000000" + ] + }, + { + "input": "Thapsigargin induces IL - 2 receptor alpha - chain in human peripheral and Jurkat T cells via a protein kinase C - independent mechanism .", + "output": [ + "0012222220000000001220000" + ] + }, + { + "input": "TG plus phorbol myristate acetate ( PMA ) but not TG alone induced IL - 2 in Jurkat T cells , suggesting that TG had no effect on protein kinase C ( PKC ) .", + "output": [ + "00000000000001220000000000001220100" + ] + }, + { + "input": "However , TG induced increases in IL - 2R alpha protein as well as IL - 2R alpha mRNA in Jurkat T cells in a dose - dependent manner .", + "output": [ + "000000122220001222200000000000" + ] + }, + { + "input": "Further , like PMA , TG markedly induced NF kappa B in Jurkat T cells .", + "output": [ + "0000000012200000" + ] + }, + { + "input": "In toto , these results suggest that TG induces IL - 2R alpha in human T cells through a PKC - independent pathway .", + "output": [ + "000000000122200000010000" + ] + }, + { + "input": "Physiological concentration of estradiol inhibits polymorphonuclear leukocyte chemotaxis via a receptor mediated system .", + "output": [ + "00000000000000" + ] + }, + { + "input": "Estrogen exhibits a variety of actions , including immuno - modulatory effects , in vivo and in vitro .", + "output": [ + "0000000000000000000" + ] + }, + { + "input": "The mechanism by which estrogen exerts its anti - inflammatory effect is not yet understood .", + "output": [ + "0000000000000000" + ] + }, + { + "input": "We investigated the possible mechanisms of estradiol acting via the polymorphonuclear leukocytes ( PMNs ) , which are important in the immune response .", + "output": [ + "000000000000000000000000" + ] + }, + { + "input": "These observations suggest that 17 beta - estradiol suppressed the chemotaxis of PMNs by a receptor - dependent mechanism .", + "output": [ + "00000000000000000000" + ] + }, + { + "input": "Estrogen may modify the activity of neutrophils during the normal menstrual cycle , not only during pregnancy , and influence inflammation .", + "output": [ + "0000000000000000000000" + ] + }, + { + "input": "Identification of the TCL1 gene involved in T - cell malignancies .", + "output": [ + "000120000000" + ] + }, + { + "input": "The TCL1 locus on chromosome 14q32 . 1 is frequently involved in chromosomal translocations and inversions with one of the T - cell receptor loci in human T - cell leukemias and lymphomas .", + "output": [ + "0120122200000000000012222000000000" + ] + }, + { + "input": "The chromosome 14 region translocated or rearranged involves approximately 350 kb of DNA at chromosome band 14q32 . 1 .", + "output": [ + "01220000000000000000" + ] + }, + { + "input": "Within this region we have identified a gene coding for a 1 . 3 - kb transcript , expressed only in restricted subsets of cells within the lymphoid lineage and expressed at high levels in leukemic cells carrying a t ( 14 ; 14 ) ( q11 ; q32 ) chromosome translocation or a inv ( 14 ) ( q11 ; q32 ) chromosome inversion .", + "output": [ + "000000000001222220000000000000000000000000000000000000000000000000" + ] + }, + { + "input": "The cognate cDNA sequence reveals an open reading frame of 342 nt encoding a protein of 14 kDa .", + "output": [ + "0122001220000012220" + ] + }, + { + "input": "The TCL1 gene sequence , which , to our knowledge , shows no sequence homology with other human genes , is preferentially expressed early in T - and B - lymphocyte differentiation .", + "output": [ + "012000000000000001200000000000000" + ] + }, + { + "input": "Identification of a region which directs the monocytic activity of the colony - stimulating factor 1 ( macrophage colony - stimulating factor ) receptor promoter and binds PEBP2 / CBF ( AML1 ) .", + "output": [ + "0000000000012222222222222001220100" + ] + }, + { + "input": "The receptor for the macrophage colony - stimulating factor ( or colony - stimulating factor 1 [ CSF - 1 ] ) is expressed from different promoters in monocytic cells and placental trophoblasts .", + "output": [ + "0000122220012222012200000000000000" + ] + }, + { + "input": "We have demonstrated that the monocyte - specific expression of the CSF - 1 receptor is regulated at the level of transcription by a tissue - specific promoter whose activity is stimulated by the monocyte / B - cell - specific transcription factor PU . 1 ( D . - E . Zhang , C . J . Hetherington , H . - M . Chen , and D . G . Tenen , Mol . Cell . Biol . 14 : 373 - 381 , 1994 ) .", + "output": [ + "00000000000122200000000012220000001222222221220000000000000000000000000000000000000000000" + ] + }, + { + "input": "Here we report that the tissue specificity of this promoter is also mediated by sequences in a region II ( bp - 88 to - 59 ) , which lies 10 bp upstream from the PU . 1 - binding site .", + "output": [ + "000000000100000001200000000000122001222220" + ] + }, + { + "input": "When analyzed by DNase footprinting , region II was protected preferentially in monocytic cells .", + "output": [ + "000100120000000" + ] + }, + { + "input": "Electrophoretic mobility shift assays confirmed that region II interacts specifically with nuclear proteins from monocytic cells .", + "output": [ + "00000012000120000" + ] + }, + { + "input": "Competition and supershift experiments indicate that Mono B contains a member of the polyomavirus enhancer - binding protein 2 / core - binding factor ( PEBP2 / CBF ) family , which includes the AML1 gene product , while Mono A is a distinct complex preferentially expressed in monocytic cells .", + "output": [ + "000000120000012222222222222222200000000120000000000" + ] + }, + { + "input": "Promoter constructs with mutations in these sequence elements were no longer expressed specifically in monocytes .", + "output": [ + "1200000000000000" + ] + }, + { + "input": "These results indicate that the monocyte / B - cell - specific transcription factor PU . 1 and the Mono A and Mono B protein complexes act in concert to regulate monocyte - specific transcription of the CSF - 1 receptor .", + "output": [ + "000001222222221220012222220000000000012220" + ] + }, + { + "input": "We examined the effect of pyrrolidine dithiocarbamate ( PDTC ) , which potently blocks the activation of nuclear factor kappa B ( NF - kappa B ) , on the induction of apoptosis by a variety of agents .", + "output": [ + "000000000000000001222012220000000000000" + ] + }, + { + "input": "Treatment of a human promyelocytic leukemia cell line , HL - 60 , with 10 micrograms / mL etoposide or 2 microM 1 - beta - D - arabinofuranosylcyto induced NF - kappa B activation within 1 hr and subsequently caused apoptosis within 3 - 4 hr .", + "output": [ + "000000000000000000000000000000122200000000000000" + ] + }, + { + "input": "The simultaneous addition of 50 - 500 microM PDTC with these agents blocked NF - kappa B activation and completely abrogated both morphologically apoptotic changes and internucleosomal DNA fragmentation for up to 6 hr .", + "output": [ + "00000000000001222000000000000000000" + ] + }, + { + "input": "The inhibitory effect of PDTC was also observed in etoposide - and dexamethasone - induced apoptosis in human thymocytes at a concentration of 1 - 10 microM .", + "output": [ + "0000000000000000000000000000" + ] + }, + { + "input": "Pretreatment of HL - 60 cells or thymocytes with 100 - 500 microM OP for 2 hr , but not 10 - 60 mM NAC , suppressed subsequent occurrence of apoptosis induced by etoposide .", + "output": [ + "00000000000000000000000000000000000" + ] + }, + { + "input": "These results suggest that the activation of NF - kappa B plays an important role in the apoptotic process of human hematopoietic cells .", + "output": [ + "000000012220000000000000" + ] + }, + { + "input": "Overexpression of protein kinase C - zeta stimulates leukemic cell differentiation .", + "output": [ + "001222200000" + ] + }, + { + "input": "A function for protein kinase C - zeta ( PKC - zeta ) , a member of the phorbol ester nonresponsive atypical protein kinase C subfamily , in modulating differentiation was examined in the leukemic U937 cell .", + "output": [ + "00012222012200000000001222000000000000" + ] + }, + { + "input": "Transfected U937 cells stably overexpressing PKC - zeta displayed a longer doubling time , lower saturation density at confluency , and an increase in adherence to plastic as compared to control cells .", + "output": [ + "000001220000000000000000000000000" + ] + }, + { + "input": "In contrast to parental U937 cells , PKC - zeta cells constitutively expressed mRNA transcripts for c - jun and a low mobility AP - 1 binding activity .", + "output": [ + "00000000000001201220000122000" + ] + }, + { + "input": "Thus , PKC - zeta overexpression stimulates a type of phenotypic differentiation that differs significantly from maturation occurring upon activation of other PKC subfamilies induced by phorbol ester treatment .", + "output": [ + "001220000000000000000012000000" + ] + }, + { + "input": "A family of serine proteases expressed exclusively in myelo - monocytic cells specifically processes the nuclear factor - kappa B subunit p65 in vitro and may impair human immunodeficiency virus replication in these cells .", + "output": [ + "00012000000000012222220000000000000" + ] + }, + { + "input": "Two groups of U937 promonocytic cells were obtained by limiting dilution cloning which differed strikingly in their ability to support human immunodeficiency virus 1 ( HIV - 1 ) replication .", + "output": [ + "0000000000000000000000000000000" + ] + }, + { + "input": "` ` Plus ' ' clones replicated the virus efficiently , whereas ` ` minus ' ' clones did not .", + "output": [ + "000000000000000000000" + ] + }, + { + "input": "We examined these clones for differences in nuclear factor ( NF ) - kappa B activity which might account for the observed phenomenon .", + "output": [ + "000000012222222000000000" + ] + }, + { + "input": "Stimulation of plus clones liberated the classical p50 - p65 complex from cytoplasmic pools , whereas minus clones produced an apparently novel , faster - migrating complex , as judged by electrophoretic mobility shift assays .", + "output": [ + "000000012220000000000001222000000000" + ] + }, + { + "input": "However , the p65 subunit was COOH - terminally truncated , as shown by immunoprecipitation .", + "output": [ + "0001200000000000" + ] + }, + { + "input": "The truncation resulted from limited proteolysis of p65 during cellular extraction which released particular lysosomal serine proteases , such as elastase , cathepsin G , and proteinase 3 .", + "output": [ + "00000001000000122000101200120" + ] + }, + { + "input": "These specific proteases are coordinately expressed and were present exclusively in the minus U937 clones , but not in the plus clones , as demonstrated in the case of cathepsin G .", + "output": [ + "00000000000000000000000000000120" + ] + }, + { + "input": "In addition , these proteases were detected in certain subclones of THP - 1 and HL - 60 cells and in primary monocytes , in each case correlating with the truncated from of p65 .", + "output": [ + "00000000000000000000000000000000010" + ] + }, + { + "input": "We demonstrate in vitro cleavage of p65 by purified elastase and cathepsin G .", + "output": [ + "00000010010120" + ] + }, + { + "input": "It is possible that particular serine proteases may have inhibiting effects on the replication of HIV - 1 in myelo - monocytic cells .", + "output": [ + "000001200000000000000000" + ] + }, + { + "input": "The data also demonstrate that special precautions must be taken when making extracts from myelo - monocytic cells .", + "output": [ + "0000000000000000000" + ] + }, + { + "input": "A germline TaqI restriction fragment length polymorphism in the progesterone receptor gene in ovarian carcinoma [ see comments ]", + "output": [ + "0122222001220000000" + ] + }, + { + "input": "Clinical outcome in ovarian carcinoma is predicted by progesterone receptor status , indicating an endocrine aspect to this disease .", + "output": [ + "00000000120000000000" + ] + }, + { + "input": "Peripheral leucocyte genomic DNAs were obtained from 41 patients with primary ovarian carcinoma and 83 controls from Ireland , as well as from 26 primary ovarian carcinoma patients and 101 controls in Germany .", + "output": [ + "1222000000000000000000000000000000" + ] + }, + { + "input": "Southern analysis using a human progesterone receptor ( hPR ) cDNA probe identified a germline TaqI restriction fragment length polymorphism ( RFLP ) defined by two alleles : T1 , represented by a 2 . 7 kb fragment ; and T2 , represented by a 1 . 9 kb fragment and characterised by an additional TaqI restriction site with respect to T1 .", + "output": [ + "000012222222001222220100000010000122220010000122220000012200010" + ] + }, + { + "input": "An over - representation of T2 in ovarian cancer patients compared with controls in the pooled Irish / German population ( P < 0 . 025 ) was observed .", + "output": [ + "000001000000000000000000000000" + ] + }, + { + "input": "A difference ( P < 0 . 02 ) in the distribution of the RFLP genotypes between Irish and German control populations was also observed .", + "output": [ + "00000000000000100000000000" + ] + }, + { + "input": "The allele distributions could not be shown to differ significantly from Hardy - Weinberg distribution in any subgroup .", + "output": [ + "0000000000000000000" + ] + }, + { + "input": "Using hPR cDNA region - specific probes , the extra TaqI restriction site was mapped to intron G of the hPR gene .", + "output": [ + "01222220000000001200120" + ] + }, + { + "input": "Recent biochemical and genetic studies indicate that in addition to the octamer - binding proteins Oct - 1 and Oct - 2 , other B cell components are required for lymphoid - restricted , octamer site - mediated immunoglobulin gene promoter activity .", + "output": [ + "0000000000012221220122001220000000000012200" + ] + }, + { + "input": "Using a genetic screen in yeast , we have isolated B cell - derived cDNAs encoding Oct - binding factor 1 ( OBF - 1 ) , a novel protein that specifically associates with Oct - 1 and Oct - 2 .", + "output": [ + "000000000012222012222012200000000012201220" + ] + }, + { + "input": "Biochemical studies demonstrate that OBF - 1 has no intrinsic DNA - binding activity and recognizes the POU domains of Oct - 1 and Oct - 2 , but not those of Oct - 4 and Oct - 6 .", + "output": [ + "0000122000000000012012201220000012201220" + ] + }, + { + "input": "Furthermore , expression of OBF - 1 in HeLa cells selectively stimulates the activity of a natural immunoglobulin promoter in an octamer site - dependent manner .", + "output": [ + "000012200000000001200120000" + ] + }, + { + "input": "Thus , OBF - 1 has all the properties expected for a B cell - specific transcriptional coactivator protein .", + "output": [ + "00122000000012222220" + ] + }, + { + "input": "Modulation of transcription factor NF kappa B activity by intracellular glutathione levels and by variations of the extracellular cysteine supply .", + "output": [ + "001222200000000000000" + ] + }, + { + "input": "HIV - infected individuals and SIV - infected rhesus macaques have , on the average , decreased plasma cysteine and cystine concentrations and decreased intracellular glutathione levels .", + "output": [ + "0000000000000000000000000000" + ] + }, + { + "input": "We now show that a depletion of intracellular glutathione in a human T cell line ( Molt - 4 ) inhibits the activation and nuclear translocation of the transcription factor NF kappa B , whereas incubation with increasing extracellular concentrations of cysteine inhibits the DNA - binding and transactivating activity of NF kappa B .", + "output": [ + "0000000000000000000000000000122220000000000000000001220" + ] + }, + { + "input": "Because inhibition of DNA - binding activity is associated with increasing intracellular glutathione disulfide levels and GSSG can be shown to inhibit the DNA - binding activity directly in cell - free systems , our studies suggest that GSSG is a physiologically relevant inhibitor in intact cells also .", + "output": [ + "0000000000000000100000000000000000000010000000000" + ] + }, + { + "input": "NF kappa B controls many immunologically important genes , so our studies suggest that the immune system may be sensitive not only against a cysteine and glutathione deficiency but also against an excess of cysteine .", + "output": [ + "122001220000000000000000000000000000" + ] + }, + { + "input": "Two distinct signalling pathways are involved in the control of the biphasic junB transcription induced by interleukin - 6 in the B cell hybridoma 7TD1 .", + "output": [ + "00000000000010001220000000" + ] + }, + { + "input": "We have measured the level of junB mRNA in the B hybridoma cell line 7TD1 , under interleukin - 6 ( IL - 6 ) stimulation .", + "output": [ + "000000120000000001220122000" + ] + }, + { + "input": "IL - 6 increases junB mRNA in a biphasic fashion .", + "output": [ + "12201200000" + ] + }, + { + "input": "At variance , the second peak which has never been reported previously , lasted several hours .", + "output": [ + "00000000000000000" + ] + }, + { + "input": "As a consequence of its effect on junB mRNA , IL - 6 stimulated , in a biphasic fashion , the nuclear accumulation of the JunB protein .", + "output": [ + "0000000120122000000000000120" + ] + }, + { + "input": "In this study , we demonstrated that IL - 6 regulation occurred exclusively at the transcriptional level and that the bimodal increase of junB mRNA and JunB protein can be accounted for by a biphasic stimulation of junB transcription .", + "output": [ + "0000000122000000000000012012000000000100" + ] + }, + { + "input": "Furthermore , our data point to two major differences between the mechanism of control of the early and the late IL - 6 - induced junB transcription waves .", + "output": [ + "00000000000000000000122001000" + ] + }, + { + "input": "First , cycloheximide strongly potentiated the transcription of the second wave , whereas it failed to affect the early - induced burst .", + "output": [ + "00000000000000000000000" + ] + }, + { + "input": "Conversely , genistein , another tyrosine kinase inhibitor , totally abolished the expression of the second peak of junB mRNA whereas it did not affect the expression of the first peak .", + "output": [ + "00000000000000000012000000000000" + ] + }, + { + "input": "Altogether these data indicate that , in 7TD1 cells , IL - 6 controls junB transcription in a biphasic fashion by means of two separate transduction pathways .", + "output": [ + "0000000000122010000000000000" + ] + }, + { + "input": "A newly established megakaryoblastic / erythroid cell line that differentiates to red cells in the presence of erythropoietin and produces platelet - like particles .", + "output": [ + "0000000000000000010000000" + ] + }, + { + "input": "In August , 1992 , we established a leukemic cell line ( NS - Meg ) from a patient in megakaryoblastic transformation of Philadelphia chromosome - positive chronic myeloid leukemia .", + "output": [ + "0000000000000000000000000000000" + ] + }, + { + "input": "The NS - Meg cells were positive for alpha - naphthyl acetate esterase and periodic acid - Schiff ( PAS ) staining and for surface CD4 , CD7 , CD13 , CD34 , CD41a , and glycophorin A antigens .", + "output": [ + "0000000012222000000000000101010101001220" + ] + }, + { + "input": "Ultrastructurally , the cells had alpha - granules , demarcation membranes , and platelet peroxidase activity .", + "output": [ + "00000000000001200" + ] + }, + { + "input": "The NS - Meg cells spontaneously produced platelet - like particles which contained alpha - granules , mitochondria and dense bodies , strongly suggesting platelet production .", + "output": [ + "000000000000000000000000000" + ] + }, + { + "input": "Phorbol - 12 - myristate - 13 - acetate increased the expression of both CD41a and CD61 antigens .", + "output": [ + "0000000000000010000" + ] + }, + { + "input": "Untreated NS - Meg cells expressed mRNA for the Epo receptor ( EpoR ) , for GATA - 1 , and for alpha 1 , alpha 2 and gamma globin genes .", + "output": [ + "00000010012010001220001222222220" + ] + }, + { + "input": "These results indicate that NS - Meg cells undergo terminal differentiation of both megakaryocytic and erythroid lineages .", + "output": [ + "000000000000000000" + ] + }, + { + "input": "This cell line should be a very useful tool for the investigation of both megakaryocytic and erythroid maturation .", + "output": [ + "0000000000000000000" + ] + }, + { + "input": "Differential regulation of proto - oncogenes c - jun and c - fos in T lymphocytes activated through CD28 .", + "output": [ + "00012212201220000010" + ] + }, + { + "input": "In addition to activation of phospholipase C gamma 1 , ligation of this receptor also seems to activate a calcium - independent , CD28 - specific pathway .", + "output": [ + "0000012220000000000000010000" + ] + }, + { + "input": "In this paper , we report that cross - linking of CD28 ( but not CD2 , CD5 , LFA - 1 , or CD7 ) leads to an elevation of c - jun mRNA , with only minimal activation of c - fos expression .", + "output": [ + "0000000000010001010122001000000122200000012200" + ] + }, + { + "input": "CD28 - dependent induction of c - jun expression requires protein tyrosine kinase activity , but does not depend on activation of a phorbol ester - responsive protein kinase C or elevation of cytosolic calcium .", + "output": [ + "100001220012200000000001222222000000" + ] + }, + { + "input": "Furthermore , CD28 - dependent elevation of c - jun mRNA does not appear to be mediated at the level of mRNA stability .", + "output": [ + "001000012220000000000000" + ] + }, + { + "input": "A mechanism is suggested whereby expression of c - jun and junB , in the absence of members of the fos family , can prevent inappropriate activation of T cells caused by ligation of CD28 in the absence of a specific antigenic stimulus .", + "output": [ + "00000001220100000000120000000000001000000000" + ] + }, + { + "input": "Infection with a variant of simian immunodeficiency virus , SIVsmmPBj14 , leads to severe acute disease in macaques .", + "output": [ + "0000000000000000000" + ] + }, + { + "input": "This study was designed to investigate the functional significance of previously described mutations in the viral long terminal repeat ( LTR ) and to elucidate their contribution to the unique phenotype of SIVsmmPBj14 .", + "output": [ + "0000000000000001222010000000000000" + ] + }, + { + "input": "LTR - directed transcription was measured by using luciferase reporter constructs that were transiently transfected into cultured cells .", + "output": [ + "1000000012200000000" + ] + }, + { + "input": "These LTRs differ by five point mutations and a 22 - bp duplication in SIVsmmPBj14 , which includes a nuclear factor kappa B ( NF kappa B ) site .", + "output": [ + "010000000122200000012222222220" + ] + }, + { + "input": "Transcriptional differences between these LTRs were further enhanced by two - to threefold upon treatment of cells with phorbol ester or tumor necrosis factor alpha or by cotransfection with plasmids expressing NF kappa B subunits .", + "output": [ + "000010000000000000000122200001012200" + ] + }, + { + "input": "Finally , infectious virus stocks that were isogenic except for the LTR were generated .", + "output": [ + "000000000001000" + ] + }, + { + "input": "The LTR from SIVsmmPBj14 was found to confer an increase in the kinetics of virus replication in cultured cells .", + "output": [ + "01000000000000000000" + ] + }, + { + "input": "Inclusion of this LTR in recombinant SIVs also resulted in a two - to threefold rise in the extent of cellular proliferation that was induced in quiescent simian peripheral blood mononuclear cells .", + "output": [ + "000100000000000000000000000000000" + ] + }, + { + "input": "These studies are consistent with the hypothesis that LTR mutations assist SIVsmmPBj14 in responding efficiently to cellular stimulation and allow it to replicate to high titers during the acute phase of viral infection .", + "output": [ + "0000000010000000000000000000000000" + ] + }, + { + "input": "Constitutive nuclear NF - kappa B in cells of the monocyte lineage .", + "output": [ + "0122220000000" + ] + }, + { + "input": "In monocytes , the nuclear factor NF - kappa B has been invoked as an important transcription factor in the expression of cytokine genes , of cell - surface receptors and in the expression of human immunodeficiency virus .", + "output": [ + "000012222200000012000012001222000000000" + ] + }, + { + "input": "In our studies , cells of the human monocytic line Mono Mac 6 , cultured in medium containing fetal - calf serum and low levels of lipopolysaccharide ( LPS ) , also exhibit such ' constitutive ' NF - kappa B , as demonstrated by mobility - shift analysis of nuclear extracts .", + "output": [ + "00000000000000000000000000000000000001222000000000000" + ] + }, + { + "input": "Protein - DNA complexes of constitutive NF - kappa B are similar in mobility to the LPS - induced NF - kappa B and both are recognized by an antibody specific to the p50 subunit of NF - kappa B .", + "output": [ + "00000012220000001222222000000000012012220" + ] + }, + { + "input": "By contrast , treatment of cells with pyrrolidine dithiocarbamate ( PDTC ) will only block LPS - induced NF - kappa B , but not the constitutive binding protein .", + "output": [ + "000000000000000122222200001220" + ] + }, + { + "input": "When ordered according to stage of maturation , the amount of constitutive NF - kappa B was not increased in more mature cell lines .", + "output": [ + "0000000000001222000000000" + ] + }, + { + "input": "Furthermore , when inducing differentiation in Mono Mac 6 cells , with vitamin D3 , no change in constitutive or inducible NF - kappa B can be detected .", + "output": [ + "00000000000000000000012220000" + ] + }, + { + "input": "Analysis of primary cells revealed substantial constitutive NF - kappa B - binding activity in blood monocytes , pleural macrophages and alveolar macrophages .", + "output": [ + "000000012220000000000000" + ] + }, + { + "input": "The level of constitutive NF - kappa B in these cells is variable and is frequently found to be lower in the more mature macrophages .", + "output": [ + "00001222000000000000000000" + ] + }, + { + "input": "Constitutive NF - kappa B was not maintained by autocrine action of cytokines TNF , interleukin 6 , interleukin 10 , granulocyte - macrophage colony - stimulating factor or macrophage colony - stimulating factor , since neutralizing antibodies did not reduce constitutive DNA - binding activity .", + "output": [ + "01222000000011012010012222220122220000000000000" + ] + }, + { + "input": "Furthermore , blockade of prostaglandin or leukotriene biosynthesis did not affect constitutive NF - kappa B .", + "output": [ + "00000000000012220" + ] + }, + { + "input": "( ABSTRACT TRUNCATED AT 400 WORDS )", + "output": [ + "0000000" + ] + }, + { + "input": "Steel factor affects SCL expression during normal erythroid differentiation .", + "output": [ + "1201000000" + ] + }, + { + "input": "Steel factor is one of the growth factors that controls the proliferation and differentiation of hematopoietic cells and SCL , also known as Tcl - 5 or Tal - 1 , is a transcription factor involved in erythropoiesis .", + "output": [ + "120000120000000000100001220122000120000" + ] + }, + { + "input": "In this report , we studied the role of SCL in the proliferation of human peripheral blood burst - forming unit - erythroid ( BFU - E ) and the effects of Steel factor on SCL expression in proliferating erythroid cells .", + "output": [ + "000000000000000000000000000000001201000000" + ] + }, + { + "input": "BFU - E - derived colonies increase progressively in size , as determined by cell number , from day 7 to day 14 of culture , with the greatest increase in colony size ( 10 - fold expansion ) occurring between day 7 and day 10 .", + "output": [ + "00000000000000000000000000000000000000000000000" + ] + }, + { + "input": "SCL protein levels in BFU - E - derived cells were highest in day 7 cells and decreased progressively from day 7 to day 14 of culture , suggesting an association of SCL with erythroid proliferation .", + "output": [ + "1200000000000000000000000000000010000" + ] + }, + { + "input": "The role of SCL in Steel factor - induced erythroid proliferation was then examined .", + "output": [ + "000101200000000" + ] + }, + { + "input": "In day 7 and day 10 erythroid precursors cultured with Steel factor , SCL protein was increased significantly compared to control .", + "output": [ + "0000000000120120000000" + ] + }, + { + "input": "The increase in SCL protein levels in early erythroid precursors stimulated with Steel factor suggests one mechanism through which Steel factor may enhance normal erythroid proliferation .", + "output": [ + "000100000000120000012000000" + ] + }, + { + "input": "SCL mRNA levels assessed by Northern blot in day 7 cells did not increase significantly in response to Steel factor stimulation , suggesting that posttranscriptional mechanisms may also be important in the increase in SCL protein observed in response to Steel .", + "output": [ + "120000000000000000120000000000000012000010" + ] + }, + { + "input": "C / EBP beta regulation of the tumor necrosis factor alpha gene .", + "output": [ + "1222000122220" + ] + }, + { + "input": "The mechanism ( s ) responsible for the cell type - specific regulation of TNF alpha is not known .", + "output": [ + "00000000000000120000" + ] + }, + { + "input": "C / EBP beta activated the TNF alpha gene promoter in cotransfection assays and bound to it at a site which failed to bind the closely related protein C / EBP alpha .", + "output": [ + "122200122200000000000000000012220" + ] + }, + { + "input": "Finally , a dominant - negative version of C / EBP beta blocked TNF alpha promoter activation in myeloid cells .", + "output": [ + "000000001222012200000" + ] + }, + { + "input": "Our results implicate C / EBP beta as an important regulator of TNF alpha by myelomonocytic cells .", + "output": [ + "000122200000120000" + ] + }, + { + "input": "Engagement of the T cell receptor for antigen activates phospholipase C resulting in an increase in intracellular free calcium concentration ( [ Ca2 + ] i ) and activation of protein kinase C ( PKC ) .", + "output": [ + "0001220001200000000000000000001220100" + ] + }, + { + "input": "Increased [ Ca2 + ] i activates Ca2 + / calmodulin - dependent kinases including the multifunctional Ca2 + / calmodulin - dependent protein kinase II ( CaM - K II ) , as well as calcineurin , a type 2B protein phosphatase .", + "output": [ + "00000001222222000122222222012220000010012220" + ] + }, + { + "input": "Recent studies have identified calcineurin as a key enzyme for interleukin ( IL ) - 2 and IL - 4 promoter activation .", + "output": [ + "00001000000000000000000" + ] + }, + { + "input": "gamma B * CaM - K and delta CaM - AI , known to exhibit constitutive Ca ( 2 + ) - independent activity , were cotransfected ( alone or in combination ) in Jurkat T cells with a plasmid containing the intact IL - 2 promoter driving the expression of the chloramphenicol acetyltransferase reporter gene .", + "output": [ + "122222012220000000000000000000000000000000012220000012220" + ] + }, + { + "input": "Cotransfection of gamma B * CaM - K with the IL - 2 promoter construct downregulated its transcription in response to stimulation with ionomycin and phorbol myristate acetate ( PMA ) .", + "output": [ + "00122222001222200000000000000000" + ] + }, + { + "input": "The inhibitory effect of CaM - K II on IL - 2 promoter was associated with decreased transcription of its AP - 1 and NF - AT transactivating pathways .", + "output": [ + "000012220122200000000000000000" + ] + }, + { + "input": "Under the same conditions , delta CaM - AI superinduced IL - 2 promoter activity ( approximately twofold increase ) .", + "output": [ + "000001222012220000000" + ] + }, + { + "input": "gamma B * CaM - K also downregulated the activation of AP - 1 in response to transfection with a constitutively active mutant of PKC or stimulation with PMA .", + "output": [ + "122222000001220000000000100000" + ] + }, + { + "input": "These results suggest that CaM - K II may exert negative influences on cytokine gene transcription in human T cells , and provide preliminary evidence for negative cross - talk with the calcineurin - and PKC - dependent signaling systems .", + "output": [ + "00001222000001200000000000000000000000000" + ] + }, + { + "input": "Induction of ICAM - 1 and LFA - 3 by Tax1 of human T - cell leukemia virus type 1 and mechanism of down - regulation of ICAM - 1 or LFA - 1 in adult - T - cell - leukemia cell lines .", + "output": [ + "001220122010000000000000000122012200000000000" + ] + }, + { + "input": "The present study was undertaken to determine the role of HTLV - I TaxI in the up - regulation of ICAM - I and LFA - 3 in human T cells transformed with HTLV - I and the mechanism of down - regulation of ICAM - I and LFA - I in ATL - derived cell lines .", + "output": [ + "0000000000122200000012201220000000000000000012201220000000" + ] + }, + { + "input": "The response of LFA - 3 to TaxI induction was , on the other hand , relatively slow and weak , and might be indirect .", + "output": [ + "00012201000000000000000000" + ] + }, + { + "input": "Transactivation of the ICAM - I promoter by TaxI was further shown by co - transfection of a CAT reporter construct with the ICAM - I promoter and a plasmid expressing TaxI .", + "output": [ + "000122201000000000122001222001010" + ] + }, + { + "input": "The mechanism of down - regulation of ICAM - I or LFA - I in 4 ATL cell lines was next examined .", + "output": [ + "00000001220122000000000" + ] + }, + { + "input": "ICAM - I mRNA was quite low in MT - I , but no genomic changes were found .", + "output": [ + "1222000000000000000" + ] + }, + { + "input": "The CAT reporter with the ICAM - I promoter was inactive in MT - I .", + "output": [ + "0120012220000000" + ] + }, + { + "input": "Finally , combined treatment of MT - I with 5 - azacytidine and IFN - gamma induced re - expression of ICAM - I .", + "output": [ + "0000000000000122000001220" + ] + }, + { + "input": "Collectively , ( a ) transcriptional factor ( s ) necessary for expression of ICAM - I gene may be repressed in MT - I through DNA methylation .", + "output": [ + "00000120000000122200000000000" + ] + }, + { + "input": "No genomic changes were found , and a CAT reporter gene with the CD18 promoter was inactive in the 3 of them , again suggesting lack of ( a ) transcriptional factor ( s ) necessary for CD18 expression .", + "output": [ + "0000000012200120000000000000001200000100" + ] + }, + { + "input": "Theileria annulata infects bovine leucocytes and results in their reversible transformation such that they become immortalised and metastatic .", + "output": [ + "0000000000000000000" + ] + }, + { + "input": "The present study describes parasite - induced changes in host cell gene expression which have a direct bearing on this transformation process .", + "output": [ + "00000000012200000000000" + ] + }, + { + "input": "An antiserum to this enzyme was used to isolate a cDNA clone .", + "output": [ + "0000000000120" + ] + }, + { + "input": "The predicted protein sequence of B1 is 81 % identical to human matrix metalloproteinase 9 ( MMP9 ) , demonstrating that it is the bovine homologue of this enzyme .", + "output": [ + "000001000000122010000000000000" + ] + }, + { + "input": "RNAase protection assays demonstrated that the MMP9 activity , unique to infected cells , is due to increased MMP9 mRNA levels .", + "output": [ + "1000001000000000001000" + ] + }, + { + "input": "We also assayed the levels of transcription factor AP - 1 and demonstrated that it was constitutively present in increased amounts in Theileria - infected cells .", + "output": [ + "000000121220000000000000000" + ] + }, + { + "input": "Since AP - 1 is implicated in the control of the cell cycle , and MMP9 can confer metastatic properties , these results are of considerable significance with respect to the transformed phenotype induced by Theileria infection .", + "output": [ + "01220000000000010000000000000000000000" + ] + }, + { + "input": "B - cell proliferation and induction of early G1 - regulating proteins by Epstein - Barr virus mutants conditional for EBNA2 .", + "output": [ + "0000000012220000000010" + ] + }, + { + "input": "Infection of primary B - lymphocytes by Epstein - Barr virus ( EBV ) leads to growth transformation of these B - cells in vitro .", + "output": [ + "00000000000000000000000000" + ] + }, + { + "input": "EBV nuclear antigen 2 ( EBNA2 ) , one of the first genes expressed after EBV infection of B - cells , is a transcriptional activator of viral and cellular genes and is essential for the transforming potential of the virus .", + "output": [ + "000001000000000000000000000122200000000000" + ] + }, + { + "input": "Growth transformation of primary normal B - cells by mutant virus resulted in estrogen - dependent lymphoblastoid cell lines expressing the chimeric EBNA2 protein .", + "output": [ + "0000000000000000000000120" + ] + }, + { + "input": "In the absence of estrogen about half of the cells enter a quiescent non - proliferative state whereas the others die by apoptosis .", + "output": [ + "000000000000000000000000" + ] + }, + { + "input": "EBNA2 is thus required not only for initiation but also for maintenance of transformation .", + "output": [ + "100000000000000" + ] + }, + { + "input": "Growth arrest occurred at G1 and G2 stages of the cell cycle , indicating that functional EBNA2 is required at different restriction points of the cell cycle .", + "output": [ + "0000000000000000100000000000" + ] + }, + { + "input": "Growth arrest is reversible for G1 / G0 cells as indicated by the sequential accumulation and modification of cell cycle regulating proteins .", + "output": [ + "00000000000000000012220" + ] + }, + { + "input": "EBV induces the same cell cycle regulating proteins as polyclonal stimuli in primary B - cells .", + "output": [ + "00000000000000000" + ] + }, + { + "input": "IL - 1 receptor and TCR signals synergize to activate NF - kappa B - mediated gene transcription .", + "output": [ + "1222010000122200000" + ] + }, + { + "input": "Previous studies have demonstrated that IL - 1 receptor ( IL - 1R ) - and TCR - initiated signals can interact synergistically to increase the rate of transcription of several lymphokine and lymphokine receptor genes during the competence phase of the activation program in T helper lymphocytes .", + "output": [ + "0000012220122000100000000000000122220000000000000" + ] + }, + { + "input": "In this report we describe how signals initiated through the type I IL - 1R interact with signals from the antigen receptor to synergistically augment the transactivating properties of NF - kappa B .", + "output": [ + "0000000000122220000000000000012220" + ] + }, + { + "input": "Gel shift analyses demonstrate that NF - kappa B nuclear translocation is stimulated primarily by IL - 1 rather than by antigen receptor signals .", + "output": [ + "0000012220000001220001200" + ] + }, + { + "input": "Western blot and phosphorylation analyses demonstrate that the synergistic effect on NF - kappa B functional activity is independent of I kappa B alpha ( MAD3 ) - NF - kappa B dissociation in the cytosol and is not associated with I kappa B nuclear translocation .", + "output": [ + "00000000000122200000122201001222000000000122000" + ] + }, + { + "input": "These results suggest that IL - 1 induces both NF - kappa B nuclear translocation and the synthesis of a protein ( s ) responsible for terminating NF - kappa B - DNA interaction in the nucleus .", + "output": [ + "00001220012220000000000000012220000000" + ] + }, + { + "input": "Antigen receptor signals prolong NF - kappa B - DNA interaction , probably by functionally antagonizing the IL - 1 - induced synthesis of a protein ( s ) responsible for the transient NF - kappa B - DNA interaction and consequently synergistically enhance IL - 1 - induced NF - kappa B - dependent gene transcription .", + "output": [ + "0000122200000000012200000000000001222000000012200122200000" + ] + }, + { + "input": "Identification of the promoter region of chicken anemia virus ( CAV ) containing a novel enhancer - like element .", + "output": [ + "00012000000000012220" + ] + }, + { + "input": "The single promoter region in the cloned genome [ Noteborn et al . , J . Virol . 65 ( 1991 ) 3131 - 3139 ] of chicken anemia virus ( CAV ) in chicken T - cells was analysed via CAT assays .", + "output": [ + "00120000000000000000000000000000000000000100" + ] + }, + { + "input": "A unique region containing four or five near - perfect direct repeats ( DR ) of 21 bp with one 12 - bp insert was proven to be the main transcription - activation element , with enhancer - like characteristics .", + "output": [ + "00000000000000000000122200000012220000000" + ] + }, + { + "input": "PCR studies revealed that CAV isolates from across the world all contained this promoter sequence .", + "output": [ + "0000000000000120" + ] + }, + { + "input": "Electrophoretic mobility - shift assays ( EMSA ) showed that individual DR units , as well as the 12 - bp insert , can bind to nuclear factors of chicken T - cells .", + "output": [ + "0000000000122000001222000012000000" + ] + }, + { + "input": "Competition assays revealed that the DR units bound to factors other than the 12 - bp insert .", + "output": [ + "000001200000012220" + ] + }, + { + "input": "Purified human SP1 was shown to have very strong affinity for the 12 - bp insert .", + "output": [ + "01200000000012220" + ] + }, + { + "input": "Previous studies using antisense oligonucleotides implicated the c - Myc protein in the phenomenon of activation - induced apoptosis .", + "output": [ + "00000001222000000000" + ] + }, + { + "input": "This role for c - Myc in apoptosis is now confirmed in studies using a dominant negative form of its heterodimeric binding partner , Max , which we show here inhibits activation - induced apoptosis .", + "output": [ + "000122000000000000000000100000000000" + ] + }, + { + "input": "Further , coexpression of a reciprocally mutant Myc protein capable of forming functional heterodimers with the mutant Max can compensate for the dominant negative activity and restore activation - induced apoptosis .", + "output": [ + "00000122200001000100000000000000" + ] + }, + { + "input": "These results imply that Myc promotes activation - induced apoptosis by obligatory heterodimerization with Max , and therefore , by regulating gene transcription .", + "output": [ + "000010000000001000000000" + ] + }, + { + "input": "Epstein - Barr virus SM protein .", + "output": [ + "1222220" + ] + }, + { + "input": "The protein products of the Epstein - Barr virus ( EBV ) BMLF1 open reading frame have been characterized in the early productive cycle in B95 - 8 and Akata cells .", + "output": [ + "00000000000000000000000000000000" + ] + }, + { + "input": "The SM protein derived from the spliced RNA joining BSLF2 to BMLF1 is much the most abundant protein .", + "output": [ + "0120000001010000000" + ] + }, + { + "input": "SM is a phosphoprotein in EBV - infected cells and can be phosphorylated in vitro with casein kinase II ( CKII ) .", + "output": [ + "10010000000000001220100" + ] + }, + { + "input": "Site - directed mutagenesis of the consensus CKII site in EBV SM greatly reduced the in vitro phosphorylation of SM by CKII .", + "output": [ + "00000012200000000001010" + ] + }, + { + "input": "The mechanism of transactivation by BMLF1 proteins has been controversial but SM was shown to transactivate gene expression from a CAT reporter construct by increasing the amount of cytoplasmic CAT mRNA .", + "output": [ + "00000120000100000000122000001220" + ] + }, + { + "input": "Inducible binding to the c - fos serum response element during T cell activation is regulated by a phosphotyrosine - containing protein .", + "output": [ + "00000000000000000012220" + ] + }, + { + "input": "Fos expression may be a pivotal event in converting ligand - receptor interactions at the membrane into functional modulation of cell phenotype .", + "output": [ + "00000000000000000000000" + ] + }, + { + "input": "We show that an inducible protein complex ( Band A ) binds to SRE DNA within 10 min after mitogenic stimulation of human PBL - T , and becomes nondetectable by 60 min .", + "output": [ + "0000012012000120000000000000000000" + ] + }, + { + "input": "A protein that is phosphorylated on a tyrosine residue in resting PBL - T suppresses binding of a component of Band A to the SRE motif .", + "output": [ + "000000000000000000001200120" + ] + }, + { + "input": "Upon stimulation of the cells , this protein no longer prevents binding of DNA by Band A , and suppression of binding is restored within 30 min .", + "output": [ + "0000000000000001200000000000" + ] + }, + { + "input": "In vivo modification of major histocompatibility complex class II DRA promoter occupancy mediated by the AIR - 1 trans - activator .", + "output": [ + "0000122222200001222220" + ] + }, + { + "input": "This locus encodes a transcriptional trans - activator required for the constitutive expression of major histocompatibility complex ( MHC ) class II genes .", + "output": [ + "000000000000001222222220" + ] + }, + { + "input": "Here we show , by in vivo DNase I footprinting , that the AIR - 1 locus defect correlates with changes in the DRA promoter occupancy .", + "output": [ + "000000012000012222000001200" + ] + }, + { + "input": "Interestingly , reexpression of human MHC class II genes in RJ 2 . 2 . 5 x mouse spleen cell hybrids is associated with partial reversion of DRA promoter occupancy to the Raji pattern .", + "output": [ + "00001222200000000000000000012000000" + ] + }, + { + "input": "DRA promoter occupancy in other class II - negative B cell lines , derived from patients with bare lymphocyte syndrome , is drastically different from the one observed in RJ 2 . 2 . 5 and Raji cells .", + "output": [ + "120000000000000000000000000000000000000" + ] + }, + { + "input": "Moreover , the use of the DNase I as an in vivo footprinting agent reveals that the patients ' cell lines do not display a completely ` ` bare promoter ` ` as previously reported using dimethyl sulfate as the footprinting agent .", + "output": [ + "0000001200000000000000000000120000000000000" + ] + }, + { + "input": "Regulation of cell - type - specific interleukin - 2 receptor alpha - chain gene expression : potential role of physical interactions between Elf - 1 , HMG - I ( Y ) , and NF - kappa B family proteins .", + "output": [ + "000000012222220000000001220122222001222220" + ] + }, + { + "input": "Previously , an inducible enhancer between nucleotides - 299 and - 228 that contains NF - kappa B and CArG motifs was identified .", + "output": [ + "000120122222001222222000" + ] + }, + { + "input": "We now report the characterization of a second essential positive regulatory element located between nucleotides - 137 and - 64 that binds Elf - 1 and HMG - I ( Y ) .", + "output": [ + "000000001222001222220012201222220" + ] + }, + { + "input": "Transcription from the IL - 2R alpha promoter was inhibited when either the Elf - 1 or the HMG - I ( Y ) binding site was mutated .", + "output": [ + "00012222000001222222222222000" + ] + }, + { + "input": "Coexpression of both proteins activated transcription of the - 137 to - 64 element in COS - 7 cells .", + "output": [ + "00000000122222000000" + ] + }, + { + "input": "This is the first report of a physical interaction between an Ets family member and NF - kappa B family proteins .", + "output": [ + "0000000000000001222220" + ] + }, + { + "input": "These findings provide significant new insights into the protein - protein and protein - DNA interactions that regulate cell - type - specific and inducible IL - 2R alpha gene expression and also have implications for other genes regulated by Elf - 1 and NF - kappa B family proteins .", + "output": [ + "000000000000000000000000012220000000000012201222220" + ] + }, + { + "input": "Isolation of cDNA clones for 42 different Kruppel - related zinc finger proteins expressed in the human monoblast cell line U - 937 .", + "output": [ + "001200012222200000000000" + ] + }, + { + "input": "To study the complexity and structural characteristics of zinc finger proteins expressed during human hematopoiesis and to isolate novel regulators of blood cell development , a degenerate oligonucleotide probe specific for a consensus zinc finger peptide domain was used to isolate 63 cDNA clones for Kruppel - related zinc finger genes from the human monoblast cell line U - 937 .", + "output": [ + "0000000012200000000000000000000012222000001201222220000000000" + ] + }, + { + "input": "By extensive nucleotide sequence and Northern blot analysis , these cDNA clones were found to originate from approximately 42 different genes ( HZF 1 - 42 ) of which only 8 have previously been described .", + "output": [ + "000000000012000000000012220000000000" + ] + }, + { + "input": "The large number of individual genes represented among the 63 clones and their apparent non - cell - type - specific expression suggest that the majority of the Kruppel - related zinc finger genes are likely to be expressed in most human tissues .", + "output": [ + "00000000000000000000000000001222220000000000" + ] + }, + { + "input": "In contrast , some of the genes displayed a restricted expression pattern , indicating that they represent potential regulators of monocyte differentiation or proliferation .", + "output": [ + "0000000000000000000000000" + ] + }, + { + "input": "Detailed structural analysis of the first 12 cDNAs ( HZF 1 - 10 ) and a partial characterization of HZF 11 - 42 revealed that a common feature of human Kruppel - related zinc finger proteins is the presence of tandem arrays of zinc fingers ranging in number from 3 to over 20 that are preferentially located in the carboxy - terminal regions of the proteins .", + "output": [ + "0000000101222000000122200000012222220000000120000000000000012220000" + ] + }, + { + "input": "In addition , several novel KRAB - containing zinc finger genes and a novel conserved sequence element were identified .", + "output": [ + "00000122222000122000" + ] + }, + { + "input": "CAG repeat length variation in sperm from a patient with Kennedy ' s disease .", + "output": [ + "000000000000000" + ] + }, + { + "input": "Using a modified sperm typing protocol , the mutation frequency of the CAG repeat region at the androgen receptor locus has been measured using a rare semen sample from an individual with spinal and bulbar muscular atrophy ( SBMA ) .", + "output": [ + "00000000000012200122000000000000000000000" + ] + }, + { + "input": "The average expansion was 2 . 7 repeats .", + "output": [ + "000000000" + ] + }, + { + "input": "More than half of the expansions involved one or two repeats ; the largest was 11 repeats .", + "output": [ + "000000000000000000" + ] + }, + { + "input": "68 % of the contractions were also one or two repeats but six ( 16 % ) were very large ( 12 - 25 repeats ) .", + "output": [ + "000000000000000000000000000" + ] + }, + { + "input": "One contraction generated an allele in an intermediate size range ( 33 - 39 repeats ) .", + "output": [ + "00000000000000000" + ] + }, + { + "input": "Such alleles have not been observed among more than 900 normal and SBMA X - chromosomes that have been examined .", + "output": [ + "000000000000122200000" + ] + }, + { + "input": "Comparison of the SBMA sperm typing results with mutation frequency data on normal alleles supports the hypothesis that trinucleotide repeat expansions may have a different molecular origin than contractions .", + "output": [ + "000000000000000000120000000000" + ] + }, + { + "input": "Benzene toxicity towards lymphocytes is thought to be mediated by metabolites of benzene including benzoquinone ( BQ ) .", + "output": [ + "0000000000000000000" + ] + }, + { + "input": "NAD ( P ) H : quinone reductase ( QR ) is known to protect against BQ toxicity .", + "output": [ + "1222222201000000000" + ] + }, + { + "input": "We had previously found that aspirin - like drugs ( ALD ) induce AP - 1 in human T lymphocytes .", + "output": [ + "000000000000012200000" + ] + }, + { + "input": "It was therefore hypothesized that ALD would protect lymphocytes against BQ toxicity by inducing QR .", + "output": [ + "0000000000000010" + ] + }, + { + "input": "Molt - 4 cells ( M4 ) , a human T lymphocyte cell line , were incubated with different concentrations of two ALD , flurbiprofen and sodium diclofenac , and then exposed to BQ .", + "output": [ + "00000000000000000000000000000000000" + ] + }, + { + "input": "Toxicity was measured by viability ( trypan blue exclusion ) .", + "output": [ + "00000000000" + ] + }, + { + "input": "The protective effect of ALD was significantly reduced by dicoumarol , a QR - specific inhibitor .", + "output": [ + "00000000000010000" + ] + }, + { + "input": "Since human T cells and T cell lines do not metabolize arachidonic acid , our data suggest that ALD can protect human T lymphocytes against a metabolite of benzene by induction of QR activity .", + "output": [ + "00000000000000000000000000000000100" + ] + }, + { + "input": "Correlation of differentiation - inducing activity of retinoids on human leukemia cell lines HL - 60 and NB4 .", + "output": [ + "0000000000000000000" + ] + }, + { + "input": "Retinoids , including all - trans - retinoic acid , its isomers , and fifty synthetic retinoids ( retinobenzoic acids ) , were tested for differentiation - inducing activity on human leukemia cell lines HL - 60 and NB4 .", + "output": [ + "0000000000000000000000000000000000000000" + ] + }, + { + "input": "Platelet - activating factor ( PAF ) positively auto - regulates the expression of human PAF receptor transcript 1 ( leukocyte - type ) through NF - kappa B .", + "output": [ + "122201000000001222200000012220" + ] + }, + { + "input": "The human platelet - activating factor receptor ( PAFR ) gene is transcribed by two distinct promoters ( promoter 1 and promoter 2 ) to generate two transcripts ( designated as PAFR transcript 1 and PAFR transcript 2 ) , though their open reading frames are identical .", + "output": [ + "012222222220000010120120000000012201220000000000" + ] + }, + { + "input": "By primer extension analysis to discriminate two transcripts , we found that the levels of PAFR transcript 1 ( leukocyte - type ) , but not PAFR transcript 2 ( tissue - type ) , are upregulated by PAF as well as by 12 - O - tetradecanoylphorbol - 13 - acetate ( TPA ) in the human stomach cancer cell line ( JR - St cells ) which expresses both functional PAFR transcript 1 and PAFR transcript 2 endogenously .", + "output": [ + "000000000000000122000000001220000000001000000000000000000000000000000000122012200" + ] + }, + { + "input": "Functional analysis of the promoter 1 with a transient expression assay using chloramphenicol acetyltransferase ( CAT ) gene as a reporter showed that both PAF and TPA activated the promoter 1 but not the deleted promoter lacking the three consensus binding sites for NF - kappa B located from - 571 bp to - 459 bp .", + "output": [ + "000012000000122222000000100001200000000122012220000000000" + ] + }, + { + "input": "A cDNA library was prepared from peripheral blood lymphocytes of an autoimmune patient with primary Sjogrens ' syndrome .", + "output": [ + "0120000000000000000" + ] + }, + { + "input": "The cDNA library was screened with the patients own autoimmune serum being monospecific for the nuclear autoantigen La / SS - B .", + "output": [ + "01200000000000012222220" + ] + }, + { + "input": "Thereby an alternative type of La mRNA was identified that differed from the known La mRNA due to an exchange of the exon 1 .", + "output": [ + "0000012000000012000000120" + ] + }, + { + "input": "Sequencing of the genomic region between the exons 1 and 2 showed that the alternative 5 ' - end is a part of the intron .", + "output": [ + "00000001222000122220000010" + ] + }, + { + "input": "In addition , the presence of an alternative promoter site , which exists within the intron downstream of the exon 1 , became evident .", + "output": [ + "0000000122000001000120000" + ] + }, + { + "input": "In consequence , the alternative La mRNA is the result of a promoter switching combined with an alternative splicing mechanism .", + "output": [ + "000012200000000000000" + ] + }, + { + "input": "In the intron , further transcription factor binding sites , including a NF - kappa B element , were identified leading to the suggestion that the expression of the gene encoding for the nuclear autoantigen La / SS - B alters in dependence on disease conditions .", + "output": [ + "00000120000012222000000000000000012222220000000" + ] + }, + { + "input": "Cross - linking CD40 on B cells rapidly activates nuclear factor - kappa B .", + "output": [ + "000100000122220" + ] + }, + { + "input": "Cross - linking CD40 on B cells can lead to homotypic cell adhesion , IL - 6 production , and , in combination with cytokines , to Ig isotype switching .", + "output": [ + "0001000000000012200000001000000" + ] + }, + { + "input": "Tyrosine kinase activity is increased shortly after engagement of this receptor .", + "output": [ + "000000000000" + ] + }, + { + "input": "Little is known about how the very early events induced by CD40 cross - linking link to cellular responses .", + "output": [ + "00000000000100000000" + ] + }, + { + "input": "In this study , we demonstrate that nuclear factor ( NF ) - kappa B and NF - kappa B - like transcription factors are activated after cross - linking CD40 on resting human tonsillar B cells and on B cell lines .", + "output": [ + "0000000122222220122222220000001000000000000" + ] + }, + { + "input": "The complexes detected in electrophoretic mobility shift assays contain p50 , p65 ( RelA ) , c - Rel , and most likely other components .", + "output": [ + "00000000010101001220000000" + ] + }, + { + "input": "By using transient transfection assays , we found that cross - linking CD40 supports NF - kappa B - dependent gene expression .", + "output": [ + "00000000000010122200000" + ] + }, + { + "input": "Our results define the NF - kappa B system as an intermediate event in CD40 signaling and suggest that the CD40 pathway can influence the expression of B cell - associated genes with NF - kappa B consensus sites .", + "output": [ + "0000122200000010000010000001222201222220" + ] + }, + { + "input": "Protease inhibitors block lipopolysaccharide induction of tissue factor gene expression in human monocytic cells by preventing activation of c - Rel / p65 heterodimers .", + "output": [ + "0000000000000000001222220" + ] + }, + { + "input": "Tissue factor ( TF ) is expressed rapidly by human monocytes exposed to bacterial endotoxin ( lipopolysaccharide , or LPS ) .", + "output": [ + "1201000000000120000000" + ] + }, + { + "input": "Transcriptional regulation is mediated by binding of c - Rel / p65 heterodimers to a kappa B - like site in the TF promoter .", + "output": [ + "0000000122222001222200120" + ] + }, + { + "input": "Nuclear translocation of cytosolic c - Rel / p65 heterodimers and other members of the NF - kappa B / Rel family requires dissociation and proteolytic degradation of the inhibitor protein , I kappa B alpha .", + "output": [ + "0001222222000001222222000000012012220" + ] + }, + { + "input": "The protease inhibitors N alpha - tosylphenylalanyl chloromethyl ketone ( TPCK ) and N alpha - tosyl - L - lysine chloromethyl ketone ( TLCK ) block activation of NF - kappa B / Rel proteins by preventing degradation of I kappa B alpha .", + "output": [ + "000000000000000000000000000001222222000012220" + ] + }, + { + "input": "To determine if TPCK and TLCK inhibited LPS induction of TF expression , freshly isolated human monocytes and monocytic THP - 1 cells were pretreated with these inhibitors for 30 min before LPS stimulation .", + "output": [ + "00000000001000000000000000000000000" + ] + }, + { + "input": "Both TPCK and TLCK inhibited LPS induction of TF protein , TF mRNA and TF promoter activity in a dose - dependent manner .", + "output": [ + "000000001201201000000000" + ] + }, + { + "input": "Taken together , these data indicated that inhibiting nuclear translocation of c - Rel / p65 heterodimers prevented LPS induction of TF gene transcription in monocytic cells .", + "output": [ + "0000000000012222200001000000" + ] + }, + { + "input": "1 , 25 - Dihydroxyvitamin D3 receptors in peripheral blood mononuclear cells from patients with primary and secondary hyperparathyroidism .", + "output": [ + "12222220000000000000" + ] + }, + { + "input": "A decreased number of calcitriol ( 1 , 25 ( OH ) 2D3 ) receptors has been observed in parathyroid glands of uremic animals .", + "output": [ + "0000122222222220000000000" + ] + }, + { + "input": "In humans , studies carried out in surgically removed parathyroid glands have shown that calcitriol binding is higher in primary than in secondary hyperparathyroidism .", + "output": [ + "0000000000000000000000000" + ] + }, + { + "input": "Since specific receptors for calcitriol have been described in peripheral blood mononuclear cells ( PBMC ) , we have investigated the specific uptake of 3H - labelled 1 , 25 ( OH ) 2D3 in PBMC of 12 women with primary hyperparathyroidism ( PHP ) , 8 women with hyperparathyroidism secondary to chronic renal failure ( SH ) , 9 women with renal transplant ( RT ) , and 23 healthy women .", + "output": [ + "0000000000000000000000000000000000000000000000000000000000000000000000000" + ] + }, + { + "input": "In three patients with PHP who were subjected to parathyroidectomy , the calcitriol number came down to normal .", + "output": [ + "0000000000000000000" + ] + }, + { + "input": "The severe phenotype of females with tiny ring X chromosomes is associated with inability of these chromosomes to undergo X inactivation .", + "output": [ + "0000001222000000100000" + ] + }, + { + "input": "Mental retardation and a constellation of congenital malformations not usually associated with Turner syndrome are seen in some females with a mosaic 45 , X / 46 , X , r ( X ) karyotype .", + "output": [ + "000000000000000000000000000000000000" + ] + }, + { + "input": "The two tiny ring X chromosomes studied with an antibody specific for the acetylated isoforms of histone H4 marking transcribed chromatin domains were labeled at a level consistent with their being active .", + "output": [ + "000012000100000012012200000000000" + ] + }, + { + "input": "We also examined tow of the XISTE - ring chromosomes to determine whether genes that are normally silent on an inactive X are expressed from these chromosomes .", + "output": [ + "0000001222000100000012000010" + ] + }, + { + "input": "Analyses of hybrid cells show that TIMP , ZXDA , and ZXDB loci on the proximal short arm , and AR and PHKA1 loci on the long arm , are well expressed from the tiny ring X chromosome lacking XIST DNA .", + "output": [ + "000000101001200122001012000000000012220120" + ] + }, + { + "input": "Studies of the ring chromosome that has XIST DNA but does not transcribe it show that its AR allele is transcribed along with the one on the normal X allele .", + "output": [ + "0001200120000000000000000000000" + ] + }, + { + "input": "Inhibition of activation of transcription factor AP - 1 by CD28 signalling in human T - cells .", + "output": [ + "000012222010000000" + ] + }, + { + "input": "Co - stimulation of T - lymphocytes by T - cell receptor ( TcR ) occupancy and activation of the CD28 surface molecule results in enhanced proliferation and interleukin 2 ( IL - 2 ) production .", + "output": [ + "0000000012220100000012200000120122000" + ] + }, + { + "input": "Stimulation of T - cells by agonistic anti - CD28 antibodies in conjunction with phorbol 12 - myristate 13 - acetate ( PMA ) - or TcR - derived signals induces the enhanced activation of the transcription factor NF - kappa B .", + "output": [ + "0000000122200000000000000010000000001212220" + ] + }, + { + "input": "Whereas anti - CD28 together with PMA increased the DNA binding and trans - activation activity of NF - kappa B , PMA - induced activation of AP - 1 was significantly suppressed .", + "output": [ + "0122000000000000012220000001220000" + ] + }, + { + "input": "The inhibitory effect exerted by anti - CD28 was observed at the level of DNA binding as well as in functional reporter - gene assays .", + "output": [ + "00000122000000000000000000" + ] + }, + { + "input": "These results suggest that the two transcription factors are independently regulated and may perform different functions during T - cell activation .", + "output": [ + "0000001200000000000000" + ] + }, + { + "input": "HIV - 1 Nef leads to inhibition or activation of T cells depending on its intracellular localization .", + "output": [ + "122200000000000000" + ] + }, + { + "input": "Nef of primate lentiviruses is required for viremia and progression to AIDS in monkeys .", + "output": [ + "100000000000000" + ] + }, + { + "input": "Negative , positive , and no effects of Nef have also been reported on viral replication in cells .", + "output": [ + "0000000010000000000" + ] + }, + { + "input": "To reconcile these observations , we expressed a hybrid CD8 - Nef protein in Jurkat cells .", + "output": [ + "00000000122220000" + ] + }, + { + "input": "Two opposite phenotypes were found , which depended on the intracellular localization of Nef .", + "output": [ + "000000000000010" + ] + }, + { + "input": "Expressed in the cytoplasm or on the cell surface , the chimera inhibited or activated early signaling events from the T cell antigen receptor .", + "output": [ + "0000000000010000000012220" + ] + }, + { + "input": "Activated Jurkat cells died by apoptosis , and only cells with mutated nef genes expressing truncated Nefs survived , which rendered Nef nonfunctional .", + "output": [ + "000000000000120010000100" + ] + }, + { + "input": "These mutations paralleled those in other viral strains passaged in vitro .", + "output": [ + "000000000000" + ] + }, + { + "input": "Not only do these positional effects of Nef reconcile diverse phenotypes of Nef and suggest a role for its N - terminal myristylation , but they also explain effects of Nef in HIV infection and progression to AIDS .", + "output": [ + "000000010000100000000000000000100000000" + ] + }, + { + "input": "An intricate arrangement of binding sites for the Ets family of transcription factors regulates activity of the alpha 4 integrin gene promoter .", + "output": [ + "00000000120120000122220" + ] + }, + { + "input": "alpha 4 integrins mediate cell - cell and cell - extracellular matrix interactions that are critical for maturation and function of the immune system as well as differentiation of skeletal muscle .", + "output": [ + "12200000000000000000000000000000" + ] + }, + { + "input": "Here we examine molecular mechanisms controlling the pattern of alpha 4 expression .", + "output": [ + "0000000001200" + ] + }, + { + "input": "Three binding sites for the Ets family of transcription factors are found in this region : two adjacent sites at positions - 50 and - 54 bp and a more 5 ' site at position - 67 bp .", + "output": [ + "012001201200000000000122222000122001220" + ] + }, + { + "input": "Using a series of constructs containing deletions and mutations in this region , we found that the 3 ' - most site alone was sufficient for binding GA - binding protein alpha ( GABP alpha ) / GABP beta and for a low level of transcriptional activation .", + "output": [ + "000000000000000001222200000122220122222000000000" + ] + }, + { + "input": "Deletion of the 5 ' - most Ets site had no effect on binding to GABP alpha / GABP beta , but it eliminated a .", + "output": [ + "00012222200000012222000000" + ] + }, + { + "input": "Concomitant with this loss of a , a new Ets - 1 - containing complex ` ` c ` ` appeared .", + "output": [ + "0000000012222220010000" + ] + }, + { + "input": "Complex c substituted efficiently for complex a in transcriptional activation .", + "output": [ + "00000000000" + ] + }, + { + "input": "We conclude that although neither of the two 5 ' - most Ets sites alone binds nuclear protein , they appear to act as modulators which control the pattern of Ets proteins that bind the alpha 4 gene promoter .", + "output": [ + "0000000012222200120000000000001200012220" + ] + }, + { + "input": "Mechanism of antiandrogen action : conformational changes of the receptor .", + "output": [ + "00000000000" + ] + }, + { + "input": "Androgen receptor mRNA was translated in vitro , and androgen - and antiandrogen - bound receptor complexes were studied using limited proteolytic digestion by trypsin .", + "output": [ + "12200000012222222000000010" + ] + }, + { + "input": "Partial proteolysis of androgen - bound receptor protein resulted in a 29 - kDa proteolysis - resisting fragment , whereas antiandrogen binding stabilised a 35 - kDa fragment .", + "output": [ + "00012222000122222200000012220" + ] + }, + { + "input": "Both fragments contain the entire ligand binding domain , and the 35 - kDa fragment extended into the hinge region of the receptor .", + "output": [ + "000001220001222000120000" + ] + }, + { + "input": "Several antiandrogens show agonistic properties for a mutated androgen receptor ( LNCaP cell variant ) ; trypsin digestion of antiandrogen - bound mutated receptor also resulted in a 29 - kDa fragment .", + "output": [ + "000000012200000010012222000012220" + ] + }, + { + "input": "Our results point to an important difference between antiandrogens and antagonists of other steroid hormone receptors .", + "output": [ + "00000000000001220" + ] + }, + { + "input": "Differences in conformation of the hinge region distinguish androgen - bound from antiandrogen - bound receptor complexes , which represents an important feature of antiandrogen action .", + "output": [ + "000001201220122220000000000" + ] + }, + { + "input": "Activation of nuclear factor kappa B in human neuroblastoma cell lines .", + "output": [ + "001222000000" + ] + }, + { + "input": "The nuclear factor kappa B ( NF - kappa B ) is a eukaryotic transcription factor .", + "output": [ + "01222012220000120" + ] + }, + { + "input": "In B cells and macrophages it is constitutively present in cell nuclei , whereas in many other cell types , NF - kappa B translocates from cytosol to nucleus as a result of transduction by tumor necrosis factor alpha ( TNF alpha ) , phorbol ester , and other polyclonal signals .", + "output": [ + "0000000000000000000012220000000000012220120000000000" + ] + }, + { + "input": "Using neuroblastoma cell lines as models , we have shown that in neural cells NF - kappa B was present in the cytosol and translocated into nuclei as a result of TNF alpha treatment .", + "output": [ + "00000000000000122200000000000001200" + ] + }, + { + "input": "The TNF alpha - activated NF - kappa B was transcriptionally functional .", + "output": [ + "0120012220000" + ] + }, + { + "input": "NF - kappa B activation by TNF alpha was not correlated with cell differentiation or proliferation .", + "output": [ + "12220012000000000" + ] + }, + { + "input": "In a NGF - responsive rat pheochromocytoma cell line , PC12 , PMA activated NF - kappa B , whereas NGF did not .", + "output": [ + "000000000000001222001000" + ] + }, + { + "input": "In other neuroblastoma cell lines , such as SK - N - Be ( 2 ) , the lack of PMA induction of differentiation was correlated with the lack of NF - kappa B activation .", + "output": [ + "000000000000000000000000000000122200" + ] + }, + { + "input": "We found , moreover , that in SK - N - Be ( 2 ) cells protein kinase C ( PKC ) enzymatic activity was much lower compared with that in a control cell line and that the low PKC enzymatic activity was due to low PKC protein expression .", + "output": [ + "00000000000000001220100000000000000000010000001000" + ] + }, + { + "input": "NF - kappa B was not activated by retinoic acid , which induced morphological differentiation of all the neuroblastoma cell lines used in the present study .", + "output": [ + "122200000000000000000000000" + ] + }, + { + "input": "Thus , NF - kappa B activation was not required for neuroblastoma cell differentiation .", + "output": [ + "001222000000000" + ] + }, + { + "input": "Furthermore , the results obtained with TNF alpha proved that NF - kappa B activation was not sufficient for induction of neuroblastoma differentiation .", + "output": [ + "000000120012220000000000" + ] + }, + { + "input": "ERP , a new member of the ets transcription factor / oncoprotein family : cloning , characterization , and differential expression during B - lymphocyte development .", + "output": [ + "100000012222200000000000000" + ] + }, + { + "input": "The ets gene family encodes a group of proteins which function as transcription factors under physiological conditions and , if aberrantly expressed , can cause cellular transformation .", + "output": [ + "0122000000001200000000000000" + ] + }, + { + "input": "We have recently identified two regulatory elements in the murine immunoglobulin heavy - chain ( IgH ) enhancer , pi and microB , which exhibit striking similarity to binding sites for ets - related proteins .", + "output": [ + "000000000122222222010100000012012220" + ] + }, + { + "input": "The ERP protein contains a region of high homology with the ETS DNA - binding domain common to all members of the ets transcription factor / oncoprotein family .", + "output": [ + "01000000000000000000001222220" + ] + }, + { + "input": "Three additional smaller regions show homology to the ELK - 1 and SAP - 1 genes , a subgroup of the ets gene family that interacts with the serum response factor .", + "output": [ + "00000000000012200000012200001220" + ] + }, + { + "input": "Removal of the carboxy terminus enables ERP to interact with a variety of ets - binding sites including the E74 site , the IgH enhancer pi site , and the lck promoter ets site , suggesting a carboxy - terminal negative regulatory domain .", + "output": [ + "00012010000001222001200122200012220001222220" + ] + }, + { + "input": "At least three ERP - related transcripts are expressed in a variety of tissues .", + "output": [ + "000122200000000" + ] + }, + { + "input": "However , within the B - cell lineage , ERP is highly expressed primarily at early stages of B - lymphocyte development , and expression declines drastically upon B - cell maturation , correlating with the enhancer activity of the IgH pi site .", + "output": [ + "00000000010000000000000000000000000000001220" + ] + }, + { + "input": "These data suggest that ERP might play a role in B - cell development and in IgH gene regulation .", + "output": [ + "00001000000000001200" + ] + }, + { + "input": "Gene for a tissue - specific transcriptional activator ( EBF or Olf - 1 ) , expressed in early B lymphocytes , adipocytes , and olfactory neurons , is located on human chromosome 5 , band q34 , and proximal mouse chromosome 11 .", + "output": [ + "00012222010122000000000000000001220120012220" + ] + }, + { + "input": "Murine B lymphocytes , adipocytes , and olfactory neurons contain a DNA - binding protein that participates in the regulation of genes encoding tissue - specific components of signal transduction .", + "output": [ + "0000000000012220000001000000000" + ] + }, + { + "input": "Purification and cloning of this protein , termed early B - cell factor ( EBF ) , from murine B lymphocytes and independent cloning of a protein , termed Olf - 1 , from olfactory neuronal cells revealed virtual complete amino acid sequence identity between these proteins .", + "output": [ + "000000000122201000000000000001220000000000000000" + ] + }, + { + "input": "As a first step towards identifying a human genetic disorder or mouse mutation for which EBF could be a candidate gene , we have chromosomally mapped the corresponding locus in both species .", + "output": [ + "000000000000000100000000000000000" + ] + }, + { + "input": "By Southern hybridization analyses of somatic cell hybrid panels with murine cDNA probe , fluorescence chromosomal in situ hybridization ( FISH ) of human genomic clones , and analysis of recombinant inbred mouse strains , we have found single sites for EBF homologous sequences on human Chromosome ( Chr ) 5 , band q34 , and on proximal mouse Chr 11 , in an evolutionarily conserved region .", + "output": [ + "00000000001220000000000122000000000000000122000000001200012220001220" + ] + }, + { + "input": "Calcineurin activates transcription from the GM - CSF promoter in synergy with either protein kinase C or NF - kappa B / AP - 1 in T cells .", + "output": [ + "10000122200001220122212220000" + ] + }, + { + "input": "The GM - kappa B sequence is recognized by NF - kappa B , which is mainly induced by PMA .", + "output": [ + "012222000122200000000" + ] + }, + { + "input": "The CLE0 sequence interacts with factors , related to a PMA - induced AP - 1 and a PMA / A23187 - induced NF - AT .", + "output": [ + "012000000012222200122222220" + ] + }, + { + "input": "We examined whether signal transducing components in T cells can activate transcription of the GM - CSF gene .", + "output": [ + "0000000000000012220" + ] + }, + { + "input": "Cotransfection of NF - kappa B ( p50 / p65 ) - or AP - 1 ( c - Jun / c - Fos ) - expression vectors into Jurkat cells with a luciferase reporter containing the GM - CSF promoter did not stimulate transcription from the GM - CSF promoter .", + "output": [ + "0012222222222222222222222222000001200122200000012220" + ] + }, + { + "input": "In contrast , cotransfection with a combination of NF - kappa B and AP - 1 significantly augmented transcription from the GM - CSF promoter containing the GM - kappa B / GC - box and the CLE0 ( AP - 1 / NF - AT ) .", + "output": [ + "000000001222012200000122200122222220010122222200" + ] + }, + { + "input": "Expression of a constitutively active calcineurin ( CN ) , a Ca2 + / calmodulin - dependent protein phosphatase , potentiated by two fold the transcriptional activation by NF - kappa B / AP - 1 .", + "output": [ + "0000010100012222222000000000122212220" + ] + }, + { + "input": "Both constitutively active forms of CN and protein kinase C ( PKC ) synergistically activated transcription from the GM - CSF promoter .", + "output": [ + "00000101220100000012220" + ] + }, + { + "input": "These results suggest that cooperation among NF - kappa B - , AP - 1 - and NF - AT - binding sequences is required for induction of the GM - CSF gene through PKC - and Ca2 + - signaling pathways downstream of T cell activation .", + "output": [ + "000000122222222222222220000001222000000000000000" + ] + }, + { + "input": "Expression of the human PRL ( hPRL ) gene in extrapituitary sites such as the uterus ( decidualized endometrial stroma and myometrium ) and cells of the hematopoietic lineage is directed by an alternative promoter which is located approximately 6 kilobases ( kb ) upstream of the pituitary - specific start site .", + "output": [ + "00012222200000000000000000000000012000012222200122220" + ] + }, + { + "input": "In order to delineate the tissue - specific mechanisms governing the control of nonpituitary PRL gene expression , we have cloned and sequenced 3 kb 5 ' - flanking DNA of the upstream decidual / lymphoid ( dPRL ) promoter .", + "output": [ + "00000000000000120000000122222200012222220" + ] + }, + { + "input": "Based on sequence homology we identified two binding motifs for Pit - 1 and seven half - sites for glucocorticoid receptor / progesterone receptor ( PR ) binding .", + "output": [ + "00000001201220012201222201000" + ] + }, + { + "input": "We focused our studies on the role of Pit - 1 and of PR as potential transcriptional regulators , since the POU domain protein Pit - 1 is essential in the control of pituitary PRL expression , and progesterone induces decidual transformation of the endometrial stroma , a differentiation process during which the decidual PRL gene is activated .", + "output": [ + "00000000122001001200012212200000001000000000000000000012000" + ] + }, + { + "input": "We demonstrate in a variety of cell types , including lymphocytes and endometrial stroma , that Pit - 1 is not involved in the regulation of dPRL promoter / reporter gene constructs carrying 3 kb 5 ' - flanking DNA .", + "output": [ + "00000000000000001220000000122222012222220" + ] + }, + { + "input": "When we compared the activity of the transfected dPRL promoter in PRL - secreting and nonsecreting lymphoid cells , we found that the 3 kb 5 ' - flanking region of the dPRL promoter did not contain elements restricting expression to only those lymphocytes that produce PRL but allowed expression of fusion reporter genes irrespective of the status of the endogenous PRL gene .", + "output": [ + "0000000012000000000000012222220012000000000000000000000000000120" + ] + }, + { + "input": "This was in sharp contrast to endometrial cells where 3 kb 5 ' - flanking DNA conferred strong transcriptional activation on the dPRL promoter in decidualized endometrial stromal cells actively secreting PRL , but did not allow transcription in undifferentiated non - PRL - secreting endometrial stromal cells .", + "output": [ + "0000000000000000000000120000000100000000000000000" + ] + }, + { + "input": "Activation of the dPRL promoter construct in these undifferentiated cells could however be induced by the addition of cAMP , in the absence of progesterone , suggesting that a signal transduced through the cAMP signaling pathway is a primary inducer of decidual PRL gene expression .", + "output": [ + "0001200000000000000000000000000000000000001200" + ] + }, + { + "input": "Signals and nuclear factors that regulate the expression of interleukin - 4 and interleukin - 5 genes in helper T cells .", + "output": [ + "0012000001222222200000" + ] + }, + { + "input": "Mouse thymoma line EL - 4 cells produce cytokines such as interleukin ( IL ) - 2 , IL - 3 , IL - 4 , IL - 10 , and granulocyte - macrophage colony - stimulating factor in response to phorbol 12 - myristate 13 - acetate ( PMA ) .", + "output": [ + "0000000010012222201220122012200122222200000000000000" + ] + }, + { + "input": "EL - 4 cells also produce low levels of IL - 5 when stimulated by PMA alone ; however , cAMP greatly augments PMA - dependent IL - 5 production .", + "output": [ + "0000000001220000000000000012200" + ] + }, + { + "input": "A transient transfection assay revealed that two signals , PMA and cAMP , are required for optimal activation of the IL - 5 promoter .", + "output": [ + "0000000000000000000012220" + ] + }, + { + "input": "In contrast , cAMP almost completely inhibited the PMA - dependent activation of the endogenous IL - 2 gene , as well as the transfected IL - 2 promoter .", + "output": [ + "000000000000001222200000012220" + ] + }, + { + "input": "These results indicate that the IL - 5 gene is positively regulated by cAMP in a manner opposite to that for the IL - 2 gene .", + "output": [ + "000001222000000000000012220" + ] + }, + { + "input": "The P sequence of the IL - 4 gene , defined as a responsive element for PMA and calcium ionophore ( A23187 ) , shares sequence similarity with the NF kappa B and the NF - activated T cell binding sites .", + "output": [ + "012001222000012000000000000001222222222220" + ] + }, + { + "input": "We attempted to determine whether NF ( P ) , a nuclear factor specific for the P sequence , is related to NF - kappa B and nuclear factor for activated T cell ( NF - AT ) .", + "output": [ + "000001222000000012000012220122222012200" + ] + }, + { + "input": "In electromobility shift assays both NF - kappa B ( P65 or P65 / P50 heterodimer ) and NF - AT bound to the P sequence .", + "output": [ + "000001222010122200122000120" + ] + }, + { + "input": "However , sequence specificity of NF - AT was more similar to that of NF ( P ) , and only a small amount of P65 was detected in NF ( P ) .", + "output": [ + "0000012200000012220000000100012220" + ] + }, + { + "input": "These results indicate that a component or components of NF - AT have the potential to reconstitute NF ( P ) , whereas NF - kappa B alone does not account for NF ( P ) in Jurkat crude extract .", + "output": [ + "00000000012200000122200122200000122200000" + ] + }, + { + "input": "Taken together , these results suggest that NF - AT - like factors are involved in the regulation of IL - 4 and IL - 5 genes .", + "output": [ + "0000000122222000000122222220" + ] + }, + { + "input": "Solution structure of a POU - specific homeodomain : 3D - NMR studies of human B - cell transcription factor Oct - 2 .", + "output": [ + "000012220000000122221220" + ] + }, + { + "input": "The POU DNA - binding motif defines a conserved family of eukaryotic transcription factors involved in regulation of gene expression .", + "output": [ + "012222000001220000000" + ] + }, + { + "input": "This bipartite motif consists of an N - terminal POU - specific domain ( POUs ) , a flexible linker , and a C - terminal POU - specific homeodomain ( POUHD ) .", + "output": [ + "0120001222222010001200012222220100" + ] + }, + { + "input": "Here we describe the solution structure of a POU - specific homeodomain .", + "output": [ + "0000000012220" + ] + }, + { + "input": "An NMR model is obtained from Oct - 2 , a human B - cell specific transcription factor which participates in the regulation of immunoglobulin genes .", + "output": [ + "000000122001222222000000120" + ] + }, + { + "input": "A fragment of Oct - 2 containing POUHD and an adjoining linker was expressed in Escherichia coli and characterized by three - dimensional nuclear magnetic resonance ( 3D - NMR ) spectroscopy .", + "output": [ + "000122010000000000000000000000000" + ] + }, + { + "input": "Complete 1H and 15N resonance assignment of the POUHD moiety is presented .", + "output": [ + "0000000012000" + ] + }, + { + "input": "The POUHD solution structure , as calculated by distance geometry and simulated annealing ( DG / SA ) , is similar to that of canonical homeodomains .", + "output": [ + "010000000000000000000000120" + ] + }, + { + "input": "A salient difference between solution and crystal structures is observed in the C - terminal segment of alpha - helix 3 ( the HTH recognition helix ) , which is not well ordered in solution .", + "output": [ + "000000000000122201222001220000000000" + ] + }, + { + "input": "Because this segment presumably folds upon specific DNA binding , its flexibility in solution may reduce the intrinsic DNA affinity of POUHD in the absence of POUs .", + "output": [ + "0000000000000000000001000010" + ] + }, + { + "input": "NF - kappa B - dependent and - independent pathways of HIV activation in a chronically infected T cell line .", + "output": [ + "000000000000000000000" + ] + }, + { + "input": "J delta K cells were isolated as a chronically infected survivor cell line , following infection of Jurkat CD4 + T cells with dl - NF , a mutated strain of human immunodeficiency virus type 1 ( HIV - 1 ) containing a deletion of the long terminal repeat ( LTR ) NF - kappa B sites .", + "output": [ + "0000000000000000000000000000000000000000000000122010122200" + ] + }, + { + "input": "J delta K cells exhibited very low levels of constitutive HIV production .", + "output": [ + "0000000000000" + ] + }, + { + "input": "HIV - 1 expression was activated from J delta K cells by treatment with phorbol myristate acetate ( PMA ) , sodium butyrate ( NaB ) , or hexamethylene bisacetamide ( HMBA ) , but not tumor necrosis factor alpha ( TNF - alpha ) , confirming the role of NF - kappa B in mediating TNF - alpha induction of HIV transcription .", + "output": [ + "0000000000000000000000000000000000001222012200000012220012200000" + ] + }, + { + "input": "The strong induction of HIV expression by NaB or HMBA in J delta K cells clearly demonstrates the existence of NF - kappa B - independent mechanisms of HIV activation in chronically infected cells .", + "output": [ + "00000000000000000000122200000000000" + ] + }, + { + "input": "J delta K cells may provide a useful model for characterizing NF - kappa B - independent transcriptional activation of the HIV LTR .", + "output": [ + "000000000001222000000120" + ] + }, + { + "input": "We investigated how these stimuli affect mitogen activated protein ( MAP ) kinases .", + "output": [ + "00000012222220" + ] + }, + { + "input": "Alone , each stimulus resulted in little or no activation .", + "output": [ + "00000000000" + ] + }, + { + "input": "Similar to its effect on IL - 2 induction , cyclosporin A ( CsA ) inhibited the synergistic activation of JNK , and a competitive inhibitor of Jun phosphorylation by JNK inhibited IL - 2 promoter activation .", + "output": [ + "00000122000000000000100000010010122200" + ] + }, + { + "input": "By contrast , the MAP kinases ERK1 and ERK2 were fully activated by TPA or TCR stimulation and were not affected by Ca2 + , CD28 , or CsA .", + "output": [ + "000012101000000100000000000000" + ] + }, + { + "input": "Hence , integration of signals that lead to T cell activation occurs at the level of JNK activation .", + "output": [ + "0000000000000000100" + ] + }, + { + "input": "Inhibition of rat splenocyte proliferation with methylprednisolone : in vivo effect of liposomal formulation .", + "output": [ + "000000000000000" + ] + }, + { + "input": "Rat splenocytes were found to have greater sensitivity to MPL ( EC50 = 7 . 9 nM ) than do human peripheral blood lymphocytes ( EC50 = 28 nM ) .", + "output": [ + "0000000000000000000000000000000" + ] + }, + { + "input": "In vivo studies in rats utilized 2 mg / kg IV bolus doses of liposomal MPL compared to drug in solution .", + "output": [ + "0000000000000000000000" + ] + }, + { + "input": "Animals were sacrificed at various times post - dosing until 120 h , spleen was excised and , after incubation of lymphocytes with PHA , splenocyte blastogenic responses were assessed by measuring cellular incorporation of 3H - thymidine .", + "output": [ + "000000000000000000000001000000000000000" + ] + }, + { + "input": "The suppressive effect of liposomal MPL in comparison with free drug was significantly prolonged ( > 120 h vs < 18 h ) .", + "output": [ + "000000000000000000000000" + ] + }, + { + "input": "A nonlinear relationship was found between suppression of splenocyte proliferation and the concentration of bound glucocorticoid receptors in spleen .", + "output": [ + "00000000000000012000" + ] + }, + { + "input": "Only partial receptor occupancy accompanied complete lymphocyte suppression .", + "output": [ + "000000000" + ] + }, + { + "input": "The suppression of endogenous corticosterone in plasma for both treatments was similar with values from L - MPL rats returning to baseline after 24 h .", + "output": [ + "00000000000000000000000000" + ] + }, + { + "input": "These results demonstrate enhanced efficacy of local immunosuppression by targeting spleen with liposomal MPL .", + "output": [ + "000000000000000" + ] + }, + { + "input": "Function of NF - kappa B / Rel binding sites in the major histocompatibility complex class II invariant chain promoter is dependent on cell - specific binding of different NF - kappa B / Rel subunits .", + "output": [ + "0012222222001222222200000000012222220" + ] + }, + { + "input": "The promoter of the human major histocompatibility complex class II - associated invariant - chain gene ( Ii ) contains two NF - kappa B / Rel binding sites located at - 109 to - 118 ( Ii kappa B - 1 ) and - 163 to - 172 ( Ii kappa B - 2 ) from the transcription start site .", + "output": [ + "01000012222222220100012222222001222201222200122220122220000000" + ] + }, + { + "input": "We report here that the differential function of each of these NF - kappa B / Rel sites in several distinct cell types depends on cell - specific binding of NF - kappa B / Rel transcription factors .", + "output": [ + "000000000001222222000000000000122222220" + ] + }, + { + "input": "Ii kappa B - 1 is a positive regulatory element in B - cell lines and in the Ii - expressing T - cell line , H9 , but acts as a negative regulatory element in myelomonocytic and glia cell lines .", + "output": [ + "122220012200000000000000000000001220000000" + ] + }, + { + "input": "Electrophoretic mobility supershift assays determine that members of the NF - kappa B / Rel family of transcription factors can bind to this site in vitro and that DNA - binding complexes that contain p50 , p52 , p65 , and cRel correlate with positive regulation whereas the presence of p50 correlates with negative regulation .", + "output": [ + "00000000012222220120000000001222001010100100000000100000" + ] + }, + { + "input": "In vivo occupancy of this site is observed only in the H9 T - cell line .", + "output": [ + "00000000000000000" + ] + }, + { + "input": "This differential binding of specific NF - kappa B / Rel subunits is likely to mediate the disparate functions of these two NF - kappa B / Rel binding sites .", + "output": [ + "0000012222220000000000122222220" + ] + }, + { + "input": "Epstein - Barr virus ( EBV ) replicative gene expression in tumour cells of AIDS - related non - Hodgkin ' s lymphoma in relation to CD4 cell number and antibody titres to EBV .", + "output": [ + "00000000000000000000000000100000000" + ] + }, + { + "input": "METHODS : Seventeen out of 22 cases of ARNHL were selected for the presence of EBV [ Epstein - Barr early region ( EBER ) RNA - positive ] .", + "output": [ + "000000000000000000000000000000" + ] + }, + { + "input": "Immunohistochemistry was performed with anti - ZEBRA , anti - EA - restricted , anti - VCA antibodies and in situ hybridization with BHLF1 / NotI oligoprobes on tumour samples .", + "output": [ + "0000122012222222220000000000000" + ] + }, + { + "input": "Results were statistically correlated with those of CD4 + cell counts ( 17 out of 17 ) and with anti - EBV antibody titres ( 13 out of 17 ) assessed using standard immunofluorescence method and enzyme - linked immunosorbent assay procedure using recombinant ZEBRA protein and synthetic peptides as antigens .", + "output": [ + "0000000120000000000000000000000000000000000122000010" + ] + }, + { + "input": "RESULTS : BZLF1 ( ZEBRA ) or early gene products ( EA - R and EA - D / BHLF1 / NotI ) were detected in a small proportion ( < 0 . 01 - 5 % ) of tumour cells in eight of these 17 cases by immunohistochemistry and in situ hybridization .", + "output": [ + "001010012201220122222200000000000000000000000000000000" + ] + }, + { + "input": "Demonstration of replicative gene expression did not correlate with either low CD4 + cell counts ( P > 0 . 05 ) or anti - EBV antibody titres ( P > 0 . 05 ) .", + "output": [ + "000000000001200000000000000000000000" + ] + }, + { + "input": "Anti - ZEBRA activity was not significantly increased in patients affected with ARNHL , the cells of which expressed replicative gene products ( P > 0 . 05 ) .", + "output": [ + "001000000000000000000000000000" + ] + }, + { + "input": "CONCLUSION : The degree of immunodeficiency does not clearly enhance replicative gene expression in tumour cells of ARNHL .", + "output": [ + "0000000000000000000" + ] + }, + { + "input": "EBV serology , including anti - ZEBRA activity , is not a reliable tool for predicting the occurrence of such proliferations .", + "output": [ + "0000001000000000000000" + ] + }, + { + "input": "Effects of prostaglandin E2 on Th0 - type human T cell clones : modulation of functions of nuclear proteins involved in cytokine production .", + "output": [ + "001200000000000001200100" + ] + }, + { + "input": "The effects of prostaglandin E2 ( PGE2 ) on cytokine production and proliferation of the CD4 + human helper T cell clone SP - B21 were investigated .", + "output": [ + "0001201001000000000000000000" + ] + }, + { + "input": "In contrast , in cells stimulated with phorbol myristate acetate ( PMA ) / A23187 , PGE2 enhanced the production of IL - 4 and IL - 5 , and only partially inhibited the production of other cytokines .", + "output": [ + "000000000000000010000122012200000000010" + ] + }, + { + "input": "Therefore , the effects of PGE2 vary depending on the mode of T cell activation , and the IL - 4 and IL - 5 are regulated differently from other cytokines .", + "output": [ + "00000100000000000012201220000010" + ] + }, + { + "input": "In a mobility shift assay , only the NF - kappa B ( p50 / p50 ) homodimer was observed in a complex formed with the kappa B sequence in unstimulated SP - B21 cells .", + "output": [ + "000000001222222222000000001220000000" + ] + }, + { + "input": "When cells were stimulated with anti - CD3 mAb or PMA / A23187 , a complex formation of NF - kappa B ( p50 / p65 ) heterodimer with the kappa B sequence was induced .", + "output": [ + "000001222000000000122201120000122000" + ] + }, + { + "input": "Interestingly , PGE2 or di - butyryl ( Bt2 ) cAMP abolished the binding of NF - kappa B ( p50 / p65 ) heterodimer to the kappa B sequence in cells stimulated with anti - CD3 mAb but not with PMA / A23187 .", + "output": [ + "001000000000000122222222200122000012220000000" + ] + }, + { + "input": "Our results suggest that the target of PGE2 action is a component in the signal transduction pathway leading to the activation of protein kinase C .", + "output": [ + "00000001000000000000001220" + ] + }, + { + "input": "However , the inhibition of the T cell activation signals by PGE2 is selective .", + "output": [ + "000000000001000" + ] + }, + { + "input": "PGE2 enhanced the complex formation with NF - AT , AP - 1 and CLE0 sequences when the cells were activated by either anti - CD3 mAb or PMA / A23187 stimulation .", + "output": [ + "100000122222222200000001222000000" + ] + }, + { + "input": "Characterization of NF ( P ) , the nuclear factor that interacts with the regulatory P sequence ( 5 ' - CGAAAATTTCC - 3 ' ) of the human interleukin - 4 gene : relationship to NF - kappa B and NF - AT .", + "output": [ + "001222001200000120000000000012222000122201220" + ] + }, + { + "input": "The P sequence of the human interleukin - 4 ( IL - 4 ) gene , which was defined as a responsive element for phorbol 12 - myristate 13 - acetate and calcium ionophore ( A23187 ) in Jurkat T cells , shares sequence similarity with the NF - kappa B and the NF - AT binding sites .", + "output": [ + "01200122222222200000012000000000000000000000000122222222220" + ] + }, + { + "input": "We examined whether NF ( P ) , a nuclear factor specific for the P sequence , is related to NF - kappa B and NF - AT .", + "output": [ + "00012220012000120000122201220" + ] + }, + { + "input": "NF - kappa B ( P65 or P65 / P50 heterodimer ) bound to the P sequence in electrophoretic mobility shift assays ( EMSA ) and activated transcription through the P sequence when expression plasmids were cotransfected with P sequence - driven reporter plasmids in Jurkat T cells .", + "output": [ + "1222010122200001200000000000001201200012222200000" + ] + }, + { + "input": "In EMSAs , NF ( P ) binding was inhibited by the unlabeled NF - AT binding site but not by the unlabeled AP1 binding site and purified NF - AT contained an activity that bound to the P sequence .", + "output": [ + "00012220000012222200001222012220000000120" + ] + }, + { + "input": "Both mobility shift and sequence specificity of NF - AT were similar to those of NF ( P ) and only a small amount of P65 was detected in NF ( P ) in crude nuclear extracts .", + "output": [ + "00000001220000012220000001000122200000" + ] + }, + { + "input": "These results indicate that the component ( s ) of NF - AT has the potential to reconstitute NF ( P ) whereas NF - kappa B alone can not account for NF ( P ) in crude extracts .", + "output": [ + "0000000000122000001222012220000012220000" + ] + }, + { + "input": "Unlike NF - AT , NF ( P ) does not contain AP1 as its DNA binding component .", + "output": [ + "0122012220001001220" + ] + }, + { + "input": "Activation of early growth response 1 gene transcription and pp90rsk during induction of monocytic differentiation .", + "output": [ + "0012222001000000" + ] + }, + { + "input": "The present work has studied mechanisms responsible for induction of early growth response 1 ( EGR - 1 ) gene expression during monocytic differentiation of U - 937 myeloid leukemia cells .", + "output": [ + "00000000001222222222000000000000" + ] + }, + { + "input": "Differentiation of U - 937 cells with 12 - O - tetradecanoylphorbol - 13 - acetate ( TPA ) , an activator of the serine / threonine protein kinase C , was associated with transcriptional activation of EGR - 1 promoter - reporter constructs .", + "output": [ + "000000000000000000000000122222000000012222220" + ] + }, + { + "input": "The EGR - 1 promoter contains six CC ( A / T ) 6GG ( CArG ) motifs .", + "output": [ + "0122200000000000000" + ] + }, + { + "input": "The two 5 ' - most distal CArG sequences conferred TPA inducibility .", + "output": [ + "0012222220000" + ] + }, + { + "input": "In contrast , there was little effect of TPA on EGR - 1 transcription in a TPA - resistant U - 937 cell variant , designated TUR .", + "output": [ + "0000000000122000000000000000" + ] + }, + { + "input": "Treatment of both U - 937 and TUR cells with okadaic acid , an inhibitor of serine / threonine protein phosphatases 1 and 2A , was associated with induction of monocytic differentiation and EGR - 1 transcription through the 5 ' - most CArG element .", + "output": [ + "0000000000000000122222220000000001220001222220" + ] + }, + { + "input": "Since these findings supported the involvement of serine / threonine protein phosphorylation in the regulation of EGR - 1 expression , we studied activation of the 40S ribosomal protein S6 serine / threonine kinases , pp70S6K and pp90rsk .", + "output": [ + "000000000000000012200000001222222201010" + ] + }, + { + "input": "Although both kinases participate in regulating cell growth , there was no detectable activation of pp70S6K during TPA - or okadaic acid - induced monocytic differentiation .", + "output": [ + "000000000000000100000000000" + ] + }, + { + "input": "Okadaic acid treatment of both cell types was associated with activation of pp90rsk .", + "output": [ + "00000000000010" + ] + }, + { + "input": "Antioxidants inhibit monocyte adhesion by suppressing nuclear factor - kappa B mobilization and induction of vascular cell adhesion molecule - 1 in endothelial cells stimulated to generate radicals .", + "output": [ + "00000012222000012222200000000" + ] + }, + { + "input": "Cell adhesion to endothelial cells stimulated by tumor necrosis factor - alpha ( TNF ) is due to induction of surface receptors , such as vascular cell adhesion molecule - 1 ( VCAM - 1 ) .", + "output": [ + "0000012222220100000012000122222012200" + ] + }, + { + "input": "The antioxidant pyrrolidine dithiocarbamate ( PDTC ) specifically inhibits activation of nuclear factor - kappa B ( NF - kappa B ) .", + "output": [ + "00000000000122220122200" + ] + }, + { + "input": "Since kappa B motifs are present in VCAM - 1 and intercellular adhesion molecule - 1 ( ICAM - 1 ) promoters , we used PDTC to study the regulatory mechanisms of VCAM - 1 and ICAM - 1 induction and subsequent monocyte adhesion in TNF - treated human umbilical vein endothelial cells ( HUVECs ) .", + "output": [ + "012200012222222222222200000000001220122000000000000000000" + ] + }, + { + "input": "Gel - shift analysis in HUVECs demonstrated that PDTC prevented NF - kappa B mobilization by TNF , suggesting that only VCAM - 1 induction was controlled by NF - kappa B .", + "output": [ + "000000000012220010000122000012220" + ] + }, + { + "input": "Since HUVECs released superoxide anions in response to TNF , and H2O2 induces VCAM - 1 , PDTC may act as a radical scavenger .", + "output": [ + "0000000000000122000000000" + ] + }, + { + "input": "Although ICAM - 1 induction was unaffected , inhibitors of NADPH oxidase ( apocynin ) or cytochrome P - 450 ( SKF525a ) suppressed VCAM - 1 induction by TNF , revealing that several radical - generating systems are involved in its regulation .", + "output": [ + "01220000001200001222000012200000000000000000" + ] + }, + { + "input": "PDTC , apocynin , or SKF525a decreased adhesion of monocytic U937 cells to TNF - treated HUVECs ( by 75 % at 100 mumol / L PDTC ) .", + "output": [ + "00000000000000000000000000000" + ] + }, + { + "input": "Inhibition by anti - VCAM - 1 monoclonal antibody 1G11 indicated that U937 adhesion was VCAM - 1 dependent and suppression by antioxidants was due to reduced VCAM - 1 induction .", + "output": [ + "00122222210000012200000000012200" + ] + }, + { + "input": "Displacement of an E - box - binding repressor by basic helix - loop - helix proteins : implications for B - cell specificity of the immunoglobulin heavy - chain enhancer .", + "output": [ + "00012222201222222000000000122220" + ] + }, + { + "input": "The activity of the immunoglobulin heavy - chain ( IgH ) enhancer is restricted to B cells , although it binds both B - cell - restricted and ubiquitous transcription factors .", + "output": [ + "00001222222200000000001222222220" + ] + }, + { + "input": "Activation of the enhancer in non - B cells upon overexpression of the basic helix - loop - helix ( bHLH ) protein E2A appears to be mediated not only by the binding of E2A to its cognate E box but also by the resulting displacement of a repressor from that same site .", + "output": [ + "000100000000012222222221000000000010001200000000100000" + ] + }, + { + "input": "Hence , we propose that a necessary prerequisite of enhancer activity is the B - cell - specific displacement of a ZEB - like repressor by bHLH proteins .", + "output": [ + "00000000010000000000012220120" + ] + }, + { + "input": "Inhibition of NF - kappa B by sodium salicylate and aspirin [ see comments ]", + "output": [ + "001222000000000" + ] + }, + { + "input": "The transcription factor nuclear factor - kappa B ( NF - kappa B ) is critical for the inducible expression of multiple cellular and viral genes involved in inflammation and infection including interleukin - 1 ( IL - 1 ) , IL - 6 , and adhesion molecules .", + "output": [ + "0121222201222000000000122200000012201220012200120" + ] + }, + { + "input": "The anti - inflammatory drugs sodium salicylate and aspirin inhibited the activation of NF - kappa B , which further explains the mechanism of action of these drugs .", + "output": [ + "00000000000001222000000000000" + ] + }, + { + "input": "This inhibition prevented the degradation of the NF - kappa B inhibitor , I kappa B , and therefore NF - kappa B was retained in the cytosol .", + "output": [ + "00000001222201220001222000000" + ] + }, + { + "input": "Sodium salicylate and aspirin also inhibited NF - kappa B - dependent transcription from the Ig kappa enhancer and the human immunodeficiency virus ( HIV ) long terminal repeat ( LTR ) in transfected T cells .", + "output": [ + "0000001222000001220012222222201000000" + ] + }, + { + "input": "Expression of antisense myb RNA reduced the amount of c - myb mRNA , and the percentage of Hb - synthesizing cells was decreased to 20 % .", + "output": [ + "0012200001222000000000000000" + ] + }, + { + "input": "In the presence of Epo , c - myb mRNA declined and 20 % of K562 cells synthesized Hb regardless of antisense myb RNA expression .", + "output": [ + "00001012220000000010012200" + ] + }, + { + "input": "It is suggested that constitutive expression of c - myb mRNA is necessary for Hm - induced differentiation , and that a decrease in the amount of c - myb mRNA induced by antisense myb RNA expression suppresses Hm - induced differentiation .", + "output": [ + "0000000122200010000000000001222001220010000" + ] + }, + { + "input": "The amount of c - myb mRNA in K562 cells was reduced during the differentiation induced by Epo .", + "output": [ + "0001222000000000010" + ] + }, + { + "input": "Expression of GATA - 1 mRNA was almost constant during Hm - induced differentiation , but increased during Epo treatment .", + "output": [ + "001222000010000000100" + ] + }, + { + "input": "It is supposed that the mechanism of Hm - induced differentiation is distinguished from that of Epo - induced differentiation in K562 cells .", + "output": [ + "000000010000000010000000" + ] + }, + { + "input": "Prenatal immune challenge alters the hypothalamic - pituitary - adrenocortical axis in adult rats .", + "output": [ + "000000000000000" + ] + }, + { + "input": "To study putative teratogenic effects of a T cell - mediated immune response versus an endotoxic challenge , 10 - d - pregnant rats received a single intraperitoneal injection of 5 x 10 ( 8 ) human red blood cells ( HRBC ) or gram - negative bacterial endotoxin ( Escherichia coli LPS : 30 micrograms / kg ) .", + "output": [ + "000000000000000000000000000000000000000000000000000000000000" + ] + }, + { + "input": "In addition , after novelty stress the HRBC group , but not the LPS group , showed increased ACTH and corticosterone levels .", + "output": [ + "00000000000000000000000" + ] + }, + { + "input": "This study demonstrates that a T cell - mediated immune response as well as an endotoxic challenge during pregnancy can induce anomalies in HPA axis function in adulthood .", + "output": [ + "00000000000000000000000000000" + ] + }, + { + "input": "Clinically , it may be postulated that disturbed fetal brain development due to prenatal immune challenge increases the vulnerability to develop mental illness involving inadequate responses to stress .", + "output": [ + "00000000000000000000000000000" + ] + }, + { + "input": "A low NM23 . H1 gene expression identifying high malignancy human melanomas .", + "output": [ + "0012220000000" + ] + }, + { + "input": "The NM23 gene has been proposed as a metastasis - suppressor gene , and its use has been suggested as prognostic factor .", + "output": [ + "01200000122200000000000" + ] + }, + { + "input": "In a human malignant melanoma study NM23 expression was found to be significantly lower in metastases that developed less than 24 months after diagnosis of the primary tumours .", + "output": [ + "00000010000000000000000000000" + ] + }, + { + "input": "The present paper studies the expression of the NM23 . H1 gene in cell lines which derive from primary or metastatic human malignant melanomas in relation to staging , infiltration degree , lymphocytic infiltration , cell morphology , cell pigmentation , karyotype , and disease - free survival .", + "output": [ + "0000000012220000000000000000000000000000000000000" + ] + }, + { + "input": "The level of mRNA expression of the NM23 gene is significantly lower in cell lines that derive from more infiltrating primary melanomas than in cell lines obtained from less infiltrating tumours .", + "output": [ + "00000001200000000000000000000000" + ] + }, + { + "input": "Moreover , cell lines derived from tumours of patients with a disease - free survival of more than 24 months ( 24 - 58 months ) express the NM23 gene at higher levels than cell lines obtained from melanomas of patients with a disease - free survival of less than 24 months ( 6 - 15 months ) .", + "output": [ + "00000000000000000000000000001200000000000000000000000000000" + ] + }, + { + "input": "Activation of a novel serine / threonine kinase that phosphorylates c - Fos upon stimulation of T and B lymphocytes via antigen and cytokine receptors .", + "output": [ + "00001222001220000000000120" + ] + }, + { + "input": "Ligation of Ag receptors in T and B lymphocytes initiates signal transduction cascades which alter the expression of genes that regulate cellular proliferation and differentiation .", + "output": [ + "00120000000000000000000000" + ] + }, + { + "input": "We have identified and characterized a novel serine / threonine kinase that phosphorylated the proto - oncogene product , c - Fos , and is termed Fos kinase .", + "output": [ + "00000001222000122201220000120" + ] + }, + { + "input": "Fos kinase was rapidly activated after ligation of the CD3 and CD2 receptors in Jurkat and normal human T lymphocytes and in response to IL - 6 and anti - IgM in the human B cell lines AF10 and Ramos , respectively .", + "output": [ + "1200000001222000000000001220122000000000000" + ] + }, + { + "input": "The phorbol ester , PMA , was also a potent inducer of Fos kinase activity in all of the above populations , suggesting that PKC plays a role in the regulation of this enzyme .", + "output": [ + "00000000000012000000000010000000010" + ] + }, + { + "input": "Fos kinase phosphorylates c - Fos at a site near the C - terminus , as well as a peptide derived from this region ( residues 359 - 370 , RKGSSSNEPSSD ) , and Fos peptide competitively inhibited c - Fos phosphorylation .", + "output": [ + "1201220000012200000000000122201000000012200" + ] + }, + { + "input": "Fos kinase was shown to be distinct from other identified serine / threonine kinases , including protein kinase A , protein kinase C , casein kinase II , MAP kinases , p70S6K and p90RSK .", + "output": [ + "12000000001222001220122012201201010" + ] + }, + { + "input": "Fos kinase was purified by anion exchange chromatography and exhibited an apparent M ( r ) = 65 , 000 and isoelectric point = 6 . 1 .", + "output": [ + "1200000000000000000000000000" + ] + }, + { + "input": "Moreover , its rapid activation suggests it may have a wider role within signal transduction cascades in lymphocytes .", + "output": [ + "0000000000000000000" + ] + }, + { + "input": "Antigenic specificities of human CD4 + T - cell clones recovered from recurrent genital herpes simplex virus type 2 lesions .", + "output": [ + "000000000000000000000" + ] + }, + { + "input": "Lesions resulting from recurrent genital herpes simplex virus ( HSV ) infection are characterized by infiltration of CD4 + lymphocytes .", + "output": [ + "000000000000000000000" + ] + }, + { + "input": "We have investigated the antigenic specificity of 47 HSV - specific CD4 + T - cell clones recovered from the HSV - 2 buttock and thigh lesions of five patients .", + "output": [ + "0000000000000000000000000000000" + ] + }, + { + "input": "Clones with proliferative responses to recombinant truncated glycoprotein B ( gB ) or gD of HSV - 2 or purified natural gC of HSV - 2 comprised a minority of the total number of HSV - specific clones isolated from lesions .", + "output": [ + "000001222010010000000000000000000000000000" + ] + }, + { + "input": "The gC2 - and gD2 - specific CD4 + clones had cytotoxic activity .", + "output": [ + "00000000000000" + ] + }, + { + "input": "The approximate locations of the HSV - 2 genes encoding HSV - 2 type - specific CD4 + antigens have been determined by using HSV - 1 x HSV - 2 intertypic recombinant virus and include the approximate map regions 0 . 30 to 0 . 46 , 0 . 59 to 0 . 67 , 0 . 67 to 0 . 73 , and 0 . 82 to 1 . 0 units .", + "output": [ + "00000000000000001220000000000000000000000000000000000000000000000000000000" + ] + }, + { + "input": "The antigenic specificity of an HLA DQ2 - restricted , HSV - 2 type - specific T - cell clone was mapped to amino acids 425 to 444 of VP16 of HSV - 2 by sequential use of an intertypic recombinant virus containing VP16 of HSV - 2 in an HSV - 1 background , recombinant VP16 fusion proteins , and synthetic peptides .", + "output": [ + "0000000000000000000000012222010000000000000100000000000122200000" + ] + }, + { + "input": "The antigenic specificities of lesion - derived CD4 + T - cell clones are quite diverse and include at least 10 epitopes .", + "output": [ + "00000000000000000000000" + ] + }, + { + "input": "Marked basophilia in acute promyelocytic leukaemia treated with all - trans retinoic acid : molecular analysis of the cell origin of the basophils .", + "output": [ + "000000000000000000000000" + ] + }, + { + "input": "We report a patient with acute promyelocytic leukaemia who developed marked basophilia during all - trans retinoic acid treatment .", + "output": [ + "00000000000000000000" + ] + }, + { + "input": "These findings suggest that the basophils which appeared during the ATRA treatment are reactive in nature rather than a leukaemic clone .", + "output": [ + "0000000000000000000000" + ] + }, + { + "input": "The host response to Mycobacterium tuberculosis includes granuloma formation at sites of infection and systemic symptoms .", + "output": [ + "00000000000000000" + ] + }, + { + "input": "Cytokines have been identified by immunohistochemistry in granulomas in animal models of bacillus Calmette - Guerin ( BCG ) infection and are released by mononuclear phagocytes upon stimulation by mycobacterial proteins .", + "output": [ + "10000000000000000000000000000000" + ] + }, + { + "input": "We have demonstrated that lipoarabinomannan ( LAM ) from the mycobacterial cell wall , which was virtually devoid of lipopolysaccharide ( LPS ) , stimulated mononuclear phagocytes to release IL - 6 in a dose - response manner .", + "output": [ + "000010100000000000000000000001220000000" + ] + }, + { + "input": "Both LAM - and LPS - inducible IL - 6 promoter activity was localized to a DNA fragment , positions - 158 to - 49 , by deletion analysis and chloramphenicol acetyltransferase assay .", + "output": [ + "0100122222200000120012222000001200" + ] + }, + { + "input": "Site - directed mutagenesis of one or more of these motifs within the IL - 6 promoter demonstrated that each has positive regulatory activity and that they could act in a function - and orientation - independent manner .", + "output": [ + "000000000000012200000000000000000000000" + ] + }, + { + "input": "Deletion of all three elements abolished inducibility of IL - 6 promoter activity by both LAM and LPS .", + "output": [ + "0000000012220001000" + ] + }, + { + "input": "Regulation of CD14 expression during monocytic differentiation induced with 1 alpha , 25 - dihydroxyvitamin D3 .", + "output": [ + "00100000000000000" + ] + }, + { + "input": "CD14 , a monocyte / macrophage receptor for the complex of LPS and LPS binding protein , is a differentiation marker for the monocyte / macrophage lineage .", + "output": [ + "1001222000000122000000000000" + ] + }, + { + "input": "We have analyzed the regulation of CD14 expression during 1 alpha , 25 - dihydroxyvitamin D3 ( VitD3 ) - induced monocytic differentiation .", + "output": [ + "000000100000000000000000" + ] + }, + { + "input": "We have recently cloned the CD14 5 ' upstream sequence and demonstrated its tissue - specific promoter activity .", + "output": [ + "0000012222000122200" + ] + }, + { + "input": "Using stable transfection of the monocytoid U937 cell line with a series of deletion mutants of the CD14 5 ' upstream sequence coupled to a reporter gene construct , we show that bp - 128 to - 70 is the critical region for the induction of CD14 expression .", + "output": [ + "0000000000000000012222000000000012222200000000100" + ] + }, + { + "input": "A 3 - bp mutation at the distal Sp1 - binding site not only eliminates Sp1 interaction , but also abolishes most of the VitD3 induction of CD14 expression .", + "output": [ + "000000001222000100000000000100" + ] + }, + { + "input": "Electrophoretic mobility shift analysis does not detect a direct interaction of the CD14 distal Sp1 - binding site with the vitamin D3 receptor and its partner , the retinoid X receptor .", + "output": [ + "00000000000010122200122000001220" + ] + }, + { + "input": "These data demonstrate that VitD3 induces CD14 indirectly through some intermediary factor , and suggest a critical role for Sp1 in this process .", + "output": [ + "000000100012000000010000" + ] + }, + { + "input": "DNA - binding and transcriptional regulatory properties of hepatic leukemia factor ( HLF ) and the t ( 17 ; 19 ) acute lymphoblastic leukemia chimera E2A - HLF .", + "output": [ + "000000001220100000000012222220" + ] + }, + { + "input": "The t ( 17 ; 19 ) translocation in acute lymphoblastic leukemias results in creation of E2A - hepatic leukemia factor ( HLF ) chimeric proteins that contain the DNA - binding and protein dimerization domains of the basic leucine zipper ( bZIP ) protein HLF fused to a portion of E2A proteins with transcriptional activation properties .", + "output": [ + "0122222000000000122220101200012222220012222221000001200000" + ] + }, + { + "input": "An in vitro binding site selection procedure was used to determine DNA sequences preferentially bound by wild - type HLF and chimeric E2A - HLF proteins isolated from various t ( 17 ; 19 ) - bearing leukemias .", + "output": [ + "000000000000000012220122200000000000000" + ] + }, + { + "input": "All were found to selectively bind the consensus sequence 5 ' - GTTACGTAAT - 3 ' with high affinity .", + "output": [ + "00000001200000000000" + ] + }, + { + "input": "Wild - type and chimeric HLF proteins also bound closely related sites identified previously for bZIP proteins of both the proline - and acidic amino acid - rich ( PAR ) and C / EBP subfamilies ; however , E2A - HLF proteins were significantly less tolerant of certain deviations from the HLF consensus binding site .", + "output": [ + "000012200000000120001000000001001222000122000000000012220" + ] + }, + { + "input": "These differences were directly attributable to loss of an HLF ancillary DNA - binding domain in all E2A - HLF chimeras and were further exacerbated by a zipper mutation in one isolate .", + "output": [ + "000000000122222001222000000000000" + ] + }, + { + "input": "Both wild - type and chimeric HLF proteins displayed transcriptional activator properties in lymphoid and nonlymphoid cells on reporter genes containing HLF or C / EBP consensus binding sites .", + "output": [ + "012201220120000000120122222220" + ] + }, + { + "input": "But on reporter genes with nonoptimal binding sites , their transcriptional properties diverged and E2A - HLF competitively inhibited activation by wild - type PAR proteins .", + "output": [ + "001201220000001220000122220" + ] + }, + { + "input": "These findings establish a spectrum of binding site - specific transcriptional properties for E2A - HLF which may preferentially activate expression of select subordinate genes as a homodimer and potentially antagonize expression of others through heteromeric interactions .", + "output": [ + "00000000000001220000000000000000000000" + ] + }, + { + "input": "ZAP - 70 tyrosine kinase , CD45 , and T cell receptor involvement in UV - and H2O2 - induced T cell signal transduction .", + "output": [ + "1222201001220000000000000" + ] + }, + { + "input": "Several mammalian responses to UV irradiation , including the activation of NF - kappa B , are believed to involve tyrosine phosphorylation .", + "output": [ + "00000000000122200000000" + ] + }, + { + "input": "We have examined the role of cell surface molecules in these responses .", + "output": [ + "0000000000000" + ] + }, + { + "input": "Normal T lymphocytes whose surface expression of CD3 was depleted showed impaired UV - induced tyrosine phosphorylation and Ca2 + signals .", + "output": [ + "0000000100000000000000" + ] + }, + { + "input": "However , all these cell types still gave strong Ca2 + and tyrosine phosphorylation responses to H2O2 .", + "output": [ + "000000000000000000" + ] + }, + { + "input": "The T cell tyrosine kinase ZAP - 70 was found to be highly responsive to UV and H2O2 treatment .", + "output": [ + "00001222000000000000" + ] + }, + { + "input": "ZAP - 70 responsiveness to UV required expression of both CD3 and CD45 , whereas only CD3 was required for the response to H2O2 .", + "output": [ + "1220000000101000100000000" + ] + }, + { + "input": "UV - induced activation of NF - kappa B was blocked by CD3 depletion , indicating the importance of such cell surface molecules in biological responses to UV .", + "output": [ + "00000122200010000000122000000" + ] + }, + { + "input": "In nonlymphoid cells , the epidermal growth factor receptor displayed increased tyrosine phosphorylation within seconds of UV irradiation .", + "output": [ + "0000012220000000000" + ] + }, + { + "input": "These results suggest that UV - induced signal transduction is mediated via cell surface receptors that normally respond to biological stimulation , whereas H2O2 is able to partially bypass this requirement .", + "output": [ + "00000000000012200000000000000000" + ] + }, + { + "input": "We have investigated the effect of redox changes in vivo on the differentiation of two human myeloid cell lines , HL - 60 and KG - 1 .", + "output": [ + "0000000000000000000000000000" + ] + }, + { + "input": "Moreover , DEM abolished phorbol 12 - myristate 13 - acetate - induced activation of the transcription factors AP - 1 and Egr - 1 , suggesting that inhibition of differentiation may be due , at least in part , to redox modifications of these proteins .", + "output": [ + "00000000000000001212201220000000000000000000010" + ] + }, + { + "input": "Lipopolysaccharide induction of tissue factor gene expression in monocytic cells is mediated by binding of c - Rel / p65 heterodimers to a kappa B - like site .", + "output": [ + "00012200000000012222200122220" + ] + }, + { + "input": "Exposure of monocytic cells to bacterial lipopolysaccharide ( LPS ) activates the NF - kappa B / Rel family of proteins and leads to the rapid induction of inflammatory gene products , including tissue factor ( TF ) .", + "output": [ + "000000000000122222200000000012200120100" + ] + }, + { + "input": "TF is the primary cellular initiator of the coagulation protease cascades .", + "output": [ + "100000001200" + ] + }, + { + "input": "Here we report the characterization of a nuclear complex from human monocytic cells that bound to a kappa B - like site , 5 ' - CGGAGTTTCC - 3 ' , in the 5 ' - flanking region of the human TF gene .", + "output": [ + "00000001200000000122220122222200012222001220" + ] + }, + { + "input": "In vitro binding studies demonstrated that the TF site bound translated c - Rel and p65 homodimers but not p50 / p65 heterodimers or p50 homodimers .", + "output": [ + "000000012001222220012220120" + ] + }, + { + "input": "Base - pair substitutions in the TF site indicated that the presence of a cytosine at position 1 precluded binding of NF - kappa B .", + "output": [ + "00000012000000001200012220" + ] + }, + { + "input": "In fact , under low - ionic - strength conditions , the TF complex did not migrate with translated p50 / p65 dimers but instead comigrated with c - Rel / p65 dimers .", + "output": [ + "0000000000001200000122200001222220" + ] + }, + { + "input": "Antibodies against the NF - kappa B and Rel proteins and UV cross - linking studies revealed the presence of c - Rel and p65 and the absence of p50 in the TF complex and further showed that c - Rel / p65 heterodimers selectively bound to the TF kappa B - like site .", + "output": [ + "0001222000000000000012200000010012000012222200001222220" + ] + }, + { + "input": "Functional studies indicated that the TF site conferred LPS inducibility on a heterologous promoter and was transactivated by c - Rel or p65 .", + "output": [ + "000001200000120000122000" + ] + }, + { + "input": "Taken together , our results demonstrated that binding of c - Rel / p65 heterodimers to a novel kappa B - like site mediated LPS induction of TF gene expression in monocytic cells .", + "output": [ + "0000000001222220001222200001000000" + ] + }, + { + "input": "Inhibition of T cell activation by the extracellular matrix protein tenascin .", + "output": [ + "000000012210" + ] + }, + { + "input": "Tenascin ( TN ) is an extracellular matrix protein that is expressed widely in the fetus and sparingly in the adult , but reappears at high levels in certain areas of tissue insult such as tumor matrices and sites of wound healing .", + "output": [ + "1010001220000000000000000000000000000000000" + ] + }, + { + "input": "We show here that soluble TN inhibits proliferation of human T cells in response to alpha CD3 Ab co - immobilized with the extracellular matrix protein fibronectin ( FN ) .", + "output": [ + "0000010000000001220000012210100" + ] + }, + { + "input": "TN also inhibits proliferation driven by alpha CD3 / IL - 2 or by phorbol ester / IL - 2 , and it prevents high level induction of IL - 2R .", + "output": [ + "10000012222200122222200000001220" + ] + }, + { + "input": "The presence of TN in culture medium does not detectably alter the pattern of tyrosine phosphorylation resulting from T cell triggering with alpha CD3 , but at later time points prevents the appearance of functional NF - AT1 transcription factor complexes in T cell nuclear extracts .", + "output": [ + "00010000000000000000001200000000000122222000000" + ] + }, + { + "input": "These findings are consistent with the postulated role for TN as a natural antagonist to FN action , and suggest that T cell responses occurring at tissue sites in which TN is expressed could be influenced by its presence .", + "output": [ + "0000000001000001000000000000001000000000" + ] + }, + { + "input": "Human immunodeficiency virus type 1 ( HIV - 1 ) negative factor ( Nef ) has been shown to down - regulate the transcription factors NF - kappa B and AP - 1 in vitro .", + "output": [ + "000000000012010000000001212220122000" + ] + }, + { + "input": "On the other hand , stimulation of T cells by mitogens or antibodies to the T - cell receptor ( TCR ) - CD3 complex resulted in the down - regulation of transcriptional factors NF - kappa B and AP - 1 in cells expressing the nef gene compared with cells not expressing the nef gene .", + "output": [ + "000000000000000000000001000000000012220122000000000000000" + ] + }, + { + "input": "Because the Nef protein does not affect the surface expression of the CD3 - TCR complex , we conclude that the Nef protein down - regulates the transcriptional factors NF - kappa B and AP - 1 in T cells in vitro through an effect on the TCR - dependent signal transduction pathway .", + "output": [ + "001000000000100000000100000001222012200000000000000000" + ] + }, + { + "input": "Effects of alpha - lipoic acid and dihydrolipoic acid on expression of proto - oncogene c - fos .", + "output": [ + "0000000000001222220" + ] + }, + { + "input": "The transcription factor AP - 1 is an important human mediator of the cellular response to serum , growth factors , and phorbol esters such as 12 - O - tetradecanoyl - phorbol - 13 acetate ( TPA ) .", + "output": [ + "0121220000000000001200000000000000000000" + ] + }, + { + "input": "The AP - 1 complex consists of distinct protein heterodimers encoded by the proto - oncogene c - fos and c - jun mRNA whose gene expression can be induced by TPA , cyclic AMP and growth factors .", + "output": [ + "012200001200012222201222000000000000120" + ] + }, + { + "input": "Recent findings suggest an involvement of reactive oxygen species in the pathway of TPA and protein kinase C leading to expression of c - fos and c - jun mRNA .", + "output": [ + "0000000000000001220000122222220" + ] + }, + { + "input": "To investigate the role of reactive oxygen species we studied the effects of alpha - lipoic acid and dihydrolipoic acid ( natural thiol antioxidants ) on the expression of c - fos mRNA in human Jurkat T cells .", + "output": [ + "000000000000000000000000000001222000000" + ] + }, + { + "input": "These studies support the idea that superoxide anion radical plays a role in the expression of c - fos mRNA .", + "output": [ + "000000000000000012220" + ] + }, + { + "input": "Appraisal of potential therapeutic index of antioxidants on the basis of their in vitro effects on HIV replication in monocytes and interleukin 2 - induced lymphocyte proliferation .", + "output": [ + "0000000000000000000001200000" + ] + }, + { + "input": "Antioxidant molecules have been suggested to be of therapeutic value in the treatment of HIV - infected patients .", + "output": [ + "0000000000000000000" + ] + }, + { + "input": "To evaluate this possibility , we examined in vitro the effects of two types of antioxidant molecules in terms of inhibition of HIV replication in monocytes , one of the main reservoirs of HIV , and also in terms of modulation of the immune competence as measured by PBMC proliferation .", + "output": [ + "000000000000000000000000000000000000000000000000000" + ] + }, + { + "input": "We tested the effects of BHA , a phenolic , lipid - soluble , chain - breaking antioxidant , and NAC , a known glutathione precursor with some direct free - radical scavenging properties as well , on the regulation of HIV - 1 expression in latently infected U1 cells and in productively and chronically infected U937 cells .", + "output": [ + "00000000000000000000000000000000000000000000000000000000000" + ] + }, + { + "input": "Both antioxidants inhibited TNF - or PMA - induced NF - kappa B activity in U1 cells , as well as the sustained NF - kappa B activity permanently induced by the virus itself in chronically HIV - infected U937 cells .", + "output": [ + "000100000122200000000001222000000000000000" + ] + }, + { + "input": "This may be the first limitation to potential antiviral effects of antioxidant therapies .", + "output": [ + "00000000000000" + ] + }, + { + "input": "These data warrant prudence in the design of antioxidant - based therapies aimed at suppressing HIV replication .", + "output": [ + "000000000000000000" + ] + }, + { + "input": "Isolation and characterization of gelatinase granules from human neutrophils .", + "output": [ + "0000000000" + ] + }, + { + "input": "We recently confirmed the existence of gelatinase granules as a subpopulation of peroxidase - negative granules by double - labeling immunogold electron microscopy on intact cells and by subcellular fractionation .", + "output": [ + "0000000000000000000000000000000" + ] + }, + { + "input": "Further characterization of gelatinase granules has been hampered by poor separation of specific and gelatinase granules on both two - layer Percoll gradients and sucrose gradients .", + "output": [ + "000000000000000000000000000" + ] + }, + { + "input": "We found that gelatinase granules , defined as peroxidase - negative granules containing gelatinase but lacking lactoferrin , contain 50 % of total cell gelatinase , with the remaining residing in specific granules .", + "output": [ + "0000000000000100100000001000000000" + ] + }, + { + "input": "Although no qualitative difference was observed between specific granules and gelatinase granules with respect to cytochrome b558 and Mac - 1 , stimulation of the neutrophil with FMLP resulted in a selective mobilization of the least dense peroxidase - negative granules , ie , gelatinase granules , which , in concert with secretory vesicles , furnish the plasma membrane with Mac - 1 and cytochrome b558 .", + "output": [ + "0000000000100001201220000001000000000000000010000000000000001220120" + ] + }, + { + "input": "Regulation of interleukin - 2 receptor alpha chain expression and nuclear factor . kappa B activation by protein kinase C in T lymphocytes .", + "output": [ + "001222220012222001220000" + ] + }, + { + "input": "Autocrine role of tumor necrosis factor alpha .", + "output": [ + "00012220" + ] + }, + { + "input": "The regulation of interleukin - 2 receptor alpha chain ( IL - 2R alpha ) expression and nuclear factor ( NF ) activation by protein kinase C ( PKC ) in resting T cells , has been studied .", + "output": [ + "000122222012220001200000122010000000000" + ] + }, + { + "input": "This activation was due to the translocation of p65 and c - Rel NF . kappa B proteins from cytoplasmic stores to the nucleus , where they bound the kappa B sequence of the IL - 2R alpha promoter either as p50 . p65 or as p50 . c - Rel heterodimers .", + "output": [ + "00000000101221222000000000000122001222200122001222200" + ] + }, + { + "input": "Interestingly , all of those events were largely indirect and mediated by endogenously secreted tumor necrosis factor alpha ( TNF alpha ) , as they were strongly inhibited by a neutralizing anti - TNF alpha monoclonal antibody .", + "output": [ + "00000000000000122201200000000012222220" + ] + }, + { + "input": "Furthermore , cyclosporin A , which blocked TNF alpha production induced by PKC , strongly inhibited IL - 2R alpha and NF . kappa B activation .", + "output": [ + "000000012000100012220122200" + ] + }, + { + "input": "The addition of either TNF alpha or IL - 2 partially recovered cyclosporin A - induced IL - 2R alpha inhibition , but only TNF alpha completely recovered NF . kappa B activation .", + "output": [ + "0000120122000000122200001200122200" + ] + }, + { + "input": "Those results indicate that , in resting T cells , PKC activation has only a triggering role , whereas the endogenously secreted TNF alpha plays an essential role in the quantitative control of the expression of IL - 2R alpha chain or NF . kappa B activation .", + "output": [ + "000000000010000000000012000000000000122200122200" + ] + }, + { + "input": "Superantigens activate HIV - 1 gene expression in monocytic cells .", + "output": [ + "10000000000" + ] + }, + { + "input": "Binding of superantigens to MHC class II molecules results in transduction of biochemical signals leading to cellular activation and gene expression .", + "output": [ + "0000122200000000000000" + ] + }, + { + "input": "We demonstrate that the staphylococcal superantigens toxic shock syndrome toxin - 1 ( TSST - 1 ) and staphylococcal enterotoxin A ( SEA ) activate HIV - 1 - LTR - driven transcription of chloramphenicol acetyl transferase in the human monocytic cell line THP - 1 .", + "output": [ + "00001212222201220012201001222200001220000000000" + ] + }, + { + "input": "Induction of HIV - 1 - LTR - driven transcription in THP - 1 cells by superantigens was associated with the induction of nuclear factor - kappa B DNA - binding activity .", + "output": [ + "000000100000000010000001222200000" + ] + }, + { + "input": "Superantigens also increased viral protein secretion from the granulocyte - macrophage colony - stimulating factor - pretreated chronically infected human monocytic cell line U1 .", + "output": [ + "1000000000000000000000000" + ] + }, + { + "input": "Induction of HIV - 1 gene expression in monocytic cells by superantigens occurred via tumor necrosis factor - alpha - dependent and - independent mechanisms .", + "output": [ + "00000000000100000000000000" + ] + }, + { + "input": "Our results suggest that superantigens and other MHC class II ligands may activate HIV - 1 gene expression in monocytes / macrophages .", + "output": [ + "00001001222000000000000" + ] + }, + { + "input": "Mitogen activation of human peripheral T lymphocytes induces the formation of new cyclic AMP response element - binding protein nuclear complexes .", + "output": [ + "0000000000001222222220" + ] + }, + { + "input": "A large body of evidence indicates that experimental agents which raise cellular cAMP levels inhibit T cell growth and division .", + "output": [ + "000000000000000000000" + ] + }, + { + "input": "By contrast , many studies have reported that mitogen activation of T cells increases cAMP levels , implying a positive physiological role for cAMP in the activation process .", + "output": [ + "00000000100000000000000000000" + ] + }, + { + "input": "In the present study we demonstrate that mitogen activation of human peripheral T lymphocytes induces nuclear factors that form complexes with cyclic AMP response element - binding protein ( CREB ) .", + "output": [ + "00000001000000000000012222220100" + ] + }, + { + "input": "Four complexes are identified by the electrophoretic mobility shift assay , two of which are induced by mitogen activation .", + "output": [ + "00000000000000000100" + ] + }, + { + "input": "All four complexes contain CREB and are bound to the cAMP response element ( CRE ) core sequence ( TGACGTCA ) , as indicated by antibody and oligonucleotide competition experiments .", + "output": [ + "0000100000122222220000000000000" + ] + }, + { + "input": "Binding of the four complexes to CRE is prevented by dephosphorylation of nuclear extracts and is restored by rephosphorylation with cAMP - dependent protein kinase or endogenous kinases .", + "output": [ + "00000010000000000000122220120" + ] + }, + { + "input": "Similar complexes are detected in nuclear extracts of Jurkat cells .", + "output": [ + "00000000000" + ] + }, + { + "input": "Mitogen induction of the electrophoretic mobility shift assay complexes is not accounted for by protein phosphorylation or by induction of CREB .", + "output": [ + "0000122220000000000010" + ] + }, + { + "input": "Induction of new CREB complexes implies a physiological role for cAMP in mitogen activation of T lymphocytes .", + "output": [ + "000120000000100000" + ] + }, + { + "input": "Alpha - tocopherol inhibits agonist - induced monocytic cell adhesion to cultured human endothelial cells .", + "output": [ + "0000000000000000" + ] + }, + { + "input": "Antioxidants have been proposed to be anti - atherosclerotic agents ; however , the mechanisms underlying their beneficial effects are poorly understood .", + "output": [ + "00000000000000000000000" + ] + }, + { + "input": "Human umbilical vein ECs were pretreated with alpha - tcp before stimulation with known agonists of monocyte adhesion : IL - 1 ( 10 ng / ml ) , LPS ( 10 ng / ml ) , thrombin ( 30 U / ml ) , or PMA ( 10 nM ) .", + "output": [ + "0000000000000000000122000000000000000100000000000000" + ] + }, + { + "input": "The IC50 of alpha - tcp on an IL - 1 - induced response was 45 microM .", + "output": [ + "000000001220000000" + ] + }, + { + "input": "The inhibition correlated with a decrease in steady state levels of E - selectin mRNA and cell surface expression of E - selectin which is consistent with the ability of a monoclonal antibody to E - selectin to inhibit monocytic cell adhesion in this system .", + "output": [ + "0000000000012220000012200000000120122000000000" + ] + }, + { + "input": "Probucol ( 50 microM ) and N - acetylcysteine ( 20 mM ) also inhibited agonist - induced monocytic cell adhesion ; whereas , several other antioxidants had no significant effect .", + "output": [ + "00000000000000000000000000000000" + ] + }, + { + "input": "Protein kinase C ( PKC ) does not appear to play a role in the alpha - tcp effect since no suppression of phosphorylation of PKC substrates was observed .", + "output": [ + "122010000000000000000000010000" + ] + }, + { + "input": "Activation of the transcription factor NF - kappa B is reported to be necessary but not sufficient for E - selectin expression in EC .", + "output": [ + "0001212220000000001220000" + ] + }, + { + "input": "Electrophoretic mobility shift assays failed to show an alpha - tcp - induced decrease in activation of this transcription factor after cytokine stimulation .", + "output": [ + "000000000000000000120100" + ] + }, + { + "input": "It has been hypothesized that alpha - tcp acts as an anti - atherosclerotic molecule by inhibiting generation of oxidized LDL - - a putative triggering molecule in the atherosclerotic process .", + "output": [ + "00000000000000000000000000000000" + ] + }, + { + "input": "Our results point to a novel alternative mechanism of action of alpha - tcp .", + "output": [ + "000000000000000" + ] + }, + { + "input": "The Tat protein of human immunodeficiency virus type 1 ( HIV - 1 ) is a potent activator of long terminal repeat - directed transcription .", + "output": [ + "01200000000000000001220000" + ] + }, + { + "input": "While in most cell types , activation requires interaction of Tat with the unusual transcription element TAR , astrocytic glial cells support TAR - independent transactivation of HIV - 1 transcription by Tat .", + "output": [ + "0000000000000012100000100000000000" + ] + }, + { + "input": "This alternative pathway of Tat activation is mediated by the viral enhancer , a kappa B domain capable of binding the prototypical form of the transcription factor nuclear factor kappa B ( NF - kappa B ) present in many cell types , including T lymphocytes .", + "output": [ + "00001000001200000000000001200000122200000000000" + ] + }, + { + "input": "The present study demonstrates the existence of kappa B - specific binding factors present in human glial astrocytes that differ from prototypical NF - kappa B .", + "output": [ + "000000012222200000000012220" + ] + }, + { + "input": "The novel astrocyte - derived kappa B - binding activity is retained on an HIV - 1 Tat affinity column , while prototypical NF - kappa B from Jurkat T cells is not .", + "output": [ + "0000000000000000010000012220000000" + ] + }, + { + "input": "In vitro transcription studies demonstrate that astrocyte - derived kappa B - binding factors activate transcription of the HIV - 1 long terminal repeat and that this activation is dependent on the kappa B domain .", + "output": [ + "000000122222220000122222000000001220" + ] + }, + { + "input": "Moreover , TAR - independent transactivation of HIV - 1 transcription is reproduced in vitro in an astrocyte factor - dependent manner which correlates with kappa B - binding activity .", + "output": [ + "0010000000000000000000000000000" + ] + }, + { + "input": "The importance of the central nervous system - enriched kappa B transcription factor in the regulation of HIV - 1 expression is discussed .", + "output": [ + "000012222221200000000000" + ] + }, + { + "input": "Human interleukin - 13 activates the interleukin - 4 - dependent transcription factor NF - IL4 sharing a DNA binding motif with an interferon - gamma - induced nuclear binding factor .", + "output": [ + "12220012222221220012200122222220" + ] + }, + { + "input": "The effects of interleukin - 13 ( IL - 13 ) and interleukin - 4 ( IL - 4 ) on cellular functions were shown to be quite similar .", + "output": [ + "000122012200122012200000000000" + ] + }, + { + "input": "We provide evidence that in monocytes as well as in T lymphocytes both IL - 4 and IL - 13 activate the same recently identified transcription factor NF - IL4 which binds to the specific responsive element IL - 4RE .", + "output": [ + "00000000000001220122000001212200001222220" + ] + }, + { + "input": "In addition , we show that a nuclear factor activated by interferon - gamma also interacts with the IL - 4RE .", + "output": [ + "0000000120000000001220" + ] + }, + { + "input": "It differs from NF - IL4 in the electrophoretic mobility of the complex with DNA , in its DNA - binding specificity and in the proteins interacting with the DNA sequence .", + "output": [ + "00012200000000000000000000000120" + ] + }, + { + "input": "Sensitivity against various enzyme inhibitors suggests that components of the signal transduction pathway are shared by all three cytokines .", + "output": [ + "00000000000000000010" + ] + }, + { + "input": "Encephalomyocarditis virus internal ribosomal entry site RNA - protein interactions .", + "output": [ + "00000000000" + ] + }, + { + "input": "Translational initiation of encephalomyocarditis virus ( EMCV ) mRNA occurs by ribosomal entry into the 5 ' nontranslated region of the EMCV mRNA , rather than by ribosomal scanning .", + "output": [ + "000122222000000122200120000000" + ] + }, + { + "input": "Internal ribosomal binding requires a cis - acting element termed the internal ribosomal entry site ( IRES ) .", + "output": [ + "0000012220012220100" + ] + }, + { + "input": "IRES elements have been proposed to be involved in the translation of picornavirus mRNAs and some cellular mRNAs .", + "output": [ + "1200000000001200120" + ] + }, + { + "input": "Internal ribosome binding likely requires the interaction of trans - acting factors that recognize both the mRNA and the ribosomal complex .", + "output": [ + "0000000012220000100120" + ] + }, + { + "input": "Five cellular proteins ( p52 , p57 , p70 , p72 , and p100 ) cross - link the EMCV IRES or fragments of the IRES .", + "output": [ + "012010101010010000001000010" + ] + }, + { + "input": "Recently , p57 was identified to be very similar , if not identical , to polypyrimidine tract - binding protein .", + "output": [ + "001000000000000122220" + ] + }, + { + "input": "On the basis of cross - linking results with 21 different EMCV IRES fragments and cytoplasmic HeLa extract or rabbit reticulocyte lysate as the source of polypeptides , consensus binding sites for p52 , p57 , p70 , and p100 are proposed .", + "output": [ + "0000000000012200000000000000122010101001000" + ] + }, + { + "input": "It is suggested that each of these proteins recognizes primarily a structural feature of the RNA rather than a specific sequence .", + "output": [ + "0000000000000000000000" + ] + }, + { + "input": "A novel heterodimerization partner for thyroid hormone receptor .", + "output": [ + "001201220" + ] + }, + { + "input": "Peroxisome proliferator - activated receptor .", + "output": [ + "122220" + ] + }, + { + "input": "In this study we have identified the peroxisome proliferator - activated receptor ( PPAR ) as a new thyroid hormone receptor ( THR ) auxiliary nuclear protein , heterodimerizing with THR in solution .", + "output": [ + "0000000122220100001222222220001000" + ] + }, + { + "input": "Although these heterodimers do not recognize a classical thyroid hormone response element ( TRE ) characterized by direct repeat separated by four nucleotides ( DR + 4 ) , PPAR behaves as a dominant negative regulator of thyroid hormone ( TH ) action .", + "output": [ + "00100000122201000000000012200100000000000000" + ] + }, + { + "input": "However , a TH - dependent positive effect is elicited by selective interaction of the THR beta - PPAR but not the THR alpha - PPAR heterodimer with a novel TRE ( DR + 2 ) .", + "output": [ + "0000000000000001222000122220001012200" + ] + }, + { + "input": "The critical region of THR beta was mapped to 3 amino acids in the distal box of the DNA binding domain .", + "output": [ + "0000100000000012001220" + ] + }, + { + "input": "In addition to PMA , cells of the THP - 1 myeloid leukemia cell line acquire macrophage - like characteristics after treatment with all - trans retinoic acid ( RA ) .", + "output": [ + "00000000000000000000000000000000" + ] + }, + { + "input": "To analyze the signal transduction mechanisms induced by RA , we first compared the effects of PMA and RA on the expression of genes which are known to be regulated during monocytic differentiation .", + "output": [ + "0000000000000000000000000000000000" + ] + }, + { + "input": "Both RA and PMA effectively down - regulated c - myc expression , while c - myb expression decreased only after PMA treatment .", + "output": [ + "000000001220001220000000" + ] + }, + { + "input": "Expression of the beta 2 - integrin genes , CD11a and CD11b , was clearly increased after both of these treatments .", + "output": [ + "0001222201010000000000" + ] + }, + { + "input": "Their effects on the src - family tyrosine kinase genes were different : hck expression was similarly induced by these agents but lyn expression was stronger and more rapid after RA treatment .", + "output": [ + "000012222200010000000000000000000" + ] + }, + { + "input": "RA also enhanced lyn mRNA production rapidly in HL - 60 , indicating that the activation of lyn gene expression is common in monocytic and granulocytic maturation of myeloid leukemia cells .", + "output": [ + "00012000000000000120000000000000" + ] + }, + { + "input": "To examine whether the AP - 1 enhancer activity is involved in RA - induced monocytic differentiation , THP - 1 cells were transiently transfected with a chloramphenicol acetyl transferase ( CAT ) - reporter gene containing 5 copies of the AP - 1 binding sites .", + "output": [ + "00001222000000000000000000012222222200000122220" + ] + }, + { + "input": "In contrast to PMA , RA did not induce any CAT activity in these cells , thus suggesting that the RA - induced changes in the expression of those genes described above were not dependent on the AP - 1 enhancer activity .", + "output": [ + "0000000000100000000000000000000000000122200" + ] + }, + { + "input": "An active v - abl protein tyrosine kinase blocks immunoglobulin light - chain gene rearrangement .", + "output": [ + "0012222201222200" + ] + }, + { + "input": "Most of these cells have rearranged their heavy - chain locus but not their light chain genes , suggesting that an active v - abl protein interferes with this differentiation step .", + "output": [ + "00000001222000122000001222000000" + ] + }, + { + "input": "These events are accompanied by marked increases in the expression of RAG - 1 and RAG - 2 RNAs .", + "output": [ + "00000000000122222220" + ] + }, + { + "input": "These increases occur in the absence of protein synthesis but are dependent on inactivation of the v - abl protein tyrosine kinase .", + "output": [ + "00000000000000001222220" + ] + }, + { + "input": "As documented in the accompanying paper ( Klug et al . , this issue ) , an active v - abl protein also suppresses the activity of NF - kappa B / rel and expression controlled by the kappa intron enhancer .", + "output": [ + "000000000000000000122200000122222000001220" + ] + }, + { + "input": "Together these data demonstrate that the v - abl protein specifically interferes with light - chain gene rearrangement by suppressing at least two pathways essential for this stage of B - cell differentiation and suggest that tyrosine phosphorylation is important in regulating RAG gene expression .", + "output": [ + "0000001222000122200000000000000000000000001200" + ] + }, + { + "input": "Calcium signalling in T cells stimulated by a cyclophilin B - binding protein .", + "output": [ + "00000000122220" + ] + }, + { + "input": "The immunosuppressant drug cyclosporin A blocks a calcium - dependent signal from the T - cell receptor ( TCR ) that normally leads to T - cell activation .", + "output": [ + "00000000000001222010000000000" + ] + }, + { + "input": "When bound to cyclophilin , cyclosporin A binds and inactivates the key signalling intermediate calcineurin .", + "output": [ + "0001000000000010" + ] + }, + { + "input": "To identify potential cellular homologues of cyclosporin A that might regulate calcium signalling , we have cloned human genes encoding cyclophilin B - binding - proteins using the yeast two - hybrid system .", + "output": [ + "0000000000000000000012222200000000" + ] + }, + { + "input": "One gene product , when overexpressed in Jurkat T cells , specifically induced transcription from the interleukin - 2 enhancer , by activating the T - cell - specific transcription factors NF - AT and NF - IL2A .", + "output": [ + "000000000000000012220000122222212201220" + ] + }, + { + "input": "This protein , termed calcium - signal modulating cyclophilin ligand ( CAML ) , acts downstream of the TCR and upstream of calcineurin by causing an influx of calcium .", + "output": [ + "000012222201000000100010000000" + ] + }, + { + "input": "CAML appears to be a new participant in the calcium - signal transduction pathway , implicating cyclophilin B in calcium signalling , even in the absence of cyclosporin .", + "output": [ + "10000000000000001200000000000" + ] + }, + { + "input": "Peripheral blood mononuclear cells from seventeen patients with primary myelodysplastic syndromes ( MDS ) in advanced stage were enriched for blasts and tested for ( 1 ) karyotype , ( 2 ) genomic configuration and ( 3 ) expression of IL - 3 , GM - CSF , FMS and EGR - 1 genes which are all located on the long arm of chromosome 5 .", + "output": [ + "000000000000000000000000000000000000000012222222222222000000122220" + ] + }, + { + "input": "Aims of the study were to ( 1 ) assess the potential role of the expression of these genes in the maintenance and expansion of the neoplastic clones and ( 2 ) search for constitutional losses or rearrangements of one allele followed by a deletion of the second allele of the same genes in the leukemic cells .", + "output": [ + "0000000000000000000000000000000000000000100000001000000000" + ] + }, + { + "input": "The latter issue was investigated by comparing , in 8 cases , constitutive DNA from skin fibroblasts with leukemic DNA .", + "output": [ + "000000000000120000120" + ] + }, + { + "input": "Eleven of the 17 patients had abnormal karyotypes .", + "output": [ + "000000000" + ] + }, + { + "input": "The M - CSF gene was expressed in 6 cases and the FMS and the EGR - 1 genes were expressed in 2 of the latter cases .", + "output": [ + "0122200000001001222000000000" + ] + }, + { + "input": "An autocrine mechanism of growth could be hypothesized only for the 2 patients whose cells expressed both the M - CSF and FMS genes .", + "output": [ + "0000000000000000001222220" + ] + }, + { + "input": "No germline changes or rearrangements were observed in any of the genes studied .", + "output": [ + "00000000000000" + ] + }, + { + "input": "Thus , deregulation of genes encoding for certain hemopoietic growth factors or receptors does not seem to represent a major mechanism of MDS progression .", + "output": [ + "0000000012200000000000000" + ] + }, + { + "input": "A novel human homeobox gene distantly related to proboscipedia is expressed in lymphoid and pancreatic tissues .", + "output": [ + "00122000100000000" + ] + }, + { + "input": "A novel human homeobox gene , HB9 , was isolated from a cDNA library prepared from in vitro stimulated human tonsil B lymphocytes and from a human genomic library .", + "output": [ + "001220100000120000000000001220" + ] + }, + { + "input": "The HB9 gene is composed of 3 exons spread over 6 kilobases of DNA .", + "output": [ + "012000010000000" + ] + }, + { + "input": "An open reading frame of 1206 nucleotides is in frame with a diverged homeodomain .", + "output": [ + "012200000000120" + ] + }, + { + "input": "The predicted HB9 protein has a molecular mass of 41 kilodaltons and is enriched for alanine , glycine , and leucine .", + "output": [ + "0012000000000000000000" + ] + }, + { + "input": "The HB9 homeodomain is most similar to that of the Drosophila melanogaster homeobox gene proboscipedia .", + "output": [ + "0120000000122210" + ] + }, + { + "input": "Northern blot analysis of poly ( A ) RNA purified from the human B cell line RPMI 8226 and from activated T cells revealed a major mRNA transcript of 2 . 2 kilobases .", + "output": [ + "0000122220000000000000000122000000" + ] + }, + { + "input": "Reverse transcriptase - polymerase chain reaction was used to examine HB9 RNA transcripts in hematopoietic cell lines .", + "output": [ + "000000000012200000" + ] + }, + { + "input": "HB9 RNA transcripts were most prevalent in several human B cell lines and K562 cells .", + "output": [ + "1220000000000000" + ] + }, + { + "input": "In addition , transcripts were detected in RNA prepared from tonsil B cells and in situ hybridization studies localized them in the germinal center region of adult tonsil .", + "output": [ + "00000000000000000000000000000" + ] + }, + { + "input": "These findings suggest the involvement of HB9 in regulating gene transcription in lymphoid and pancreatic tissues .", + "output": [ + "00000010000000000" + ] + }, + { + "input": "Human immunodeficiency virus type 1 Tat upregulates interleukin - 2 secretion in activated T cells .", + "output": [ + "1222220122000000" + ] + }, + { + "input": "Dysregulation of cytokines secreted by T cells may play an important role in the pathogenesis of AIDS .", + "output": [ + "001000000000000000" + ] + }, + { + "input": "To investigate the effects of human immunodeficiency virus type 1 ( HIV - 1 ) Tat on interleukin - 2 ( IL - 2 ) expression , we used IL - 2 promoter - chloramphenicol acetyltransferase constructs and IL - 2 - secreting Jurkat T cells as a model system .", + "output": [ + "000001222222222201220122000001222222200000000000000" + ] + }, + { + "input": "Transient expression of HIV - 1 Tat induced a five - to eightfold increase in IL - 2 promoter activity in Jurkat T cells stimulated with phytohemagglutinin and phorbol myristate acetate .", + "output": [ + "00012220000000012220000000100000" + ] + }, + { + "input": "IL - 2 secretion was increased more than twofold in both Jurkat T cells and primary T cells stimulated by extracellular HIV - 1 Tat protein .", + "output": [ + "122000000000000000001222220" + ] + }, + { + "input": "Analysis of mRNA suggested that Tat exerts its effect on IL - 2 primarily at the transcriptional level .", + "output": [ + "0010000000122000000" + ] + }, + { + "input": "The NF - kappa B site at positions - 206 to - 195 of the IL - 2 promoter was required but not sufficient for the Tat effect .", + "output": [ + "01222200122220012220000000100" + ] + }, + { + "input": "The Tat - mediated increase in IL - 2 promoter activity could selectively be blocked by antisense tat or - unlike the analogous effect of human T - cell lymphotropic virus type 1 Tax - by cyclosporin A .", + "output": [ + "010000122200000000000000012222222200000" + ] + }, + { + "input": "Furthermore , it might contribute to the hypergammaglobulinem or , together with other cytokines found to be dysregulated , the T - helper cell dysfunctions observed in AIDS patients .", + "output": [ + "000000000000010000000000000000" + ] + }, + { + "input": "Activation of nuclear factor kappa B in human lymphoblastoid cells by low - dose ionizing radiation .", + "output": [ + "00122200000000000" + ] + }, + { + "input": "Nuclear factor kappa B ( NF - kappa B ) is a pleiotropic transcription factor which is involved in the transcriptional regulation of several specific genes .", + "output": [ + "122201222000122000000000000" + ] + }, + { + "input": "These results are in a dose range where the viability of the cells remains very high .", + "output": [ + "00000000000000000" + ] + }, + { + "input": "After exposure to 137Cs gamma rays at a dose rate of 1 . 17 Gy / min , a maximum in expression of NF - kappa B was seen at 8 h after a 0 . 5 - Gy exposure .", + "output": [ + "00000000000000000000000122200000000000000" + ] + }, + { + "input": "Time - course studies revealed a biphasic time - dependent expression after 0 . 5 - , 1 - and 2 - Gy exposures .", + "output": [ + "0000000000000000000000000" + ] + }, + { + "input": "However , for each time examined , the expression of NF - kappa B was maximum after the 0 . 5 - Gy exposure .", + "output": [ + "0000000000122200000000000" + ] + }, + { + "input": "Alternative splicing of RNA transcripts encoded by the murine p105 NF - kappa B gene generates I kappa B gamma isoforms with different inhibitory activities .", + "output": [ + "00012000122222201222200000" + ] + }, + { + "input": "The gene encoding the 105 - kDa protein ( p105 ) precursor of the p50 subunit of transcription factor NF - kappa B also encodes a p70 I kappa B protein , I kappa B gamma , which is identical to the C - terminal 607 amino acids of p105 .", + "output": [ + "000012222222001000012220001222201222000000122222010" + ] + }, + { + "input": "Here we show that alternative RNA splicing generates I kappa B gamma isoforms with properties different from those of p70 .", + "output": [ + "000000001222200000010" + ] + }, + { + "input": "One 63 - kDa isoform , termed I kappa B gamma - 1 , which lacks 59 amino acids C - terminal to ankyrin repeat 7 , has a novel 35 - amino acid C terminus encoded by an alternative reading frame of the p105 gene .", + "output": [ + "01222001222220000000000122000012222200012200120" + ] + }, + { + "input": "A 55 - kDa isoform , I kappa B gamma - 2 , lacks the 190 C - terminal amino acids of p70 I kappa B gamma .", + "output": [ + "0122201222220001222220112220" + ] + }, + { + "input": "In contrast to p70 I kappa B gamma , which is a cytoplasmic protein , I kappa B gamma - 1 is found in both the cytoplasm and nucleus , whereas I kappa B gamma - 2 is predominantly nuclear .", + "output": [ + "00011222000012012222200000000001222220000" + ] + }, + { + "input": "The I kappa B gamma isoforms also display differences in specificity and affinity for Rel / NF - kappa B proteins .", + "output": [ + "0122220000000012222220" + ] + }, + { + "input": "While p70 I kappa B gamma inhibits p50 - , p65 - , and c - Rel - mediated transactivation and / or DNA binding , both I kappa B gamma - 1 and I kappa B gamma - 2 are specific for p50 and have different affinities for this subunit .", + "output": [ + "0112220000000000000000000001222220122222000100000000" + ] + }, + { + "input": "The absence in I kappa B gamma - 1 and I kappa B gamma - 2 of a protein kinase A site whose phosphorylation modulates p70 I kappa B gamma inhibitory activity suggests that alternative RNA splicing may be used to generate I kappa B gamma isoforms that respond differently to intracellular signals .", + "output": [ + "000122222012222200122200011222000000000000122220000000" + ] + }, + { + "input": "Structure and expression of the human GATA3 gene .", + "output": [ + "000001220" + ] + }, + { + "input": "GATA3 , a member of the GATA family that is abundantly expressed in the T - lymphocyte lineage , is thought to participate in T - cell receptor gene activation through binding to enhancers .", + "output": [ + "10000012000000000000000012220000010" + ] + }, + { + "input": "To understand GATA3 gene regulation , we cloned the human gene and the 5 ' end of the mouse GATA3 gene .", + "output": [ + "0012000001200122001220" + ] + }, + { + "input": "We show that the human GATA3 gene contains six exons distributed over 17 kb of DNA .", + "output": [ + "00001220010000000" + ] + }, + { + "input": "The promoter sequence analysis of these two genes revealed that they are embedded within a CpG island and share structural features often found in the promoters of housekeeping genes .", + "output": [ + "000000000000000120000000010120" + ] + }, + { + "input": "Finally , we show that a DNA fragment containing the human GATA3 transcription unit , 3 kb upstream from the initiation site and 4 kb downstream from the polyadenylation site , displays T - cell specificity .", + "output": [ + "0000001200122201220012012200120000000" + ] + }, + { + "input": "Characterization of the human gene encoding LBR , an integral protein of the nuclear envelope inner membrane .", + "output": [ + "000120100120000000" + ] + }, + { + "input": "We have characterized the human gene encoding LBR , an integral protein of the nuclear envelope inner membrane .", + "output": [ + "0000120100120000000" + ] + }, + { + "input": "Restriction mapping shows that the transcription unit spans approximately 35 kilobases .", + "output": [ + "000001200000" + ] + }, + { + "input": "A transcription start site is located approximately 4 kilobases 5 ' to the translation initiation codon , and an RNA splice of 3863 bases occurs in the 5 ' - untranslated region to generate mature HeLa cell mRNA .", + "output": [ + "000000000000012200000000000122220012220" + ] + }, + { + "input": "5 ' to the identified transcription start site are two CCAAT sequences and potential recognition sites for several transcription factors including Sp1 , AP - 1 , AP - 2 , and NF - kB .", + "output": [ + "000001220012012200120101220122001220" + ] + }, + { + "input": "There are 13 protein coding exons in the LBR gene .", + "output": [ + "00000100120" + ] + }, + { + "input": "LBR ' s nucleoplasmic domain is encoded by exons 1 - 4 , and its hydrophobic domain , with eight putative transmembrane segments , is encoded by exons 5 - 13 .", + "output": [ + "10012000122200012000012000012220" + ] + }, + { + "input": "The hydrophobic domain is homologous to three yeast polypeptides , suggesting that this higher eukaryotic gene could have evolved from recombination between a gene that encoded a soluble nuclear protein and a membrane protein gene similar to those in yeast .", + "output": [ + "01200000000001220000000000012200122000000" + ] + }, + { + "input": "These results are the first to demonstrate the structural organization of a vertebrate gene encoding an integral membrane protein of the nuclear envelope that may be a member of a family of polypeptides conserved in evolution .", + "output": [ + "0000000000001200122000000000000000000" + ] + }, + { + "input": "Virtually no information is available on regulation and functions of CD38 .", + "output": [ + "000000000010" + ] + }, + { + "input": "Recently we reported that all - trans - retinoic acid ( ATRA ) is a potent and highly specific inducer of CD38 expression in human promyelocytic leukemia cells .", + "output": [ + "00000000000000000000010000000" + ] + }, + { + "input": "Here we report that ATRA - induced expression of CD38 antigen in myeloid cells is mediated through retinoic acid - alpha receptor ( RAR alpha ) .", + "output": [ + "000000000120000001222201200" + ] + }, + { + "input": "ATRA failed to induce CD38 expression in a mutant subclone of the HL - 60 myeloid leukemia cell line ( designated HL - 60R ) that is relatively resistant to ATRA - induced granulocytic differentiation .", + "output": [ + "000010000000000000000000000000000000" + ] + }, + { + "input": "Retroviral vector - mediated transduction of RA receptor ( RAR alpha ) into this HL - 60R subclone completely restored the sensitivity of these cells to ATRA in terms of their ability to express CD38 .", + "output": [ + "000000120120000000000000000000000010" + ] + }, + { + "input": "In contrast , CD38 expression was not inducible by ATRA in HL - 60R cells , transfected with a functional RAR beta , RAR gamma , or RXR alpha receptor .", + "output": [ + "0001000000000000000012012001220" + ] + }, + { + "input": "Induction of CD38 in acute promyelocytic and acute myeloblastic leukemia cells was independent of ATRA - induced cytodifferentiation .", + "output": [ + "0010000000000000000" + ] + }, + { + "input": "Following culture with ATRA , increased CD38 protein levels were also observed in normal CD34 + bone marrow cells , but not on normal circulating granulocytes .", + "output": [ + "000000100000000000000000000" + ] + }, + { + "input": "From these results , we conclude that CD38 is ATRA inducible in myeloid leukemia cells and normal CD34 + bone marrow cells .", + "output": [ + "00000001000000000000000" + ] + }, + { + "input": "This effect is independent of differentiation and is mediated by RAR alpha in HL - 60 cells , suggesting a similar role for RAR alpha in CD38 expression in other hematopoietic cells .", + "output": [ + "000000000012000000000001201000000" + ] + }, + { + "input": "Some antioxidants , including butylated hydroxyanisole ( BHA ) , tetrahydropapaveroli ( THP ) , nordihydroguiauretic acid , and 10 , 11 - dihydroxyaporphine ( DHA ) , were found to be potent inhibitors of the production of tumor necrosis factor ( TNF ) - alpha , IL - 1 beta , and IL - 6 by human peripheral blood mononuclear cells ( PBMC ) stimulated by lipopolysaccharide ( LPS ) ( IC50s in the low micromolar range ) .", + "output": [ + "00000000000000000000000000000000000000122222220122200122000000000000000000000000" + ] + }, + { + "input": "Inhibition of cytokine production by PBMC was observed also when other inducers were used ( staphylococci , silica , zymosan ) .", + "output": [ + "0010000000000000000000" + ] + }, + { + "input": "The active compounds did not inhibit IL - 1 - induced production of IL - 6 in fibroblasts , showing the cell selectivity of the effect .", + "output": [ + "000000122000012200000000000" + ] + }, + { + "input": "Antioxidant - mediated inhibition of cytokine production was correlated with low levels of the corresponding messenger RNAs .", + "output": [ + "000001000000000120" + ] + }, + { + "input": "Nuclear run - on experiments showed that THP inhibited transcription of the IL - 1 beta gene .", + "output": [ + "000000000000122220" + ] + }, + { + "input": "THP decreased the concentration of the transcription factors NF - kappa B and AP - 1 detected in nuclear extracts of PBMC cultured in the presence or absence of LPS .", + "output": [ + "0000001212220122000000000000000" + ] + }, + { + "input": "THP and DHA markedly decreased the levels of TNF - alpha and IL - 1 beta in the circulation of mice following LPS injection .", + "output": [ + "0000000012201222000000000" + ] + }, + { + "input": "Coordinate inhibition of the transcription of genes for inflammatory cytokines could provide a strategy for therapy of diseases with inflammatory pathogenesis and for septic shock .", + "output": [ + "00000000010000000000000000" + ] + }, + { + "input": "An interleukin - 4 - induced transcription factor : IL - 4 Stat .", + "output": [ + "01222222012220" + ] + }, + { + "input": "Interleukin - 4 ( IL - 4 ) is an immunomodulatory cytokine secreted by activated T lymphocytes , basophils , and mast cells .", + "output": [ + "122012200000000000000000" + ] + }, + { + "input": "It plays an important role in modulating the balance of T helper ( Th ) cell subsets , favoring expansion of the Th2 lineage relative to Th1 .", + "output": [ + "0000000000000000000000000000" + ] + }, + { + "input": "Imbalance of these T lymphocyte subsets has been implicated in immunological diseases including allergy , inflammation , and autoimmune disease .", + "output": [ + "000000000000000000000" + ] + }, + { + "input": "IL - 4 may mediate its biological effects , at least in part , by activating a tyrosine - phosphorylated DNA binding protein .", + "output": [ + "122000000000000001222220" + ] + }, + { + "input": "Study of the inhibitory activities of phosphotyrosine - containing peptides derived from the intracellular domain of the IL - 4 receptor provided evidence for direct coupling of receptor and transcription factor during the IL - 4 Stat activation cycle .", + "output": [ + "0000000000000122222220000001012001222000" + ] + }, + { + "input": "Evaluation of the respiratory epithelium of normals and individuals with cystic fibrosis for the presence of adenovirus E1a sequences relevant to the use of E1a - adenovirus vectors for gene therapy for the respiratory manifestations of cystic fibrosis .", + "output": [ + "000000000000000012200000000000000000000" + ] + }, + { + "input": "For safety reasons , the Ad vectors are rendered replication deficient by deletion of the E1a region .", + "output": [ + "000000000000000120" + ] + }, + { + "input": "Because there is the theoretical possibility of an E1a - replication - deficient vector replicating as a result of recombination or complementation with Ad 2 / 5 E1a sequences present in the target cell , this study is directed toward evaluating respiratory epithelium of normals and individuals with CF for the presence of E1a sequences .", + "output": [ + "00000000000000000000000122222000000000000000000000000000" + ] + }, + { + "input": "Using Ad 2 / 5 E1a - specific primers and the polymerase chain reaction to evaluate DNA recovered from freshly isolated nasal and bronchial epithelium recovered by brushing , E1a sequences were detected in respiratory epithelium of 19 of 91 normals ( 21 % ) .", + "output": [ + "0122222220000000000000000000012000000000000000" + ] + }, + { + "input": "In CF individuals , 7 of 52 ( 13 % ) had detectable E1a sequences in the respiratory epithelium , with E1a copy number in the positive samples of 80 + / - 21 / 10 ( 3 ) recovered cells .", + "output": [ + "000000000000012000000000000000000000000000" + ] + }, + { + "input": "These results demonstrate that there are detectable Ad 2 / 5 E1a sequences in the respiratory epithelium of a small percentage of normals and individuals with CF .", + "output": [ + "0000000122222000000000000000" + ] + }, + { + "input": "Because of the theoretical potential of such sequences supporting replication of E1a - Ad vectors , human gene therapy protocols for CF utilizing such vectors should consider evaluating study individuals for the presence of Ad 2 / 5 E1a sequences in the respiratory epithelium .", + "output": [ + "000000000000000000000000000000000012222200000" + ] + }, + { + "input": "Leiomyosarcoma of the vulva : report of a case .", + "output": [ + "0000000000" + ] + }, + { + "input": "A 52 - year - old female presented with a progressively enlarging vulvar mass .", + "output": [ + "000000000000000" + ] + }, + { + "input": "Pathological evaluation revealed a high - grade vulvar leiomyosarcoma .", + "output": [ + "0000000000" + ] + }, + { + "input": "Immunohistochemical and ultrastructural studies were performed to support the diagnosis .", + "output": [ + "00000000000" + ] + }, + { + "input": "In an effort to better understand the biology of this tumor additional immunohistochemical studies for the protein product of p53 tumor suppressor gene and estrogen receptor expression by tumor cells , as well as the type of immune cells infiltrating the tumor were performed .", + "output": [ + "000000000000000012012220120000000000000000000" + ] + }, + { + "input": "Macrophages and T and B lymphocytes infiltrated the tumor in moderate numbers with occasional lymphoid aggregate formation .", + "output": [ + "000000000000000000" + ] + }, + { + "input": "This study is the first attempt to better understand the biology of these tumors .", + "output": [ + "000000000000000" + ] + }, + { + "input": "Stimulation of HIV replication in mononuclear phagocytes by leukemia inhibitory factor .", + "output": [ + "000000001220" + ] + }, + { + "input": "This study examined the effects of leukemia inhibitory factor ( LIF ) on human immunodeficiency virus ( HIV ) replication in mononuclear phagocytes ( MNP ) .", + "output": [ + "000000122010000000000000000" + ] + }, + { + "input": "LIF induced a dose - dependent increase in p24 antigen production in the chronically infected promonocytic cell line U1 .", + "output": [ + "10000000120000000000" + ] + }, + { + "input": "LIF increased steady - state levels of HIV mRNA at 2 . 0 , 4 . 3 , and 9 . 2 kB .", + "output": [ + "100000012000000000000000" + ] + }, + { + "input": "This was detectable by 24 h and persisted until 72 h .", + "output": [ + "000000000000" + ] + }, + { + "input": "The DNA binding protein NF - kB is a central mediator in cytokine activation of HIV transcription .", + "output": [ + "012222200000100000" + ] + }, + { + "input": "NF - kB levels were higher in unstimulated U1 cells as compared to the parent cell line U937 .", + "output": [ + "1220000000000000000" + ] + }, + { + "input": "The oxygen radical scavenger N - acetyl - L - cysteine , but not an inhibitor of nitric oxide synthase , inhibited LIF - induced HIV replication .", + "output": [ + "0000000000000000012200100000" + ] + }, + { + "input": "LIF induces the production of other cytokines in monocytes but its effects on HIV replication were not inhibited by antibodies to IL - 1 , TNF , or IL - 6 .", + "output": [ + "10000010000000000001012201001220" + ] + }, + { + "input": "These results identify LIF as a stimulus of HIV replication .", + "output": [ + "00010000000" + ] + }, + { + "input": "Mechanisms involved in the inhibition of growth of a human B lymphoma cell line , B104 , by anti - MHC class II antibodies .", + "output": [ + "0000000000000000001222220" + ] + }, + { + "input": "Two anti - MHC class II Ab , L227 and 2 . 06 , inhibited the growth of B104 cells , although 2 . 06 , but not L227 , needed to be further cross - linked with a goat anti - mouse IgG Ab ( GAM ) to show the effect .", + "output": [ + "01222220101220000000001220001000000000012222201000000" + ] + }, + { + "input": "L227 induced an increase in intracellular free Ca2 + concentration ( [ Ca2 + ] i ) from the intracellular pool and little or no protein tyrosine phosphorylation , phosphatidyl inositol turnover , or expression of Egr - 1 mRNA , whereas 2 . 06 plus GAM induced an increase in [ Ca2 + ] i from both the intracellular and , in particular , the extracellular pools .", + "output": [ + "100000000000000000000000000000000000122200122010000000000000000000000" + ] + }, + { + "input": "The inhibition of B104 cell growth induced by anti - MHC class II Ab was Ca ( 2 + ) - independent and not inhibited by actinomycin D or cyclosporin A , and cell cycle arrest at the G2 / M interphase was not observed .", + "output": [ + "0000000012222200000000000000000000000000000000" + ] + }, + { + "input": "These features are very different from those observed in B104 cell death induced by anti - IgM Ab .", + "output": [ + "0000000000000012220" + ] + }, + { + "input": "Neither DNA fragmentation nor the morphology of apoptosis was observed .", + "output": [ + "00000000000" + ] + }, + { + "input": "These findings demonstrate that cross - linking of MHC class II molecules transduced the negative signals through intracellular mechanisms different from those present in the cross - linking of surface IgM .", + "output": [ + "00000000122200000000000000000010" + ] + }, + { + "input": "Functional block for 1 alpha , 25 - dihydroxyvitamin D3 - mediated gene regulation in human B lymphocytes .", + "output": [ + "0000000000000000000" + ] + }, + { + "input": "Elements necessary for the steroid hormone 1 alpha , 25 - dihydroxyvitamin D3 ( 1 alpha , 25 - ( OH ) 2D3 ) to induce a biological response include the presence of specific intracellular receptors ( vitamin D3 receptors ( VDR ) ) and modulation of gene expression via hormone - activated receptor binding to regulatory regions of target genes .", + "output": [ + "00000000000000000000000000000000001201220100000000000000120120" + ] + }, + { + "input": "These parameters were examined in normal and Epstein - Barr virus - immortalized human B cells and compared with 1 alpha , 25 - ( OH ) 2D3 - responsive cells of the T and monocytic lineages .", + "output": [ + "00000000000000000000000000000000000000" + ] + }, + { + "input": "Although resting tonsillar B cells did not express VDR mRNA , activation of these cells with interleukin - 4 induced VDR in the absence of exogenously supplemented 1 alpha , 25 - ( OH ) 2D3 .", + "output": [ + "0000000012000000122010000000000000000" + ] + }, + { + "input": "As indicators of hormone - mediated gene regulation we analyzed modulation of CD23 , a common B cell / monocyte surface antigen , and 24 - hydroxylase .", + "output": [ + "0000000000001001222222001220" + ] + }, + { + "input": "1 alpha , 25 - ( OH ) 2D3 inhibited CD23 expression in U937 cells , yet failed to modulate CD23 expression in B cells .", + "output": [ + "00000000001000000000100000" + ] + }, + { + "input": "Furthermore , 1 alpha , 25 - ( OH ) 2D3 induced 24 - hydroxylase mRNA expression and metabolic activity in both U937 cells and lectin - activated T cells , yet failed to induce 24 - hydroxylase mRNA or its metabolic activity in B cells .", + "output": [ + "00000000000012200000000000000000000122200000000" + ] + }, + { + "input": "These findings suggest that although human B lymphocytes can express VDR mRNA and protein , they exhibit a functional block for vitamin D - dependent gene regulation .", + "output": [ + "0000000000120100000000000000" + ] + }, + { + "input": "Positive and negative regulation of IL - 2 gene expression : role of multiple regulatory sites .", + "output": [ + "00000122000000000" + ] + }, + { + "input": "Interleukin 2 ( IL - 2 ) is an important lymphokine required in the process of T cell activation , proliferation , clonal expansion and differentiation .", + "output": [ + "000122000010000000000000000" + ] + }, + { + "input": "The IL - 2 gene displays both T cell specific and inducible expression : it is only expressed in CD4 + T cells after antigenic or mitogenic stimulation .", + "output": [ + "01222000000000000000000000000" + ] + }, + { + "input": "Several cis - acting regulatory sites are required for induction of the IL - 2 gene after stimulation .", + "output": [ + "0122220000001222000" + ] + }, + { + "input": "In this study , we have analysed the function of these cis - acting regulatory sites in the context of the native IL - 2 enhancer and promoter sequence .", + "output": [ + "000000000001222200000012220120" + ] + }, + { + "input": "The results of this study suggest that the NFAT ( - 276 to - 261 ) , the distal octamer ( - 256 to - 248 ) and the proximal octamer ( - 75 to - 66 ) sites not only act as enhancers of IL - 2 gene transcription in the presence of cellular stimulation , but also have a silencing effect on IL - 2 gene expression in resting cells .", + "output": [ + "0000000010122220001201222200012012222000000001222000000000000000122200000" + ] + }, + { + "input": "Two other sites display disparate effects on IL - 2 gene expression in different T leukemia cell lines : the distal purine box ( - 291 to - 277 ) and the proximal purine box sites ( - 145 to - 128 ) .", + "output": [ + "00000001222000000000122012222000122201222200" + ] + }, + { + "input": "Finally , the AP - 1 ( - 186 to - 176 ) and the kappa B sites ( - 206 to - 195 ) respond to different cellular activation in EL4 cells .", + "output": [ + "0001222222222222220122220000000000" + ] + }, + { + "input": "The AP - 1 site mediated the response to PMA stimulation while the kappa B site responded to IL - 1 stimulation .", + "output": [ + "01222000000001220012200" + ] + }, + { + "input": "These data suggest that the regulation of IL - 2 gene expression is a complex process and multiple cis - acting regulatory sites interact to exert different effects in T cells representative of alternative stages of differentiation .", + "output": [ + "00000001222000000012222000000000000000" + ] + }, + { + "input": "Sp1 is a critical factor for the monocytic specific expression of human CD14 .", + "output": [ + "10000000000120" + ] + }, + { + "input": "CD14 is a membrane glycoprotein expressed specifically on monocytes and macrophages , and its expression is markedly increased during the process of monocyte differentiation .", + "output": [ + "1001200000000000000000000" + ] + }, + { + "input": "A 5 . 5 - kilobase genomic clone contained the full - length CD14 coding sequence and 4 . 2 kilobases of 5 ' - upstream sequence .", + "output": [ + "0122222200000122012222222220" + ] + }, + { + "input": "One major and one minor transcription start site were identified 101 and 130 base pairs ( bp ) upstream , respectively , from the protein translation start ATG .", + "output": [ + "01222222001222222220000012220" + ] + }, + { + "input": "A DNA fragment containing 128 bp of upstream sequence had strong , monocyte - specific promoter activity in the CD14 positive monocytic cell line Mono Mac 6 as compared to the nonmonocytic cell lines HeLa and REX .", + "output": [ + "01201222200000000000000000000000000000" + ] + }, + { + "input": "Mutation of the major Sp1 binding site ( - 110 bp ) decreased tissue - specific promoter activity , and these results , together with transactivation experiments , demonstrate that Sp1 plays a critical role in the tissue - specific expression of CD14 in monocytic cells .", + "output": [ + "00012220122000000000000000000010000000000010000" + ] + }, + { + "input": "CD14 Sp1 site oligonucleotides bound preferentially to a 105 - kDa Sp1 species , which is present in higher relative levels in monocytic than non - monocytic cells , suggesting that modification of Sp1 , such as phosphorylation , may explain how the Sp1 site mediates monocytic specific promoter activity .", + "output": [ + "110000001222200000000000000000000100000000010000000" + ] + }, + { + "input": "The interleukin - 8 AP - 1 and kappa B - like sites are genetic end targets of FK506 - sensitive pathway accompanied by calcium mobilization .", + "output": [ + "012222222222200000000000000" + ] + }, + { + "input": "FK506 , an immunosuppressant , inhibits the production of several cytokines in T lymphocytes .", + "output": [ + "000000000010000" + ] + }, + { + "input": "We observed that FK506 suppressed the transcription of a chemotactic cytokine , interleukin - 8 ( IL - 8 ) in a human T cell line , Jurkat cells , activated by phorbol 12 - myristate 13 - acetate ( PMA ) and calcium ( Ca2 + ) ionophore ( ionomycin ) .", + "output": [ + "00000000012012201220000000000000000000000000000000000" + ] + }, + { + "input": "By deleted and mutated analysis of the IL - 8 promoters , the AP - 1 and kappa B - like sites were identified as the responsive elements for PMA and ionomycin .", + "output": [ + "000000012220012222222200000000000" + ] + }, + { + "input": "FK506 suppressed the transcriptions through the AP - 1 or kappa B - like sites induced by PMA plus Ca ( 2 + ) - mobilizing agents , but not those induced by Ca ( 2 + ) - independent stimuli .", + "output": [ + "000000122012222000000000000000000000000000" + ] + }, + { + "input": "In gel retardation analysis , FK506 had little effect on the binding to the AP - 1 site of PMA / ionomycin - induced nuclear factors , which were recognized with anti - JunD or c - Fos antibody .", + "output": [ + "0000000000000012220000000000000122012220" + ] + }, + { + "input": "In contrast , FK506 or EGTA ( Ca2 + chelator ) similarly affected the formation of kappa B - like site binding complexes , which were not recognized by any antibodies against the human Rel family proteins ( c - Rel , p65 , p50 , and p49 ) .", + "output": [ + "00000000000000001222222000000010012220122010100100" + ] + }, + { + "input": "Furthermore , we confirmed the previous report that FK506 suppressed the PMA / ionomycin - induced activation through authentic kappa B site of immunoglobulin ( Ig ) gene , to which NF - kappa B binding was also decreased by FK506 , indicating that both IL - 8 kappa B - like site and Ig kappa B site are FK506 - sensitive in spite of the difference of binding factors .", + "output": [ + "00000000000000000001220122220001222000000000012222222001220000000000120" + ] + }, + { + "input": "Our results indicate that not only the reported IL - 2 NF - AT and NFIL - 2A sites and Ig kappa B site , but also the IL - 8 AP - 1 and kappa B - like sites are terminals of FK506 - sensitive pathway involving Ca2 + mobilization .", + "output": [ + "0000000012222222222001220000122122012222000000000000" + ] + }, + { + "input": "Androgen binding sites in peripheral human mononuclear leukocytes of healthy males and females .", + "output": [ + "12200000000000" + ] + }, + { + "input": "Androgen binding sites have been identified in circulating human mononuclear leukocytes of healthy donors of both sexes .", + "output": [ + "122000000000000000" + ] + }, + { + "input": "Cells were separated from blood samples on a Ficoll gradient and incubated with different concentrations of [ 3H ] testosterone in the presence or absence of a 400 - fold excess of unlabelled testosterone .", + "output": [ + "00000000000000000000000000000000000" + ] + }, + { + "input": "The binding sites fulfil the required criteria for specific steroid binding sites however differ somewhat from the classic androgen receptors from genital skin fibroblast : in fertile adult males ( n = 20 ) the binding sites showed ( 1 ) a high affinity for testosterone ( 1 . 32 + / - 0 . 49 nM ; mean + / - SD ) , ( 2 ) a saturable capacity ( 184 + / - 52 binding sites per cell ; mean + / - SD ) , and ( 3 ) a characteristic competitive binding profile for other steroid hormones ( relative binding affinities : testosterone = dihydrotestosterone > 17 beta - estradiol > progesterone , whereas aldosterone , 17 - hydroxy - progesterone and cortisol did not compete appreciably ) .", + "output": [ + "01200000012200000012000000000000000120000000000000000000000000000000000000000120000000000000000000000000000000000000000000000000000000" + ] + }, + { + "input": "Furthermore the number of binding sites determined using [ 3H ] dihydrotestosterone , [ 3H ] RU - 1881 , or [ 3H ] testosterone were comparable .", + "output": [ + "0000120000000000000000000000" + ] + }, + { + "input": "This raises the possibility that androgen receptors in peripheral mononuclear leukocytes differ from those in genital skin fibroblasts .", + "output": [ + "0000012000000000000" + ] + }, + { + "input": "There was no apparent correlation between serum testosterone concentrations and androgen binding sites .", + "output": [ + "00000000001220" + ] + }, + { + "input": "The presence of androgen receptors in peripheral mononuclear leukocytes provides for the first time the experimental basis for an hypothesis of direct , receptor - mediated effects of androgens on mature immunocompetent cells .", + "output": [ + "0001200000000000000000000000000000" + ] + }, + { + "input": "Induction of IL - 8 expression in T cells uses the CD28 costimulatory pathway .", + "output": [ + "001220000001000" + ] + }, + { + "input": "IL - 8 , a potent chemotactic factor for neutrophil granulocytes and lymphocytes , is a proinflammatory cytokine secreted by a variety of cell types , including T cells .", + "output": [ + "122000120000000000000000000000" + ] + }, + { + "input": "Anti - CD28 - stimulated T cells produced significant amounts of IL - 8 ; additionally , costimulation with anti - CD3 and anti - CD28 Abs resulted in a synergistic induction of IL - 8 secretion .", + "output": [ + "00000000000122000001220122200000012200" + ] + }, + { + "input": "Sequence homology , single nucleotide mutations , and anti - CD28 Ab stimulation studies established that the NF - kappa B - like sequence in the promoter of the IL - 8 gene functioned as a CD28 response element .", + "output": [ + "0000000012220000012222220010012220001220" + ] + }, + { + "input": "Furthermore , cyclosporin A , but not rapamycin , blocked the synergistic induction of IL - 8 expression achieved with anti - CD3 and anti - CD28 costimulation .", + "output": [ + "00000000000000122000122000100" + ] + }, + { + "input": "The involvement of a CD28 response element in the induction of IL - 8 expression in activated T cells may provide new insights into the pathogenesis and persistence of immune disorders characterized by increased levels of IL - 8 , such as psoriasis and rheumatoid arthritis .", + "output": [ + "00001220000122000000000000000000000012200000000" + ] + }, + { + "input": "MHC class II signaling in B - cell activation [ see comments ]", + "output": [ + "1220000000000" + ] + }, + { + "input": "The cognate interaction between T cells and antigen - presenting cells ( APCs ) , mediated by major histocompatibility complex ( MHC ) class II molecules , results in the delivery of activation signals to the APC .", + "output": [ + "00000000000000000122222222000000000000" + ] + }, + { + "input": "These signals contribute to the expression of co - stimulatory activity by APCs and have important consequences for cell effector function .", + "output": [ + "0000000000000000000000" + ] + }, + { + "input": "MHC class II molecules also serve as receptors for B - cell stimulation by microbial superantigens .", + "output": [ + "12200000000000120" + ] + }, + { + "input": "In this review , Paul Scholl and Raif Geha discuss recent advances in our understanding of mechanisms of MHC class II signaling and analyse their role in human B - cell activation .", + "output": [ + "000000000000000000122000000000000" + ] + }, + { + "input": "Effects of glucocorticoids in rheumatoid arthritis .", + "output": [ + "0000000" + ] + }, + { + "input": "OBJECTIVE .", + "output": [ + "00" + ] + }, + { + "input": "Lymphocytes of patients with rheumatoid arthritis ( RA ) have diminished receptor density ; thus , patients with RA should show partial resistance to glucocorticoids .", + "output": [ + "00000000000000000000000000" + ] + }, + { + "input": "We investigated the glucocorticoid sensitivity of lymphocytes in RA patients compared with healthy subjects .", + "output": [ + "000000000000000" + ] + }, + { + "input": "METHODS .", + "output": [ + "00" + ] + }, + { + "input": "We determined the effects of glucocorticoids on lymphocyte proliferation and cytokine release .", + "output": [ + "0000000000100" + ] + }, + { + "input": "RESULTS .", + "output": [ + "00" + ] + }, + { + "input": "Proliferation and cytokine release were inhibited in RA patients to the same extent as in healthy controls .", + "output": [ + "001000000000000000" + ] + }, + { + "input": "CONCLUSION .", + "output": [ + "00" + ] + }, + { + "input": "Diminished receptor density in RA patients does not result in glucocorticoid resistance .", + "output": [ + "0000000000000" + ] + }, + { + "input": "Arrested development : understanding v - abl .", + "output": [ + "00001220" + ] + }, + { + "input": "The protein tyrosine kinase activity of the v - abl oncogene has been demonstrated to subvert the normal second messenger systems used by lymphoid cells for growth and differentiation .", + "output": [ + "012200012220000000000000000000" + ] + }, + { + "input": "Transformation of bone marrow with the Abelson murine leukemia virus results in the appearance of B cell lineage cells arrested at the pre - B cell stage .", + "output": [ + "0000000000000000000000000000" + ] + }, + { + "input": "Recent reports have characterized these cells expressing high v - abl kinase activity as deficient in detectable NF - kappaB DNA binding activity and low level RAG gene expression .", + "output": [ + "000000001220000001220000001200" + ] + }, + { + "input": "These observations suggest that v - abl may be inhibiting the differentiation of B cells by blocking these two crucial elements in the maturation pathway .", + "output": [ + "00001220000000000000000000" + ] + }, + { + "input": "Corticosteroid receptors in lymphocytes : a possible marker of brain involution ?", + "output": [ + "120000000000" + ] + }, + { + "input": "A similarity has recently been found between the regulation of corticosteroid receptors in brain and in lymphoid tissue .", + "output": [ + "0000000000120000000" + ] + }, + { + "input": "We have studied the regulation of corticosteroid receptors in human mononuclear leukocytes as a possible marker of brain involution .", + "output": [ + "00000012000000000000" + ] + }, + { + "input": "Type I corticosteroid receptors are down regulated by excess of mineralocorticoids ( primary and secondary hyperaldosteronism , pseudohyperaldostero ) and of glucocorticoids ( Cushing ' s syndrome ) . Type II corticosteroid receptors are not reduced by excess of endogenous corticosteroids ( Cushing ' s syndrome ) .", + "output": [ + "122200000000000000000000000001222000000000000000" + ] + }, + { + "input": "In normal adults there is a direct significant correlation between plasma cortisol and Type I and between plasma cortisol and Type II receptors in mononuclear leukocytes , while in Cushing ' s syndrome the correlation is inverse between plasma cortisol at 8 a . m . and Type II receptors .", + "output": [ + "000000000000012000001220000000000000000000000001220" + ] + }, + { + "input": "In an aged population the mean numbers of Type I and of Type II receptors are lower and plasma cortisol is higher than in adult controls , but the increase of plasma cortisol is not followed by a clinical picture of hypercorticism .", + "output": [ + "0000000012001220000000000000000000000000000" + ] + }, + { + "input": "After dexamethasone suppression ( 1 mg at 11 p . m . ) Type I receptors always decrease in controls while the response of Type II is not homogeneous .", + "output": [ + "000000000000012200000000120000" + ] + }, + { + "input": "In an aged group of patients , both receptors are reduced by dexamethasone .", + "output": [ + "00000000000000" + ] + }, + { + "input": "We conclude that the decrease with age of corticosteroid receptors is possibly related to a physiological involution of corticosteroid receptors and that this reduction does increase plasma cortisol concentration , without affecting the glucocorticoid effector mechanism .", + "output": [ + "0000000012000000001200000000000000000" + ] + }, + { + "input": "All - trans retinoic acid ( RA ) induces differentiation of HL60 cells to neutrophils and is used to treat acute promyelocytic leukemia .", + "output": [ + "000000000000000000000000" + ] + }, + { + "input": "We observed that RA did not induced neutrophil differentiation in serum - free grown HL60 cells whereas 50 nM 1 alpha , 25 - dihydroxyvitamin D3 ( D3 ) induced maximal monocyte differentiation .", + "output": [ + "0000000000000000000000000000000000" + ] + }, + { + "input": "Increasing RA concentrations reduced the D3 concentration required for monocyte differentiation .", + "output": [ + "000000000000" + ] + }, + { + "input": "Cells treated with 5 nM D3 showed little response , but differentiated maximally with 5 nM D3 and 10 nM RA .", + "output": [ + "0000000000000000000000" + ] + }, + { + "input": "The D3 analogs MC903 , EB1089 and KH1060 were more potent inducers of monocyte differentiation .", + "output": [ + "0000000000000000" + ] + }, + { + "input": "The extent to which analog activity was increased after cotreatment with RA was inversely related to potency .", + "output": [ + "000000000000000000" + ] + }, + { + "input": "Twenty - four hour treatment with 10 nM RA primed cells for response to 5 nM D3 ; the reverse sequence being ineffective .", + "output": [ + "000000000000000000000000" + ] + }, + { + "input": "Priming with 10 nM RA , or subsequent treatment with D3 ( 5 nM ) , did not alter expression of mRNAs encoding receptors for D3 ( VDR ) , RA ( RAR alpha ) or 9 - CIS RA ( RXR alpha , beta , gamma ) .", + "output": [ + "0000000000000000000001010001000012000000012222200" + ] + }, + { + "input": "[ An overexpression of retinoic acid receptor alpha blocks myeloid cell differentiation at the promyelocyte stage ]", + "output": [ + "00001222000000000" + ] + }, + { + "input": "Retinoic acid ( RA ) , a vitamin A derivative , exerts a wide range of biological effects related to cell proliferation and differentiation .", + "output": [ + "0000000000000000000000000" + ] + }, + { + "input": "The pleiotropic effects of RA are thought to be mediated through specific nuclear RA receptors ( RARs ) .", + "output": [ + "0000000000000120100" + ] + }, + { + "input": "RARs are members of the steroid / thyroid hormone receptor superfamily and exhibit a molecular structure that possess discrete DNA - binding and RA ( ligand ) - binding domains .", + "output": [ + "1000012222200000000000012222220" + ] + }, + { + "input": "In hematopoietic system , RA and RARs , predominantly RAR alpha may play key roles for the proliferation and differentiation of hematopoietic progenitors .", + "output": [ + "000000100120000000000000" + ] + }, + { + "input": "However , it is currently unknown how RA and RARs are involved in regulating normal hematopoietic differentiation .", + "output": [ + "000000000100000000" + ] + }, + { + "input": "To make clear the roles of RA and RAR alpha in the normal hematopoiesis , I have introduced the construct of human RAR alpha ( hRAR alpha ) into murine bone marrow cells with retroviral vector , and selected infected cells with drug resistant marker ( Neo ( r ) ) cultured on the stroma cell line ( PA6 - neo ) , and analyzed the behavior of infected cells .", + "output": [ + "00000000120000000000012201200000000000000012201222000000000000000000000" + ] + }, + { + "input": "All of procedure were done in vitro .", + "output": [ + "00000000" + ] + }, + { + "input": "Most cells infected with hRAR alpha exhibited promyelocytic morphology and were thought to be blocked at the promyelocytic stage in their myeloid differentiation .", + "output": [ + "000012000000000000000000" + ] + }, + { + "input": "Furthermore , these immature cells differentiated terminally into mature granulocytes by adding with RA ( 10 ( - 6 ) M ) .", + "output": [ + "00000000000000000000000" + ] + }, + { + "input": "RAR alpha infected cells were also able to differentiate into mature macrophages in the both of long term culture and IL3 colony .", + "output": [ + "12000000000000000000000" + ] + }, + { + "input": "These observations suggest that an overexpression of RAR alpha alone is effective to suppress myeloid cell differentiation and RAR alpha plays a crucial role in the terminal differentiation of myeloid precursors .", + "output": [ + "00000001200000000012000000000000" + ] + }, + { + "input": "The system described here may serve as a model for studying the the essential genes for differentiation of normal bone marrow cells .", + "output": [ + "00000000000001200000000" + ] + }, + { + "input": "Hypoxic induction of interleukin - 8 gene expression in human endothelial cells .", + "output": [ + "0001222000000" + ] + }, + { + "input": "Because leukocyte - mediated tissue damage is an important component of the pathologic picture in ischemia / reperfusion , we have sought mechanisms by which PMNs are directed into hypoxic tissue .", + "output": [ + "00000000000000000000000000000000" + ] + }, + { + "input": "Incubation of human endothelial cells ( ECs ) in hypoxia , PO2 approximately 14 - 18 Torr , led to time - dependent release of IL - 8 antigen into the conditioned medium ; this was accompanied by increased chemotactic activity for PMNs , blocked by antibody to IL - 8 .", + "output": [ + "0000000000000000000000000122000000000000000000001220" + ] + }, + { + "input": "Production of IL - 8 by hypoxic ECs occurred concomitantly with both increased levels of IL - 8 mRNA , based on polymerase chain reaction analysis , and increased IL - 8 transcription , based on nuclear run - on assays .", + "output": [ + "001220000000000122200000000001220000000000" + ] + }, + { + "input": "Northern analysis of mRNA from hypoxic ECs also demonstrated increased levels of mRNA for macrophage chemotactic protein - 1 , another member of the chemokine superfamily of proinflammatory cytokines .", + "output": [ + "000000000000101222200000120120" + ] + }, + { + "input": "IL - 8 gene induction was associated with the presence of increased binding activity in nuclear extracts from hypoxic ECs for the NF - kB site .", + "output": [ + "122200000000000000000000000" + ] + }, + { + "input": "Studies with human umbilical vein segments exposed to hypoxia also demonstrated increased elaboration of IL - 8 antigen compared with normoxic controls .", + "output": [ + "00000000000000122200000" + ] + }, + { + "input": "In mice exposed to hypoxia ( PO2 approximately 30 - 40 Torr ) , there was increased pulmonary leukostasis , as evidenced by increased myeloperoxidase activity in tissue homogenates .", + "output": [ + "000000000000000000000000100000" + ] + }, + { + "input": "In parallel , increased levels of transcripts for IP - 10 , a murine homologue in the chemokine family related to IL - 8 , were observed in hypoxic lung tissue .", + "output": [ + "00000000122000000120012200000000" + ] + }, + { + "input": "Taken together , these data suggest that hypoxia constitutes a stimulus for leukocyte chemotaxis and tissue leukostasis .", + "output": [ + "000000000000000000" + ] + }, + { + "input": "Thrombin stimulation of the T leukemic cell line Jurkat induced a transient increase in [ Ca2 + ] i .", + "output": [ + "10000000000000000000" + ] + }, + { + "input": "Proteolytic activity of the enzyme was required for this effect since diisopropyl fluorophosphate - thrombin failed to increase [ Ca2 + ] i .", + "output": [ + "000010000001222000000000" + ] + }, + { + "input": "Furthermore , hirudin and anti - thrombin III inhibited the thrombin - induced [ Ca2 + ] i rise in Jurkat T cells .", + "output": [ + "000012220000000000000000" + ] + }, + { + "input": "A synthetic thrombin receptor agonist peptide ( TRP ) of 7 residues ( SFLLRNP ) was found to be as effective as thrombin for [ Ca2 + ] i mobilization , and both agonists induced Ca2 + release exclusively from internal stores .", + "output": [ + "0012000000000000000000100000000000000000000" + ] + }, + { + "input": "Thrombin stimulated tyrosine phosphorylation of several proteins of molecular mass 40 , 42 , 70 , 120 , and 130 kDa .", + "output": [ + "1000000012222222222220" + ] + }, + { + "input": "Thrombin and TRP also caused translocation of protein kinase C from the cytosol to the plasma membrane .", + "output": [ + "100000012200000000" + ] + }, + { + "input": "As a likely consequence of these events , thrombin activated the nuclear factor NF - kB .", + "output": [ + "00000000100122220" + ] + }, + { + "input": "Several cell lines of hematopoietic origin including the leukemic T cell line HPB . ALL and the erythroleukemic cell line K562 were responsive to thrombin , whereas others such as THP1 , a myelomonocytic cell line , and BL2 , a Burkitt lymphoma were refractory to thrombin or TRP stimulation .", + "output": [ + "000000000000000000000000100000000000000000000010000" + ] + }, + { + "input": "The magnitude of the thrombin response in the different cell types paralleled the expression of the thrombin receptor mRNA .", + "output": [ + "00001000000000001220" + ] + }, + { + "input": "We found that activation of Jurkat T cells by a combination of phytohemagglutinin and phorbol 12 - myristate 13 - acetate led to a dramatic inhibition of thrombin receptor mRNA expression and to a concomitant loss of the thrombin response .", + "output": [ + "00000000000010000000000000012200000000100" + ] + }, + { + "input": "Finally , we demonstrate that thrombin and TRP enhanced CD69 expression and interleukin 2 production induced by T cell receptor cross - linking in both Jurkat T cells and peripheral blood lymphocytes .", + "output": [ + "000001000100120001220000000000000" + ] + }, + { + "input": "These findings highlight the role of thrombin as a potential regulator of T lymphocyte activation .", + "output": [ + "0000001000000000" + ] + }, + { + "input": "A second feature of senescent T cells is the dramatic reduction in hsp70 production in response to heat shock .", + "output": [ + "00000000000010000000" + ] + }, + { + "input": "This decline is associated with a decrease in binding of nuclear extracts to the consensus heat shock element .", + "output": [ + "0000000000000012220" + ] + }, + { + "input": "This suggests that for senescent T cells the reduced ability to respond to heat shock by producing hsp70 , although possibly lying at the level of transcriptional control , may nevertheless be unrelated to the reduced DNA synthesis or the diminished proliferative activity also manifested by these cells .", + "output": [ + "0000000000000000010000000000000000000000000000000" + ] + }, + { + "input": "Involvement of phospholipase D in the activation of transcription factor AP - 1 in human T lymphoid Jurkat cells .", + "output": [ + "00120000122220000000" + ] + }, + { + "input": "The induction of the AP - 1 transcription factor has been ascribed to the early events leading to T lymphocyte activation .", + "output": [ + "0000122120000000000000" + ] + }, + { + "input": "We have examined the possibility that stimulation of phospholipase D ( PLD ) may regulate activation of transcription factor AP - 1 in human T cells by transfecting human T lymphocyte Jurkat cells with a plasmid containing an AP - 1 enhancer element and a chloramphenicol acetyltransferase reporter gene .", + "output": [ + "00000000120100000122220000000000000000122220012220" + ] + }, + { + "input": "We have detected activatable PLD in Jurkat cells , and we have found that addition of phosphatidic acid ( PA ) , the physiologic product of PLD action on phospholipids , is rapidly incorporated into Jurkat cells and leads to activation of transcription factor AP - 1 .", + "output": [ + "000010000000000000000000001000000000000000122220" + ] + }, + { + "input": "Treatment of Jurkat cells with anti - CD3 mAb activated both PLD and transcription factor AP - 1 .", + "output": [ + "0000012220010122220" + ] + }, + { + "input": "Furthermore , ethanol , an inhibitor of the PLD pathway , blocked the anti - CD3 - stimulated AP - 1 enhancer activity .", + "output": [ + "000000001000000000122200" + ] + }, + { + "input": "However , this anti - CD3 - mediated response was not inhibited by neomycin , an inhibitor of phosphoinositide hydrolysis .", + "output": [ + "000122000000000000000" + ] + }, + { + "input": "The increases in AP - 1 enhancer activity induced by PA or anti - CD3 mAb were efficiently abrogated by the presence of propranolol , an inhibitor of PA phosphohydrolase and protein kinase C ( PKC ) .", + "output": [ + "00012220000012220000000000000101220100" + ] + }, + { + "input": "Furthermore , the PA - and the anti - CD3 - induced increases in AP - 1 enhancer activity were blocked by the presence of PKC inhibitors or by PKC down - regulation .", + "output": [ + "0000000122000012220000000100010000" + ] + }, + { + "input": "These data indicate that PLD stimulation can activate the transcription factor AP - 1 in T lymphocytes , and suggest that the induction of AP - 1 enhancer factor activity by PA is mediated via PKC stimulation , either through a direct activating effect of PA or through PA - derived diacylglycerol formation .", + "output": [ + "000010000122220000000000122200000001000000000000000000" + ] + }, + { + "input": "These data also provide evidence for a role of PLD - derived lipids in the induction of AP - 1 enhancer activity resulting from stimulation of the TCR / CD3 complex , suggesting that increased PLD activity can play an important role in T lymphocyte activation .", + "output": [ + "00000000010000000122200000012220000100000000000" + ] + }, + { + "input": "Upregulation of bcl - 2 by the Epstein - Barr virus latent membrane protein LMP1 : a B - cell - specific response that is delayed relative to NF - kappa B activation and to induction of cell surface markers .", + "output": [ + "00122001222222100000000000001222000001220" + ] + }, + { + "input": "An ability of the Epstein - Barr virus latent membrane protein LMP1 to enhance the survival of infected B cells through upregulation of the bcl - 2 oncogene was first suggested by experiments involving gene transfection and the selection of stable LMP1 + clones ( S . Henderson , M . Rowe , C . Gregory , F . Wang , E . Kieff , and A . Rickinson , Cell 65 : 1107 - 1115 , 1991 ) .", + "output": [ + "00001222222100000000000012220000000000000000000000000000000000000000000000000000" + ] + }, + { + "input": "However , it was not possible to ascertain whether Bcl - 2 upregulation was a specific consequence of LMP1 expression or an artifact of the selection procedure whereby rare Bcl - 2 + cells already present in the starting population might best be able to tolerate the potentially toxic effects of LMP1 .", + "output": [ + "00000000012200000010000000000000000000000000000000010" + ] + }, + { + "input": "In the first approach , stable clones of two B - cell lines carrying an LMP1 gene under the control of an inducible metallothionein promoter were induced to express LMP1 in all cells .", + "output": [ + "0000000000000001000000012000010000" + ] + }, + { + "input": "Activation of NK - kappa B and upregulation of ICAM - 1 occurred within 24 h and were followed at 48 to 72 h by upregulation of Bcl - 2 .", + "output": [ + "0012220001220000000000000001220" + ] + }, + { + "input": "All six B - cell lines tested showed NF - kappa B activation in response to LMP1 expression , and this was followed in five of six lines by expression of ICAM - 1 and Bcl - 2 .", + "output": [ + "000000001222000010000000000000012201220" + ] + }, + { + "input": "We therefore conclude that Bcl - 2 upregulation is part of the panoply of cellular changes induced by LMP1 but that the effect is cell type specific .", + "output": [ + "0000122000000000001000000000" + ] + }, + { + "input": "Our data also suggest that whilst NF - kappa B may be an essential component of LMP1 signal transduction , other cell - specific factors may be required to effect some functions of the viral protein .", + "output": [ + "0000001222000000100001222000000000120" + ] + }, + { + "input": "Long - term inositol phosphate release , but not tyrosine kinase activity , correlates with IL - 2 secretion and NF - AT induction in anti - CD3 - activated peripheral human T lymphocytes .", + "output": [ + "00000000012000012200122000000000000" + ] + }, + { + "input": "The cascade of events within the first few minutes of T cell stimulation has been well characterized .", + "output": [ + "000000000000000000" + ] + }, + { + "input": "Although many second messengers have been shown to be necessary and sufficient for T cell activation in a number of model systems , the rate - limiting step in peripheral T cells has not been demonstrated .", + "output": [ + "0000000000000000000000000000000000000" + ] + }, + { + "input": "To model effective versus ineffective CD3 - mediated stimulation in peripheral T cells , we used two anti - CD3 mAbs that differ in their ability to stimulate purified T cells : OKT3 , which causes early second messenger generation but is unable to activate T cells without a second signal , and 64 . 1 , which stimulates T cell proliferation on its own .", + "output": [ + "000001000000000001222000000000001000000000000000000001220000000000" + ] + }, + { + "input": "However , only 64 . 1 induced NF - AT in the nucleus , correlating with its ability to activate T cells .", + "output": [ + "00012201220000000000000" + ] + }, + { + "input": "Thus , NF - AT induction and IL - 2 secretion were correlated with the levels of inositol phosphate release but not with gross levels of tyrosine kinase activity induced late following the response .", + "output": [ + "00122001220000000000000000120000000" + ] + }, + { + "input": "On the other hand , NF - kappa B induction and IL - 2 receptor expression occurred even with the smaller second messenger response generated by OKT3 .", + "output": [ + "0000012220012200000000000010" + ] + }, + { + "input": "HLA - DR - , CD33 + , CD56 + , CD16 - myeloid / natural killer cell acute leukemia : a previously unrecognized form of acute leukemia potentially misdiagnosed as French - American - British acute myeloid leukemia - M3 [ see comments ]", + "output": [ + "000000000000000000000000000000000000000000000" + ] + }, + { + "input": "We have identified and characterized a previously unrecognized form of acute leukemia that shares features of both myeloid and natural killer ( NK ) cells .", + "output": [ + "00000000000000000000000000" + ] + }, + { + "input": "Multicolor flow cytometric assays confirmed the coexpression of myeloid ( CD33 , CD13 , CD15 ) and NK cell - associated ( CD56 ) antigens in each case , whereas reverse transcription polymerase chain reaction ( RT - PCR ) assays confirmed the identity of CD56 ( neural cell adhesion molecule ) in leukemic blasts .", + "output": [ + "00000000122222222222222220000000000000000000010122200000" + ] + }, + { + "input": "Although two cases expressed CD4 , no case expressed CD2 , CD3 , or CD8 and no case showed clonal rearrangement of genes encoding the T - cell receptor ( TCR beta , gamma , delta ) .", + "output": [ + "00001000010100100000000001222012222200" + ] + }, + { + "input": "Leukemic blasts in the majority of cases shared unique morphologic features ( deeply invaginated nuclear membranes , scant cytoplasm with fine azurophilic granularity , and finely granular Sudan black B and myeloperoxidase cytochemical reactivity ) that were remarkably similar to those of acute promyelocytic leukemia ( APL ) ; particularly the microgranular variant ( FAB AML - M3v ) .", + "output": [ + "000000000000000000000000000000010000000000000000000120122200" + ] + }, + { + "input": "However , all 20 cases lacked the t ( 15 ; 17 ) and 17 cases tested lacked the promyelocytic / retinoic acid receptor alpha ( RAR alpha ) fusion transcript in RT - PCR assays ; 12 cases had 46 , XX or 46 , XY karyotypes , whereas 2 cases had abnormalities of chromosome 17q : 1 with del ( 17 ) ( q25 ) and the other with t ( 11 ; 17 ) ( q23 ; q21 ) and the promyelocytic leukemia zinc finger / RAR alpha fusion transcript .", + "output": [ + "0000000000000000000122222222222000000000000000000000000120001222222000012222222222001222222220" + ] + }, + { + "input": "All cases tested ( 6 / 20 ) , including the case with t ( 11 ; 17 ) , failed to differentiate in vitro in response to all - trans retinoic acid ( ATRA ) , suggesting that these cases may account for some APLs that have not shown a clinical response to ATRA .", + "output": [ + "00000000000001222220000000000000000000000000000000000000" + ] + }, + { + "input": "Four of 6 cases tested showed functional NK cell - mediated cytotoxicity , suggesting a relationship between these unique CD33 + , CD56 + , CD16 - acute leukemias and normal CD56 + , CD16 - NK precursor cells .", + "output": [ + "0000000000000000000000000100000000000000" + ] + }, + { + "input": "Using a combination of panning and multiparameter flow cytometric sorting , we identified a normal CD56 + , CD33 + , CD16 - counterpart cell at a frequency of 1 % to 2 % in the peripheral blood of healthy individuals .", + "output": [ + "000000000000000000000000000000000000000000" + ] + }, + { + "input": "Our studies suggest that this form of acute leukemia may arise from transformation of a precursor cell common to both the myeloid and NK cell lineages ; thus we propose the designation myeloid / NK acute leukemia .", + "output": [ + "00000000000000000000000000000000000000" + ] + }, + { + "input": "Recognition of this new leukemic entity will be important in distinguishing these ATRA - nonresponsive cases from ATRA - responsive true APL .", + "output": [ + "00000000000000000000000" + ] + }, + { + "input": "IL - 4 down - regulates IL - 2 - , IL - 3 - , and GM - CSF - induced cytokine gene expression in peripheral blood monocytes .", + "output": [ + "122000122001220001220000000000" + ] + }, + { + "input": "IL - 4 , a product of the T - helper 0 ( Th0 ) and 2 ( Th2 ) subset , was originally described as a B - cell stimulatory factor and has subsequently been found to suppress IL - 1 alpha , IL - 1 beta , IL - 6 , IL - 8 , and TNF - alpha gene expression in monocytes stimulated with LPS , and to upregulate IL - 1 receptor antagonist ( IL1 - RA ) gene expression .", + "output": [ + "1220000000000000000000000001222200000000000000000000000000000000000000001222222222200" + ] + }, + { + "input": "In this study we investigated the effect of IL - 4 on the expression of cytokine genes in monocytes evoked by other T - helper cell cytokines : IL - 2 , IL - 3 , and GM - CSF .", + "output": [ + "00000000122000012000001222201220122001220" + ] + }, + { + "input": "IL - 4 down - regulated mRNA accumulation of the proinflammatory cytokines IL - 1 beta , IL - 8 , and TNF - alpha in monocytes stimulated with IL - 2 , IL - 3 , and GM - CSF .", + "output": [ + "122000000012122201220012200001220122001220" + ] + }, + { + "input": "IL - 4 also suppressed the IL - 2 - induced IL - 6 mRNA expression .", + "output": [ + "12200012200122000" + ] + }, + { + "input": "Temporal analysis of the IL - 4 down - regulatory effect on the IL - 2 - , IL - 3 - , or GM - CSF - induced proinflammatory cytokine gene expression in monocytes provided evidence that IL - 4 acts predominantly on the post - transcriptional level .", + "output": [ + "00001220000000000000000000000000000000122000000000" + ] + }, + { + "input": "IL - 4 did not exert significant influence on the induction of expression of IL - 1 - RA or various CSFs by IL - 2 , IL - 3 , and GM - CSF .", + "output": [ + "122000000000001222200101220122001220" + ] + }, + { + "input": "Induction of proto - oncogene and cytokine expression in human peripheral blood monocytes and the monocytic cell line THP - 1 after stimulation with mycoplasma - derived material MDHM .", + "output": [ + "001220100000000000000000000000" + ] + }, + { + "input": "Mycoplasma fermentans - derived high - molecular - weight material ( MDHM ) was originally described to induce differentiation of murine thymocytes to cytolytic effector T - cells by stimulating IL - 6 release from adherent cells .", + "output": [ + "00000000000000000000000000000012200000" + ] + }, + { + "input": "This study shows that human peripheral blood monocytes ( PBMo ) also respond to MDHM with increases in IL - 1 beta , IL - 6 and TNF alpha expression , both at the mRNA and protein level .", + "output": [ + "000000000000000000122201220120000000000" + ] + }, + { + "input": "The induced expression of IL - 1 beta and TNF alpha mRNA in the monocytic THP - 1 cell line increased as quickly as in primary cells .", + "output": [ + "0000122222220000000000000000" + ] + }, + { + "input": "In contrast to PBMo , THP - 1 and 14 other monocytic / myeloid leukemia - derived cell lines did not secrete measurable amounts of the cytokines upon treatment with MDHM .", + "output": [ + "00000000000000000000000000100000" + ] + }, + { + "input": "IL - 1 beta and IL - 6 genes contain AP - 1 binding sites as regulatory elements , the AP - 1 protein being composed of c - jun and c - fos gene products .", + "output": [ + "1222222220122220120012200001222222220" + ] + }, + { + "input": "In THP - 1 cells c - jun mRNA expression increased after incubation with MDHM while positive c - fos expression remained unaffected .", + "output": [ + "000001222000000001220000" + ] + }, + { + "input": "In the primary cells MDHM - induced elevation of cytokine mRNA levels was preceded by a downregulation of c - fos expression while positive c - jun expression was not modulated .", + "output": [ + "00000000012000000012200012200000" + ] + }, + { + "input": "c - myc mRNA expression , constitutively high in THP - 1 cells , was induced in MDHM - stimulated PBMo .", + "output": [ + "1222000000000000000000" + ] + }, + { + "input": "In conclusion , MDHM - stimulated induction of cytokine mRNA expression was accompanied by different proto - oncogene responses in PBMo and THP - 1 cells .", + "output": [ + "000000001200000122000000000" + ] + }, + { + "input": "Alternatively , these data support the notion that neither AP - 1 nor the c - myc protein are involved in the MDHM - induced increase in IL - 1 beta , IL - 6 or TNF alpha mRNA levels .", + "output": [ + "00000000012200122200000000000000000000000" + ] + }, + { + "input": "Fast in vitro effects of aldosterone on the Na + / H ( + ) - exchanger , inositoltrisphosphat generation and corresponding specific binding to plasma membranes at Kd - values of approximately 0 . 1 nM have been found in human mononuclear leukocytes and vascular smooth muscle cells .", + "output": [ + "00000000122222222000000000000000000000000000000000" + ] + }, + { + "input": "This aldosterone - selectivity is typical and discriminatory for the new aldosterone membrane receptor .", + "output": [ + "000000000001220" + ] + }, + { + "input": "Solubilization of the receptor protein from membranes by high salt concentrations ( 1 M NaCl , 1 mM EDTA ) was not achieved .", + "output": [ + "000120000000000000000000" + ] + }, + { + "input": "Dithiothreitol , a sulfhydryl agent , does not reduce specific aldosterone binding indicating the absence of SH - groups in the binding domain or sensitive structures of the receptors .", + "output": [ + "000000000000000012200120000000" + ] + }, + { + "input": "The results are the first to characterize the novel membrane receptor for aldosterone with regard to molecular weight and basic properties .", + "output": [ + "0000000012200000000000" + ] + }, + { + "input": "These findings and other related results are reviewed here .", + "output": [ + "0000000000" + ] + }, + { + "input": "A transcriptional regulatory element is associated with a nuclease - hypersensitive site in the pol gene of human immunodeficiency virus type 1 .", + "output": [ + "01220000122200120000000" + ] + }, + { + "input": "In the present report , high - resolution mapping of this site with DNase I and micrococcal nuclease identified a nucleosome - free region centered around nucleotides ( nt ) 4490 to 4766 .", + "output": [ + "0000000000000120120012220012222220" + ] + }, + { + "input": "A 500 - bp fragment encompassing this hypersensitive site ( nt 4481 to 4982 ) exhibited transcription - enhancing activity ( two - to threefold ) when it was cloned in its natural position with respect to the HIV - 1 promoter after transient transfection in U937 and CEM cells .", + "output": [ + "012220012012220000000000000000000000001222000000000" + ] + }, + { + "input": "Using in vitro footprinting and gel shift assays , we have identified four distinct binding sites for nuclear proteins within this positive regulatory element .", + "output": [ + "0000000000000012012001220" + ] + }, + { + "input": "Site B ( nt 4519 to 4545 ) specifically bound four distinct nuclear protein complexes : a ubiquitous factor , a T - cell - specific factor , a B - cell - specific factor , and the monocyte / macrophage - and B - cell - specific transcription factor PU . 1 / Spi - 1 .", + "output": [ + "1201222000001220012001222220012222200012222222222212222220" + ] + }, + { + "input": "In most HIV - 1 isolates in which this PU box was not conserved , it was replaced by a binding site for the related factor Ets1 .", + "output": [ + "0000000001200000000012000010" + ] + }, + { + "input": "Factors binding to site C ( nt 4681 to 4701 ) had a DNA - binding specificity similar to that of factors binding to site B , except for PU . 1 / Spi - 1 .", + "output": [ + "0001201222000000000000001200012222220" + ] + }, + { + "input": "A GC box containing a binding site for Sp1 was identified ( nt 4623 to 4631 ) .", + "output": [ + "012001201000122200" + ] + } + ] +} diff --git a/tasks/task1700_jnlpba_entity_counting.json b/tasks/task1700_jnlpba_entity_counting.json new file mode 100644 index 000000000..1582c0cca --- /dev/null +++ b/tasks/task1700_jnlpba_entity_counting.json @@ -0,0 +1,1851 @@ +{ + "Contributors": [ + "Sagar Rudagi" + ], + "Source": [ + " JNLPBA (https://huggingface.co/datasets/jnlpba)" + ], + "Input_language": [ + "English" + ], + "Output_language": [ + "English" + ], + "Instruction_language": [ + "English" + ], + "Categories": [ + "Entity Counting" + ], + "Definition": "In this task, a sentence will be provided along with the classified tokens in a string. The token string contains '0','1' and '2' where '0' corresponds to Non-bio entity, '1' to Bio entity start token, and '2' to Subsequent bio entity tokens. The output should contain the numbers Bio entities which correspond to '1'. Each word in the sentence is called as token.", + "Positive Examples": [ + { + "input": "Tokens: IL - 2 gene expression and NF - kappa B activation through CD28 requires reactive oxygen production by 5 - lipoxygenase . \nClassified Tokens List: 1 2 2 2 0 0 1 2 2 2 0 0 1 0 0 0 0 0 1 2 2 0", + "output": "0", + "explanation": "This is a good example. It returns the correct amount of bio entities." + }, + { + "input": "Tokens: Activation of the CD28 surface receptor provides a major costimulatory signal for T cell activation resulting in enhanced production of interleukin - 2 ( IL - 2 ) and cell proliferation . \nClassified Tokens List: 0 0 0 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 1 2 2 0 0 0 0 0", + "output": "0", + "explanation": "This is a good example. It returns the correct amount of bio entities." + }, + { + "input": "Tokens: In primary T lymphocytes we show that CD28 ligation leads to the rapid intracellular formation of reactive oxygen intermediates ( ROIs ) which are required for CD28 - mediated activation of the NF - kappa B / CD28 - responsive complex and IL - 2 expression . \nClassified Tokens List: 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 2 2 2 0 1 2 2 2 0 1 2 2 0 0", + "output": "0", + "explanation": "This is a good example. It returns the correct amount of bio entities." + } + ], + "Negative Examples": [ + { + "input": "Tokens: Delineation of the CD28 signaling cascade was found to involve protein tyrosine kinase activity , followed by the activation of phospholipase A2 and 5 - lipoxygenase . \nClassified Tokens List: 0 0 0 1 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0 1 2 0 1 2 2 0", + "output": "0", + "explanation": "This is a bad example. The output should only be a number and not a list" + }, + { + "input": "Tokens: These findings should be useful for therapeutic strategies and the development of immunosuppressants targeting the CD28 costimulatory pathway . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0", + "output": "One", + "explanation": "This is a bad example. Output should be numerical and should not contain words." + }, + { + "input": "Tokens: The peri - kappa B site mediates human immunodeficiency virus type 2 enhancer activation in monocytes but not in T cells . \nClassified Tokens List: 0 1 2 2 2 2 0 1 2 2 2 2 2 0 0 0 0 0 0 0 0 0", + "output": "0", + "explanation": "This is a bad example. The bio entity starting token and the subsequent tokens are taken separately whereas they belong to one single entity." + } + ], + "Instances": [ + { + "input": "Tokens: The predicted protein sequence of B1 is 81 % identical to human matrix metalloproteinase 9 ( MMP9 ) , demonstrating that it is the bovine homologue of this enzyme . \nClassified Tokens List: 0 0 0 0 0 1 0 0 0 0 0 0 1 2 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: RNAase protection assays demonstrated that the MMP9 activity , unique to infected cells , is due to increased MMP9 mRNA levels . \nClassified Tokens List: 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: We also assayed the levels of transcription factor AP - 1 and demonstrated that it was constitutively present in increased amounts in Theileria - infected cells . \nClassified Tokens List: 0 0 0 0 0 0 1 2 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Since AP - 1 is implicated in the control of the cell cycle , and MMP9 can confer metastatic properties , these results are of considerable significance with respect to the transformed phenotype induced by Theileria infection . \nClassified Tokens List: 0 1 2 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: B - cell proliferation and induction of early G1 - regulating proteins by Epstein - Barr virus mutants conditional for EBNA2 . \nClassified Tokens List: 0 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0 0 1 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Infection of primary B - lymphocytes by Epstein - Barr virus ( EBV ) leads to growth transformation of these B - cells in vitro . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: EBV nuclear antigen 2 ( EBNA2 ) , one of the first genes expressed after EBV infection of B - cells , is a transcriptional activator of viral and cellular genes and is essential for the transforming potential of the virus . \nClassified Tokens List: 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Growth transformation of primary normal B - cells by mutant virus resulted in estrogen - dependent lymphoblastoid cell lines expressing the chimeric EBNA2 protein . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In the absence of estrogen about half of the cells enter a quiescent non - proliferative state whereas the others die by apoptosis . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: EBNA2 is thus required not only for initiation but also for maintenance of transformation . \nClassified Tokens List: 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Growth arrest occurred at G1 and G2 stages of the cell cycle , indicating that functional EBNA2 is required at different restriction points of the cell cycle . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Growth arrest is reversible for G1 / G0 cells as indicated by the sequential accumulation and modification of cell cycle regulating proteins . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: EBV induces the same cell cycle regulating proteins as polyclonal stimuli in primary B - cells . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: IL - 1 receptor and TCR signals synergize to activate NF - kappa B - mediated gene transcription . \nClassified Tokens List: 1 2 2 2 0 1 0 0 0 0 1 2 2 2 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Previous studies have demonstrated that IL - 1 receptor ( IL - 1R ) - and TCR - initiated signals can interact synergistically to increase the rate of transcription of several lymphokine and lymphokine receptor genes during the competence phase of the activation program in T helper lymphocytes . \nClassified Tokens List: 0 0 0 0 0 1 2 2 2 0 1 2 2 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In this report we describe how signals initiated through the type I IL - 1R interact with signals from the antigen receptor to synergistically augment the transactivating properties of NF - kappa B . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Gel shift analyses demonstrate that NF - kappa B nuclear translocation is stimulated primarily by IL - 1 rather than by antigen receptor signals . \nClassified Tokens List: 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 1 2 2 0 0 0 1 2 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Western blot and phosphorylation analyses demonstrate that the synergistic effect on NF - kappa B functional activity is independent of I kappa B alpha ( MAD3 ) - NF - kappa B dissociation in the cytosol and is not associated with I kappa B nuclear translocation . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 1 2 2 2 0 1 0 0 1 2 2 2 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: These results suggest that IL - 1 induces both NF - kappa B nuclear translocation and the synthesis of a protein ( s ) responsible for terminating NF - kappa B - DNA interaction in the nucleus . \nClassified Tokens List: 0 0 0 0 1 2 2 0 0 1 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Antigen receptor signals prolong NF - kappa B - DNA interaction , probably by functionally antagonizing the IL - 1 - induced synthesis of a protein ( s ) responsible for the transient NF - kappa B - DNA interaction and consequently synergistically enhance IL - 1 - induced NF - kappa B - dependent gene transcription . \nClassified Tokens List: 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0 1 2 2 0 0 1 2 2 2 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Identification of the promoter region of chicken anemia virus ( CAV ) containing a novel enhancer - like element . \nClassified Tokens List: 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The single promoter region in the cloned genome [ Noteborn et al . , J . Virol . 65 ( 1991 ) 3131 - 3139 ] of chicken anemia virus ( CAV ) in chicken T - cells was analysed via CAT assays . \nClassified Tokens List: 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: A unique region containing four or five near - perfect direct repeats ( DR ) of 21 bp with one 12 - bp insert was proven to be the main transcription - activation element , with enhancer - like characteristics . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: PCR studies revealed that CAV isolates from across the world all contained this promoter sequence . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Electrophoretic mobility - shift assays ( EMSA ) showed that individual DR units , as well as the 12 - bp insert , can bind to nuclear factors of chicken T - cells . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 1 2 2 2 0 0 0 0 1 2 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Competition assays revealed that the DR units bound to factors other than the 12 - bp insert . \nClassified Tokens List: 0 0 0 0 0 1 2 0 0 0 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Purified human SP1 was shown to have very strong affinity for the 12 - bp insert . \nClassified Tokens List: 0 1 2 0 0 0 0 0 0 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Previous studies using antisense oligonucleotides implicated the c - Myc protein in the phenomenon of activation - induced apoptosis . \nClassified Tokens List: 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: This role for c - Myc in apoptosis is now confirmed in studies using a dominant negative form of its heterodimeric binding partner , Max , which we show here inhibits activation - induced apoptosis . \nClassified Tokens List: 0 0 0 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Further , coexpression of a reciprocally mutant Myc protein capable of forming functional heterodimers with the mutant Max can compensate for the dominant negative activity and restore activation - induced apoptosis . \nClassified Tokens List: 0 0 0 0 0 1 2 2 2 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: These results imply that Myc promotes activation - induced apoptosis by obligatory heterodimerization with Max , and therefore , by regulating gene transcription . \nClassified Tokens List: 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Epstein - Barr virus SM protein . \nClassified Tokens List: 1 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The protein products of the Epstein - Barr virus ( EBV ) BMLF1 open reading frame have been characterized in the early productive cycle in B95 - 8 and Akata cells . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The SM protein derived from the spliced RNA joining BSLF2 to BMLF1 is much the most abundant protein . \nClassified Tokens List: 0 1 2 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: SM is a phosphoprotein in EBV - infected cells and can be phosphorylated in vitro with casein kinase II ( CKII ) . \nClassified Tokens List: 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 1 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Site - directed mutagenesis of the consensus CKII site in EBV SM greatly reduced the in vitro phosphorylation of SM by CKII . \nClassified Tokens List: 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0 0 0 0 1 0 1 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The mechanism of transactivation by BMLF1 proteins has been controversial but SM was shown to transactivate gene expression from a CAT reporter construct by increasing the amount of cytoplasmic CAT mRNA . \nClassified Tokens List: 0 0 0 0 0 1 2 0 0 0 0 1 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 1 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Inducible binding to the c - fos serum response element during T cell activation is regulated by a phosphotyrosine - containing protein . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Fos expression may be a pivotal event in converting ligand - receptor interactions at the membrane into functional modulation of cell phenotype . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: We show that an inducible protein complex ( Band A ) binds to SRE DNA within 10 min after mitogenic stimulation of human PBL - T , and becomes nondetectable by 60 min . \nClassified Tokens List: 0 0 0 0 0 1 2 0 1 2 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: A protein that is phosphorylated on a tyrosine residue in resting PBL - T suppresses binding of a component of Band A to the SRE motif . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 1 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Upon stimulation of the cells , this protein no longer prevents binding of DNA by Band A , and suppression of binding is restored within 30 min . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In vivo modification of major histocompatibility complex class II DRA promoter occupancy mediated by the AIR - 1 trans - activator . \nClassified Tokens List: 0 0 0 0 1 2 2 2 2 2 2 0 0 0 0 1 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: This locus encodes a transcriptional trans - activator required for the constitutive expression of major histocompatibility complex ( MHC ) class II genes . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Here we show , by in vivo DNase I footprinting , that the AIR - 1 locus defect correlates with changes in the DRA promoter occupancy . \nClassified Tokens List: 0 0 0 0 0 0 0 1 2 0 0 0 0 1 2 2 2 2 0 0 0 0 0 1 2 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Interestingly , reexpression of human MHC class II genes in RJ 2 . 2 . 5 x mouse spleen cell hybrids is associated with partial reversion of DRA promoter occupancy to the Raji pattern . \nClassified Tokens List: 0 0 0 0 1 2 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: DRA promoter occupancy in other class II - negative B cell lines , derived from patients with bare lymphocyte syndrome , is drastically different from the one observed in RJ 2 . 2 . 5 and Raji cells . \nClassified Tokens List: 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Moreover , the use of the DNase I as an in vivo footprinting agent reveals that the patients ' cell lines do not display a completely ` ` bare promoter ` ` as previously reported using dimethyl sulfate as the footprinting agent . \nClassified Tokens List: 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Regulation of cell - type - specific interleukin - 2 receptor alpha - chain gene expression : potential role of physical interactions between Elf - 1 , HMG - I ( Y ) , and NF - kappa B family proteins . \nClassified Tokens List: 0 0 0 0 0 0 0 1 2 2 2 2 2 2 0 0 0 0 0 0 0 0 0 1 2 2 0 1 2 2 2 2 2 0 0 1 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Previously , an inducible enhancer between nucleotides - 299 and - 228 that contains NF - kappa B and CArG motifs was identified . \nClassified Tokens List: 0 0 0 1 2 0 1 2 2 2 2 2 0 0 1 2 2 2 2 2 2 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: We now report the characterization of a second essential positive regulatory element located between nucleotides - 137 and - 64 that binds Elf - 1 and HMG - I ( Y ) . \nClassified Tokens List: 0 0 0 0 0 0 0 0 1 2 2 2 0 0 1 2 2 2 2 2 0 0 1 2 2 0 1 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Transcription from the IL - 2R alpha promoter was inhibited when either the Elf - 1 or the HMG - I ( Y ) binding site was mutated . \nClassified Tokens List: 0 0 0 1 2 2 2 2 0 0 0 0 0 1 2 2 2 2 2 2 2 2 2 2 2 2 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Coexpression of both proteins activated transcription of the - 137 to - 64 element in COS - 7 cells . \nClassified Tokens List: 0 0 0 0 0 0 0 0 1 2 2 2 2 2 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: This is the first report of a physical interaction between an Ets family member and NF - kappa B family proteins . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: These findings provide significant new insights into the protein - protein and protein - DNA interactions that regulate cell - type - specific and inducible IL - 2R alpha gene expression and also have implications for other genes regulated by Elf - 1 and NF - kappa B family proteins . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 1 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Isolation of cDNA clones for 42 different Kruppel - related zinc finger proteins expressed in the human monoblast cell line U - 937 . \nClassified Tokens List: 0 0 1 2 0 0 0 1 2 2 2 2 2 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: To study the complexity and structural characteristics of zinc finger proteins expressed during human hematopoiesis and to isolate novel regulators of blood cell development , a degenerate oligonucleotide probe specific for a consensus zinc finger peptide domain was used to isolate 63 cDNA clones for Kruppel - related zinc finger genes from the human monoblast cell line U - 937 . \nClassified Tokens List: 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 0 0 0 0 0 1 2 0 1 2 2 2 2 2 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: By extensive nucleotide sequence and Northern blot analysis , these cDNA clones were found to originate from approximately 42 different genes ( HZF 1 - 42 ) of which only 8 have previously been described . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The large number of individual genes represented among the 63 clones and their apparent non - cell - type - specific expression suggest that the majority of the Kruppel - related zinc finger genes are likely to be expressed in most human tissues . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In contrast , some of the genes displayed a restricted expression pattern , indicating that they represent potential regulators of monocyte differentiation or proliferation . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Detailed structural analysis of the first 12 cDNAs ( HZF 1 - 10 ) and a partial characterization of HZF 11 - 42 revealed that a common feature of human Kruppel - related zinc finger proteins is the presence of tandem arrays of zinc fingers ranging in number from 3 to over 20 that are preferentially located in the carboxy - terminal regions of the proteins . \nClassified Tokens List: 0 0 0 0 0 0 0 1 0 1 2 2 2 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 1 2 2 2 2 2 2 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In addition , several novel KRAB - containing zinc finger genes and a novel conserved sequence element were identified . \nClassified Tokens List: 0 0 0 0 0 1 2 2 2 2 2 0 0 0 1 2 2 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: CAG repeat length variation in sperm from a patient with Kennedy ' s disease . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Using a modified sperm typing protocol , the mutation frequency of the CAG repeat region at the androgen receptor locus has been measured using a rare semen sample from an individual with spinal and bulbar muscular atrophy ( SBMA ) . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The average expansion was 2 . 7 repeats . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: More than half of the expansions involved one or two repeats ; the largest was 11 repeats . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: 68 % of the contractions were also one or two repeats but six ( 16 % ) were very large ( 12 - 25 repeats ) . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: One contraction generated an allele in an intermediate size range ( 33 - 39 repeats ) . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Such alleles have not been observed among more than 900 normal and SBMA X - chromosomes that have been examined . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Comparison of the SBMA sperm typing results with mutation frequency data on normal alleles supports the hypothesis that trinucleotide repeat expansions may have a different molecular origin than contractions . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Benzene toxicity towards lymphocytes is thought to be mediated by metabolites of benzene including benzoquinone ( BQ ) . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: NAD ( P ) H : quinone reductase ( QR ) is known to protect against BQ toxicity . \nClassified Tokens List: 1 2 2 2 2 2 2 2 0 1 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: We had previously found that aspirin - like drugs ( ALD ) induce AP - 1 in human T lymphocytes . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: It was therefore hypothesized that ALD would protect lymphocytes against BQ toxicity by inducing QR . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Molt - 4 cells ( M4 ) , a human T lymphocyte cell line , were incubated with different concentrations of two ALD , flurbiprofen and sodium diclofenac , and then exposed to BQ . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Toxicity was measured by viability ( trypan blue exclusion ) . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The protective effect of ALD was significantly reduced by dicoumarol , a QR - specific inhibitor . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Since human T cells and T cell lines do not metabolize arachidonic acid , our data suggest that ALD can protect human T lymphocytes against a metabolite of benzene by induction of QR activity . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Correlation of differentiation - inducing activity of retinoids on human leukemia cell lines HL - 60 and NB4 . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Retinoids , including all - trans - retinoic acid , its isomers , and fifty synthetic retinoids ( retinobenzoic acids ) , were tested for differentiation - inducing activity on human leukemia cell lines HL - 60 and NB4 . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Platelet - activating factor ( PAF ) positively auto - regulates the expression of human PAF receptor transcript 1 ( leukocyte - type ) through NF - kappa B . \nClassified Tokens List: 1 2 2 2 0 1 0 0 0 0 0 0 0 0 1 2 2 2 2 0 0 0 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The human platelet - activating factor receptor ( PAFR ) gene is transcribed by two distinct promoters ( promoter 1 and promoter 2 ) to generate two transcripts ( designated as PAFR transcript 1 and PAFR transcript 2 ) , though their open reading frames are identical . \nClassified Tokens List: 0 1 2 2 2 2 2 2 2 2 2 0 0 0 0 0 1 0 1 2 0 1 2 0 0 0 0 0 0 0 0 1 2 2 0 1 2 2 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: By primer extension analysis to discriminate two transcripts , we found that the levels of PAFR transcript 1 ( leukocyte - type ) , but not PAFR transcript 2 ( tissue - type ) , are upregulated by PAF as well as by 12 - O - tetradecanoylphorbol - 13 - acetate ( TPA ) in the human stomach cancer cell line ( JR - St cells ) which expresses both functional PAFR transcript 1 and PAFR transcript 2 endogenously . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 1 2 2 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Functional analysis of the promoter 1 with a transient expression assay using chloramphenicol acetyltransferase ( CAT ) gene as a reporter showed that both PAF and TPA activated the promoter 1 but not the deleted promoter lacking the three consensus binding sites for NF - kappa B located from - 571 bp to - 459 bp . \nClassified Tokens List: 0 0 0 0 1 2 0 0 0 0 0 0 1 2 2 2 2 2 0 0 0 0 0 0 1 0 0 0 0 1 2 0 0 0 0 0 0 0 0 1 2 2 0 1 2 2 2 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: A cDNA library was prepared from peripheral blood lymphocytes of an autoimmune patient with primary Sjogrens ' syndrome . \nClassified Tokens List: 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The cDNA library was screened with the patients own autoimmune serum being monospecific for the nuclear autoantigen La / SS - B . \nClassified Tokens List: 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Thereby an alternative type of La mRNA was identified that differed from the known La mRNA due to an exchange of the exon 1 . \nClassified Tokens List: 0 0 0 0 0 1 2 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 1 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Sequencing of the genomic region between the exons 1 and 2 showed that the alternative 5 ' - end is a part of the intron . \nClassified Tokens List: 0 0 0 0 0 0 0 1 2 2 2 0 0 0 1 2 2 2 2 0 0 0 0 0 1 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In addition , the presence of an alternative promoter site , which exists within the intron downstream of the exon 1 , became evident . \nClassified Tokens List: 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 1 0 0 0 1 2 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In consequence , the alternative La mRNA is the result of a promoter switching combined with an alternative splicing mechanism . \nClassified Tokens List: 0 0 0 0 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In the intron , further transcription factor binding sites , including a NF - kappa B element , were identified leading to the suggestion that the expression of the gene encoding for the nuclear autoantigen La / SS - B alters in dependence on disease conditions . \nClassified Tokens List: 0 0 0 0 0 1 2 0 0 0 0 0 1 2 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Cross - linking CD40 on B cells rapidly activates nuclear factor - kappa B . \nClassified Tokens List: 0 0 0 1 0 0 0 0 0 1 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Cross - linking CD40 on B cells can lead to homotypic cell adhesion , IL - 6 production , and , in combination with cytokines , to Ig isotype switching . \nClassified Tokens List: 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0 1 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Tyrosine kinase activity is increased shortly after engagement of this receptor . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Little is known about how the very early events induced by CD40 cross - linking link to cellular responses . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In this study , we demonstrate that nuclear factor ( NF ) - kappa B and NF - kappa B - like transcription factors are activated after cross - linking CD40 on resting human tonsillar B cells and on B cell lines . \nClassified Tokens List: 0 0 0 0 0 0 0 1 2 2 2 2 2 2 2 0 1 2 2 2 2 2 2 2 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The complexes detected in electrophoretic mobility shift assays contain p50 , p65 ( RelA ) , c - Rel , and most likely other components . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 1 0 1 0 1 0 0 1 2 2 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: By using transient transfection assays , we found that cross - linking CD40 supports NF - kappa B - dependent gene expression . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 2 2 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Our results define the NF - kappa B system as an intermediate event in CD40 signaling and suggest that the CD40 pathway can influence the expression of B cell - associated genes with NF - kappa B consensus sites . \nClassified Tokens List: 0 0 0 0 1 2 2 2 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 1 2 2 2 2 0 1 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Protease inhibitors block lipopolysaccharide induction of tissue factor gene expression in human monocytic cells by preventing activation of c - Rel / p65 heterodimers . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Tissue factor ( TF ) is expressed rapidly by human monocytes exposed to bacterial endotoxin ( lipopolysaccharide , or LPS ) . \nClassified Tokens List: 1 2 0 1 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Transcriptional regulation is mediated by binding of c - Rel / p65 heterodimers to a kappa B - like site in the TF promoter . \nClassified Tokens List: 0 0 0 0 0 0 0 1 2 2 2 2 2 0 0 1 2 2 2 2 0 0 1 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Nuclear translocation of cytosolic c - Rel / p65 heterodimers and other members of the NF - kappa B / Rel family requires dissociation and proteolytic degradation of the inhibitor protein , I kappa B alpha . \nClassified Tokens List: 0 0 0 1 2 2 2 2 2 2 0 0 0 0 0 1 2 2 2 2 2 2 0 0 0 0 0 0 0 1 2 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The protease inhibitors N alpha - tosylphenylalanyl chloromethyl ketone ( TPCK ) and N alpha - tosyl - L - lysine chloromethyl ketone ( TLCK ) block activation of NF - kappa B / Rel proteins by preventing degradation of I kappa B alpha . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 0 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: To determine if TPCK and TLCK inhibited LPS induction of TF expression , freshly isolated human monocytes and monocytic THP - 1 cells were pretreated with these inhibitors for 30 min before LPS stimulation . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Both TPCK and TLCK inhibited LPS induction of TF protein , TF mRNA and TF promoter activity in a dose - dependent manner . \nClassified Tokens List: 0 0 0 0 0 0 0 0 1 2 0 1 2 0 1 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Taken together , these data indicated that inhibiting nuclear translocation of c - Rel / p65 heterodimers prevented LPS induction of TF gene transcription in monocytic cells . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 0 0 0 0 1 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: 1 , 25 - Dihydroxyvitamin D3 receptors in peripheral blood mononuclear cells from patients with primary and secondary hyperparathyroidism . \nClassified Tokens List: 1 2 2 2 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: A decreased number of calcitriol ( 1 , 25 ( OH ) 2D3 ) receptors has been observed in parathyroid glands of uremic animals . \nClassified Tokens List: 0 0 0 0 1 2 2 2 2 2 2 2 2 2 2 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In humans , studies carried out in surgically removed parathyroid glands have shown that calcitriol binding is higher in primary than in secondary hyperparathyroidism . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Since specific receptors for calcitriol have been described in peripheral blood mononuclear cells ( PBMC ) , we have investigated the specific uptake of 3H - labelled 1 , 25 ( OH ) 2D3 in PBMC of 12 women with primary hyperparathyroidism ( PHP ) , 8 women with hyperparathyroidism secondary to chronic renal failure ( SH ) , 9 women with renal transplant ( RT ) , and 23 healthy women . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In three patients with PHP who were subjected to parathyroidectomy , the calcitriol number came down to normal . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The severe phenotype of females with tiny ring X chromosomes is associated with inability of these chromosomes to undergo X inactivation . \nClassified Tokens List: 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 1 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Mental retardation and a constellation of congenital malformations not usually associated with Turner syndrome are seen in some females with a mosaic 45 , X / 46 , X , r ( X ) karyotype . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The two tiny ring X chromosomes studied with an antibody specific for the acetylated isoforms of histone H4 marking transcribed chromatin domains were labeled at a level consistent with their being active . \nClassified Tokens List: 0 0 0 0 1 2 0 0 0 1 0 0 0 0 0 0 1 2 0 1 2 2 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: We also examined tow of the XISTE - ring chromosomes to determine whether genes that are normally silent on an inactive X are expressed from these chromosomes . \nClassified Tokens List: 0 0 0 0 0 0 1 2 2 2 0 0 0 1 0 0 0 0 0 0 1 2 0 0 0 0 1 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Analyses of hybrid cells show that TIMP , ZXDA , and ZXDB loci on the proximal short arm , and AR and PHKA1 loci on the long arm , are well expressed from the tiny ring X chromosome lacking XIST DNA . \nClassified Tokens List: 0 0 0 0 0 0 1 0 1 0 0 1 2 0 0 1 2 2 0 0 1 0 1 2 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 1 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Studies of the ring chromosome that has XIST DNA but does not transcribe it show that its AR allele is transcribed along with the one on the normal X allele . \nClassified Tokens List: 0 0 0 1 2 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: ( ABSTRACT TRUNCATED AT 250 WORDS ) \nClassified Tokens List: 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Inhibition of activation of transcription factor AP - 1 by CD28 signalling in human T - cells . \nClassified Tokens List: 0 0 0 0 1 2 2 2 2 0 1 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Co - stimulation of T - lymphocytes by T - cell receptor ( TcR ) occupancy and activation of the CD28 surface molecule results in enhanced proliferation and interleukin 2 ( IL - 2 ) production . \nClassified Tokens List: 0 0 0 0 0 0 0 0 1 2 2 2 0 1 0 0 0 0 0 0 1 2 2 0 0 0 0 0 1 2 0 1 2 2 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Stimulation of T - cells by agonistic anti - CD28 antibodies in conjunction with phorbol 12 - myristate 13 - acetate ( PMA ) - or TcR - derived signals induces the enhanced activation of the transcription factor NF - kappa B . \nClassified Tokens List: 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 2 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Whereas anti - CD28 together with PMA increased the DNA binding and trans - activation activity of NF - kappa B , PMA - induced activation of AP - 1 was significantly suppressed . \nClassified Tokens List: 0 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 1 2 2 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The inhibitory effect exerted by anti - CD28 was observed at the level of DNA binding as well as in functional reporter - gene assays . \nClassified Tokens List: 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: These results suggest that the two transcription factors are independently regulated and may perform different functions during T - cell activation . \nClassified Tokens List: 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: HIV - 1 Nef leads to inhibition or activation of T cells depending on its intracellular localization . \nClassified Tokens List: 1 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Nef of primate lentiviruses is required for viremia and progression to AIDS in monkeys . \nClassified Tokens List: 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Negative , positive , and no effects of Nef have also been reported on viral replication in cells . \nClassified Tokens List: 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: To reconcile these observations , we expressed a hybrid CD8 - Nef protein in Jurkat cells . \nClassified Tokens List: 0 0 0 0 0 0 0 0 1 2 2 2 2 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Two opposite phenotypes were found , which depended on the intracellular localization of Nef . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Expressed in the cytoplasm or on the cell surface , the chimera inhibited or activated early signaling events from the T cell antigen receptor . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Activated Jurkat cells died by apoptosis , and only cells with mutated nef genes expressing truncated Nefs survived , which rendered Nef nonfunctional . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 1 0 0 0 0 1 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: These mutations paralleled those in other viral strains passaged in vitro . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Not only do these positional effects of Nef reconcile diverse phenotypes of Nef and suggest a role for its N - terminal myristylation , but they also explain effects of Nef in HIV infection and progression to AIDS . \nClassified Tokens List: 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: An intricate arrangement of binding sites for the Ets family of transcription factors regulates activity of the alpha 4 integrin gene promoter . \nClassified Tokens List: 0 0 0 0 0 0 0 0 1 2 0 1 2 0 0 0 0 1 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: alpha 4 integrins mediate cell - cell and cell - extracellular matrix interactions that are critical for maturation and function of the immune system as well as differentiation of skeletal muscle . \nClassified Tokens List: 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Here we examine molecular mechanisms controlling the pattern of alpha 4 expression . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 1 2 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Three binding sites for the Ets family of transcription factors are found in this region : two adjacent sites at positions - 50 and - 54 bp and a more 5 ' site at position - 67 bp . \nClassified Tokens List: 0 1 2 0 0 1 2 0 1 2 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 0 0 0 1 2 2 0 0 1 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Using a series of constructs containing deletions and mutations in this region , we found that the 3 ' - most site alone was sufficient for binding GA - binding protein alpha ( GABP alpha ) / GABP beta and for a low level of transcriptional activation . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 0 0 0 0 0 1 2 2 2 2 0 1 2 2 2 2 2 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Deletion of the 5 ' - most Ets site had no effect on binding to GABP alpha / GABP beta , but it eliminated a . \nClassified Tokens List: 0 0 0 1 2 2 2 2 2 0 0 0 0 0 0 1 2 2 2 2 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Concomitant with this loss of a , a new Ets - 1 - containing complex ` ` c ` ` appeared . \nClassified Tokens List: 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 0 0 1 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Complex c substituted efficiently for complex a in transcriptional activation . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: We conclude that although neither of the two 5 ' - most Ets sites alone binds nuclear protein , they appear to act as modulators which control the pattern of Ets proteins that bind the alpha 4 gene promoter . \nClassified Tokens List: 0 0 0 0 0 0 0 0 1 2 2 2 2 2 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Mechanism of antiandrogen action : conformational changes of the receptor . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Androgen receptor mRNA was translated in vitro , and androgen - and antiandrogen - bound receptor complexes were studied using limited proteolytic digestion by trypsin . \nClassified Tokens List: 1 2 2 0 0 0 0 0 0 1 2 2 2 2 2 2 2 0 0 0 0 0 0 0 1 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Partial proteolysis of androgen - bound receptor protein resulted in a 29 - kDa proteolysis - resisting fragment , whereas antiandrogen binding stabilised a 35 - kDa fragment . \nClassified Tokens List: 0 0 0 1 2 2 2 2 0 0 0 1 2 2 2 2 2 2 0 0 0 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Both fragments contain the entire ligand binding domain , and the 35 - kDa fragment extended into the hinge region of the receptor . \nClassified Tokens List: 0 0 0 0 0 1 2 2 0 0 0 1 2 2 2 0 0 0 1 2 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Several antiandrogens show agonistic properties for a mutated androgen receptor ( LNCaP cell variant ) ; trypsin digestion of antiandrogen - bound mutated receptor also resulted in a 29 - kDa fragment . \nClassified Tokens List: 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 1 0 0 1 2 2 2 2 0 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Our results point to an important difference between antiandrogens and antagonists of other steroid hormone receptors . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Differences in conformation of the hinge region distinguish androgen - bound from antiandrogen - bound receptor complexes , which represents an important feature of antiandrogen action . \nClassified Tokens List: 0 0 0 0 0 1 2 0 1 2 2 0 1 2 2 2 2 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Activation of nuclear factor kappa B in human neuroblastoma cell lines . \nClassified Tokens List: 0 0 1 2 2 2 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The nuclear factor kappa B ( NF - kappa B ) is a eukaryotic transcription factor . \nClassified Tokens List: 0 1 2 2 2 0 1 2 2 2 0 0 0 0 1 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In B cells and macrophages it is constitutively present in cell nuclei , whereas in many other cell types , NF - kappa B translocates from cytosol to nucleus as a result of transduction by tumor necrosis factor alpha ( TNF alpha ) , phorbol ester , and other polyclonal signals . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 1 2 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Using neuroblastoma cell lines as models , we have shown that in neural cells NF - kappa B was present in the cytosol and translocated into nuclei as a result of TNF alpha treatment . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The TNF alpha - activated NF - kappa B was transcriptionally functional . \nClassified Tokens List: 0 1 2 0 0 1 2 2 2 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: NF - kappa B activation by TNF alpha was not correlated with cell differentiation or proliferation . \nClassified Tokens List: 1 2 2 2 0 0 1 2 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In a NGF - responsive rat pheochromocytoma cell line , PC12 , PMA activated NF - kappa B , whereas NGF did not . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 1 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In other neuroblastoma cell lines , such as SK - N - Be ( 2 ) , the lack of PMA induction of differentiation was correlated with the lack of NF - kappa B activation . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: We found , moreover , that in SK - N - Be ( 2 ) cells protein kinase C ( PKC ) enzymatic activity was much lower compared with that in a control cell line and that the low PKC enzymatic activity was due to low PKC protein expression . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: NF - kappa B was not activated by retinoic acid , which induced morphological differentiation of all the neuroblastoma cell lines used in the present study . \nClassified Tokens List: 1 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Thus , NF - kappa B activation was not required for neuroblastoma cell differentiation . \nClassified Tokens List: 0 0 1 2 2 2 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Furthermore , the results obtained with TNF alpha proved that NF - kappa B activation was not sufficient for induction of neuroblastoma differentiation . \nClassified Tokens List: 0 0 0 0 0 0 1 2 0 0 1 2 2 2 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: ERP , a new member of the ets transcription factor / oncoprotein family : cloning , characterization , and differential expression during B - lymphocyte development . \nClassified Tokens List: 1 0 0 0 0 0 0 1 2 2 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The ets gene family encodes a group of proteins which function as transcription factors under physiological conditions and , if aberrantly expressed , can cause cellular transformation . \nClassified Tokens List: 0 1 2 2 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: We have recently identified two regulatory elements in the murine immunoglobulin heavy - chain ( IgH ) enhancer , pi and microB , which exhibit striking similarity to binding sites for ets - related proteins . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 2 2 0 1 0 1 0 0 0 0 0 0 1 2 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The ERP protein contains a region of high homology with the ETS DNA - binding domain common to all members of the ets transcription factor / oncoprotein family . \nClassified Tokens List: 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Three additional smaller regions show homology to the ELK - 1 and SAP - 1 genes , a subgroup of the ets gene family that interacts with the serum response factor . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 1 2 2 0 0 0 0 1 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Removal of the carboxy terminus enables ERP to interact with a variety of ets - binding sites including the E74 site , the IgH enhancer pi site , and the lck promoter ets site , suggesting a carboxy - terminal negative regulatory domain . \nClassified Tokens List: 0 0 0 1 2 0 1 0 0 0 0 0 0 1 2 2 2 0 0 1 2 0 0 1 2 2 2 0 0 0 1 2 2 2 0 0 0 1 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: At least three ERP - related transcripts are expressed in a variety of tissues . \nClassified Tokens List: 0 0 0 1 2 2 2 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: However , within the B - cell lineage , ERP is highly expressed primarily at early stages of B - lymphocyte development , and expression declines drastically upon B - cell maturation , correlating with the enhancer activity of the IgH pi site . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: These data suggest that ERP might play a role in B - cell development and in IgH gene regulation . \nClassified Tokens List: 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Gene for a tissue - specific transcriptional activator ( EBF or Olf - 1 ) , expressed in early B lymphocytes , adipocytes , and olfactory neurons , is located on human chromosome 5 , band q34 , and proximal mouse chromosome 11 . \nClassified Tokens List: 0 0 0 1 2 2 2 2 0 1 0 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 1 2 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Murine B lymphocytes , adipocytes , and olfactory neurons contain a DNA - binding protein that participates in the regulation of genes encoding tissue - specific components of signal transduction . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Purification and cloning of this protein , termed early B - cell factor ( EBF ) , from murine B lymphocytes and independent cloning of a protein , termed Olf - 1 , from olfactory neuronal cells revealed virtual complete amino acid sequence identity between these proteins . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 1 2 2 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: As a first step towards identifying a human genetic disorder or mouse mutation for which EBF could be a candidate gene , we have chromosomally mapped the corresponding locus in both species . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: By Southern hybridization analyses of somatic cell hybrid panels with murine cDNA probe , fluorescence chromosomal in situ hybridization ( FISH ) of human genomic clones , and analysis of recombinant inbred mouse strains , we have found single sites for EBF homologous sequences on human Chromosome ( Chr ) 5 , band q34 , and on proximal mouse Chr 11 , in an evolutionarily conserved region . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0 0 1 2 0 0 0 1 2 2 2 0 0 0 1 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Calcineurin activates transcription from the GM - CSF promoter in synergy with either protein kinase C or NF - kappa B / AP - 1 in T cells . \nClassified Tokens List: 1 0 0 0 0 1 2 2 2 0 0 0 0 1 2 2 0 1 2 2 2 1 2 2 2 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The GM - kappa B sequence is recognized by NF - kappa B , which is mainly induced by PMA . \nClassified Tokens List: 0 1 2 2 2 2 0 0 0 1 2 2 2 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The CLE0 sequence interacts with factors , related to a PMA - induced AP - 1 and a PMA / A23187 - induced NF - AT . \nClassified Tokens List: 0 1 2 0 0 0 0 0 0 0 1 2 2 2 2 2 0 0 1 2 2 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: We examined whether signal transducing components in T cells can activate transcription of the GM - CSF gene . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Cotransfection of NF - kappa B ( p50 / p65 ) - or AP - 1 ( c - Jun / c - Fos ) - expression vectors into Jurkat cells with a luciferase reporter containing the GM - CSF promoter did not stimulate transcription from the GM - CSF promoter . \nClassified Tokens List: 0 0 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 0 0 0 0 0 1 2 0 0 1 2 2 2 0 0 0 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In contrast , cotransfection with a combination of NF - kappa B and AP - 1 significantly augmented transcription from the GM - CSF promoter containing the GM - kappa B / GC - box and the CLE0 ( AP - 1 / NF - AT ) . \nClassified Tokens List: 0 0 0 0 0 0 0 0 1 2 2 2 0 1 2 2 0 0 0 0 0 1 2 2 2 0 0 1 2 2 2 2 2 2 2 0 0 1 0 1 2 2 2 2 2 2 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Expression of a constitutively active calcineurin ( CN ) , a Ca2 + / calmodulin - dependent protein phosphatase , potentiated by two fold the transcriptional activation by NF - kappa B / AP - 1 . \nClassified Tokens List: 0 0 0 0 0 1 0 1 0 0 0 1 2 2 2 2 2 2 2 0 0 0 0 0 0 0 0 0 1 2 2 2 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Both constitutively active forms of CN and protein kinase C ( PKC ) synergistically activated transcription from the GM - CSF promoter . \nClassified Tokens List: 0 0 0 0 0 1 0 1 2 2 0 1 0 0 0 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: These results suggest that cooperation among NF - kappa B - , AP - 1 - and NF - AT - binding sequences is required for induction of the GM - CSF gene through PKC - and Ca2 + - signaling pathways downstream of T cell activation . \nClassified Tokens List: 0 0 0 0 0 0 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Expression of the human PRL ( hPRL ) gene in extrapituitary sites such as the uterus ( decidualized endometrial stroma and myometrium ) and cells of the hematopoietic lineage is directed by an alternative promoter which is located approximately 6 kilobases ( kb ) upstream of the pituitary - specific start site . \nClassified Tokens List: 0 0 0 1 2 2 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 1 2 2 2 2 2 0 0 1 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In order to delineate the tissue - specific mechanisms governing the control of nonpituitary PRL gene expression , we have cloned and sequenced 3 kb 5 ' - flanking DNA of the upstream decidual / lymphoid ( dPRL ) promoter . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 1 2 2 2 2 2 2 0 0 0 1 2 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Based on sequence homology we identified two binding motifs for Pit - 1 and seven half - sites for glucocorticoid receptor / progesterone receptor ( PR ) binding . \nClassified Tokens List: 0 0 0 0 0 0 0 1 2 0 1 2 2 0 0 1 2 2 0 1 2 2 2 2 0 1 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: We focused our studies on the role of Pit - 1 and of PR as potential transcriptional regulators , since the POU domain protein Pit - 1 is essential in the control of pituitary PRL expression , and progesterone induces decidual transformation of the endometrial stroma , a differentiation process during which the decidual PRL gene is activated . \nClassified Tokens List: 0 0 0 0 0 0 0 0 1 2 2 0 0 1 0 0 1 2 0 0 0 1 2 2 1 2 2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: We demonstrate in a variety of cell types , including lymphocytes and endometrial stroma , that Pit - 1 is not involved in the regulation of dPRL promoter / reporter gene constructs carrying 3 kb 5 ' - flanking DNA . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0 1 2 2 2 2 2 0 1 2 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: When we compared the activity of the transfected dPRL promoter in PRL - secreting and nonsecreting lymphoid cells , we found that the 3 kb 5 ' - flanking region of the dPRL promoter did not contain elements restricting expression to only those lymphocytes that produce PRL but allowed expression of fusion reporter genes irrespective of the status of the endogenous PRL gene . \nClassified Tokens List: 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: This was in sharp contrast to endometrial cells where 3 kb 5 ' - flanking DNA conferred strong transcriptional activation on the dPRL promoter in decidualized endometrial stromal cells actively secreting PRL , but did not allow transcription in undifferentiated non - PRL - secreting endometrial stromal cells . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Activation of the dPRL promoter construct in these undifferentiated cells could however be induced by the addition of cAMP , in the absence of progesterone , suggesting that a signal transduced through the cAMP signaling pathway is a primary inducer of decidual PRL gene expression . \nClassified Tokens List: 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Signals and nuclear factors that regulate the expression of interleukin - 4 and interleukin - 5 genes in helper T cells . \nClassified Tokens List: 0 0 1 2 0 0 0 0 0 1 2 2 2 2 2 2 2 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Mouse thymoma line EL - 4 cells produce cytokines such as interleukin ( IL ) - 2 , IL - 3 , IL - 4 , IL - 10 , and granulocyte - macrophage colony - stimulating factor in response to phorbol 12 - myristate 13 - acetate ( PMA ) . \nClassified Tokens List: 0 0 0 0 0 0 0 0 1 0 0 1 2 2 2 2 2 0 1 2 2 0 1 2 2 0 1 2 2 0 0 1 2 2 2 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: EL - 4 cells also produce low levels of IL - 5 when stimulated by PMA alone ; however , cAMP greatly augments PMA - dependent IL - 5 production . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: A transient transfection assay revealed that two signals , PMA and cAMP , are required for optimal activation of the IL - 5 promoter . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In contrast , cAMP almost completely inhibited the PMA - dependent activation of the endogenous IL - 2 gene , as well as the transfected IL - 2 promoter . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 0 0 0 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: These results indicate that the IL - 5 gene is positively regulated by cAMP in a manner opposite to that for the IL - 2 gene . \nClassified Tokens List: 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The P sequence of the IL - 4 gene , defined as a responsive element for PMA and calcium ionophore ( A23187 ) , shares sequence similarity with the NF kappa B and the NF - activated T cell binding sites . \nClassified Tokens List: 0 1 2 0 0 1 2 2 2 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: We attempted to determine whether NF ( P ) , a nuclear factor specific for the P sequence , is related to NF - kappa B and nuclear factor for activated T cell ( NF - AT ) . \nClassified Tokens List: 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0 1 2 0 0 0 0 1 2 2 2 0 1 2 2 2 2 2 0 1 2 2 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In electromobility shift assays both NF - kappa B ( P65 or P65 / P50 heterodimer ) and NF - AT bound to the P sequence . \nClassified Tokens List: 0 0 0 0 0 1 2 2 2 0 1 0 1 2 2 2 0 0 1 2 2 0 0 0 1 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: However , sequence specificity of NF - AT was more similar to that of NF ( P ) , and only a small amount of P65 was detected in NF ( P ) . \nClassified Tokens List: 0 0 0 0 0 1 2 2 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0 1 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: These results indicate that a component or components of NF - AT have the potential to reconstitute NF ( P ) , whereas NF - kappa B alone does not account for NF ( P ) in Jurkat crude extract . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 1 2 2 2 0 0 1 2 2 2 0 0 0 0 0 1 2 2 2 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Taken together , these results suggest that NF - AT - like factors are involved in the regulation of IL - 4 and IL - 5 genes . \nClassified Tokens List: 0 0 0 0 0 0 0 1 2 2 2 2 2 0 0 0 0 0 0 1 2 2 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Solution structure of a POU - specific homeodomain : 3D - NMR studies of human B - cell transcription factor Oct - 2 . \nClassified Tokens List: 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0 1 2 2 2 2 1 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The POU DNA - binding motif defines a conserved family of eukaryotic transcription factors involved in regulation of gene expression . \nClassified Tokens List: 0 1 2 2 2 2 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: This bipartite motif consists of an N - terminal POU - specific domain ( POUs ) , a flexible linker , and a C - terminal POU - specific homeodomain ( POUHD ) . \nClassified Tokens List: 0 1 2 0 0 0 1 2 2 2 2 2 2 0 1 0 0 0 1 2 0 0 0 1 2 2 2 2 2 2 0 1 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Here we describe the solution structure of a POU - specific homeodomain . \nClassified Tokens List: 0 0 0 0 0 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: An NMR model is obtained from Oct - 2 , a human B - cell specific transcription factor which participates in the regulation of immunoglobulin genes . \nClassified Tokens List: 0 0 0 0 0 0 1 2 2 0 0 1 2 2 2 2 2 2 0 0 0 0 0 0 1 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: A fragment of Oct - 2 containing POUHD and an adjoining linker was expressed in Escherichia coli and characterized by three - dimensional nuclear magnetic resonance ( 3D - NMR ) spectroscopy . \nClassified Tokens List: 0 0 0 1 2 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Complete 1H and 15N resonance assignment of the POUHD moiety is presented . \nClassified Tokens List: 0 0 0 0 0 0 0 0 1 2 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The POUHD solution structure , as calculated by distance geometry and simulated annealing ( DG / SA ) , is similar to that of canonical homeodomains . \nClassified Tokens List: 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: A salient difference between solution and crystal structures is observed in the C - terminal segment of alpha - helix 3 ( the HTH recognition helix ) , which is not well ordered in solution . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 1 2 2 2 0 0 1 2 2 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Because this segment presumably folds upon specific DNA binding , its flexibility in solution may reduce the intrinsic DNA affinity of POUHD in the absence of POUs . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: NF - kappa B - dependent and - independent pathways of HIV activation in a chronically infected T cell line . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: J delta K cells were isolated as a chronically infected survivor cell line , following infection of Jurkat CD4 + T cells with dl - NF , a mutated strain of human immunodeficiency virus type 1 ( HIV - 1 ) containing a deletion of the long terminal repeat ( LTR ) NF - kappa B sites . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 1 0 1 2 2 2 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: J delta K cells exhibited very low levels of constitutive HIV production . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: HIV - 1 expression was activated from J delta K cells by treatment with phorbol myristate acetate ( PMA ) , sodium butyrate ( NaB ) , or hexamethylene bisacetamide ( HMBA ) , but not tumor necrosis factor alpha ( TNF - alpha ) , confirming the role of NF - kappa B in mediating TNF - alpha induction of HIV transcription . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 1 2 2 0 0 0 0 0 0 1 2 2 2 0 0 1 2 2 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The strong induction of HIV expression by NaB or HMBA in J delta K cells clearly demonstrates the existence of NF - kappa B - independent mechanisms of HIV activation in chronically infected cells . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: J delta K cells may provide a useful model for characterizing NF - kappa B - independent transcriptional activation of the HIV LTR . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 1 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: We investigated how these stimuli affect mitogen activated protein ( MAP ) kinases . \nClassified Tokens List: 0 0 0 0 0 0 1 2 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Alone , each stimulus resulted in little or no activation . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Similar to its effect on IL - 2 induction , cyclosporin A ( CsA ) inhibited the synergistic activation of JNK , and a competitive inhibitor of Jun phosphorylation by JNK inhibited IL - 2 promoter activation . \nClassified Tokens List: 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 1 0 1 2 2 2 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: By contrast , the MAP kinases ERK1 and ERK2 were fully activated by TPA or TCR stimulation and were not affected by Ca2 + , CD28 , or CsA . \nClassified Tokens List: 0 0 0 0 1 2 1 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Hence , integration of signals that lead to T cell activation occurs at the level of JNK activation . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Inhibition of rat splenocyte proliferation with methylprednisolone : in vivo effect of liposomal formulation . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Rat splenocytes were found to have greater sensitivity to MPL ( EC50 = 7 . 9 nM ) than do human peripheral blood lymphocytes ( EC50 = 28 nM ) . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In vivo studies in rats utilized 2 mg / kg IV bolus doses of liposomal MPL compared to drug in solution . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Animals were sacrificed at various times post - dosing until 120 h , spleen was excised and , after incubation of lymphocytes with PHA , splenocyte blastogenic responses were assessed by measuring cellular incorporation of 3H - thymidine . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The suppressive effect of liposomal MPL in comparison with free drug was significantly prolonged ( > 120 h vs < 18 h ) . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: A nonlinear relationship was found between suppression of splenocyte proliferation and the concentration of bound glucocorticoid receptors in spleen . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Only partial receptor occupancy accompanied complete lymphocyte suppression . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The suppression of endogenous corticosterone in plasma for both treatments was similar with values from L - MPL rats returning to baseline after 24 h . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: These results demonstrate enhanced efficacy of local immunosuppression by targeting spleen with liposomal MPL . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Function of NF - kappa B / Rel binding sites in the major histocompatibility complex class II invariant chain promoter is dependent on cell - specific binding of different NF - kappa B / Rel subunits . \nClassified Tokens List: 0 0 1 2 2 2 2 2 2 2 0 0 1 2 2 2 2 2 2 2 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The promoter of the human major histocompatibility complex class II - associated invariant - chain gene ( Ii ) contains two NF - kappa B / Rel binding sites located at - 109 to - 118 ( Ii kappa B - 1 ) and - 163 to - 172 ( Ii kappa B - 2 ) from the transcription start site . \nClassified Tokens List: 0 1 0 0 0 0 1 2 2 2 2 2 2 2 2 2 0 1 0 0 0 1 2 2 2 2 2 2 2 0 0 1 2 2 2 2 0 1 2 2 2 2 0 0 1 2 2 2 2 0 1 2 2 2 2 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: We report here that the differential function of each of these NF - kappa B / Rel sites in several distinct cell types depends on cell - specific binding of NF - kappa B / Rel transcription factors . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Ii kappa B - 1 is a positive regulatory element in B - cell lines and in the Ii - expressing T - cell line , H9 , but acts as a negative regulatory element in myelomonocytic and glia cell lines . \nClassified Tokens List: 1 2 2 2 2 0 0 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Electrophoretic mobility supershift assays determine that members of the NF - kappa B / Rel family of transcription factors can bind to this site in vitro and that DNA - binding complexes that contain p50 , p52 , p65 , and cRel correlate with positive regulation whereas the presence of p50 correlates with negative regulation . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 0 1 2 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 1 0 1 0 1 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In vivo occupancy of this site is observed only in the H9 T - cell line . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: This differential binding of specific NF - kappa B / Rel subunits is likely to mediate the disparate functions of these two NF - kappa B / Rel binding sites . \nClassified Tokens List: 0 0 0 0 0 1 2 2 2 2 2 2 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Epstein - Barr virus ( EBV ) replicative gene expression in tumour cells of AIDS - related non - Hodgkin ' s lymphoma in relation to CD4 cell number and antibody titres to EBV . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: METHODS : Seventeen out of 22 cases of ARNHL were selected for the presence of EBV [ Epstein - Barr early region ( EBER ) RNA - positive ] . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Immunohistochemistry was performed with anti - ZEBRA , anti - EA - restricted , anti - VCA antibodies and in situ hybridization with BHLF1 / NotI oligoprobes on tumour samples . \nClassified Tokens List: 0 0 0 0 1 2 2 0 1 2 2 2 2 2 2 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Results were statistically correlated with those of CD4 + cell counts ( 17 out of 17 ) and with anti - EBV antibody titres ( 13 out of 17 ) assessed using standard immunofluorescence method and enzyme - linked immunosorbent assay procedure using recombinant ZEBRA protein and synthetic peptides as antigens . \nClassified Tokens List: 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 1 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: RESULTS : BZLF1 ( ZEBRA ) or early gene products ( EA - R and EA - D / BHLF1 / NotI ) were detected in a small proportion ( < 0 . 01 - 5 % ) of tumour cells in eight of these 17 cases by immunohistochemistry and in situ hybridization . \nClassified Tokens List: 0 0 1 0 1 0 0 1 2 2 0 1 2 2 0 1 2 2 2 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Demonstration of replicative gene expression did not correlate with either low CD4 + cell counts ( P > 0 . 05 ) or anti - EBV antibody titres ( P > 0 . 05 ) . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Anti - ZEBRA activity was not significantly increased in patients affected with ARNHL , the cells of which expressed replicative gene products ( P > 0 . 05 ) . \nClassified Tokens List: 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: CONCLUSION : The degree of immunodeficiency does not clearly enhance replicative gene expression in tumour cells of ARNHL . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: EBV serology , including anti - ZEBRA activity , is not a reliable tool for predicting the occurrence of such proliferations . \nClassified Tokens List: 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Effects of prostaglandin E2 on Th0 - type human T cell clones : modulation of functions of nuclear proteins involved in cytokine production . \nClassified Tokens List: 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 1 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The effects of prostaglandin E2 ( PGE2 ) on cytokine production and proliferation of the CD4 + human helper T cell clone SP - B21 were investigated . \nClassified Tokens List: 0 0 0 1 2 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In contrast , in cells stimulated with phorbol myristate acetate ( PMA ) / A23187 , PGE2 enhanced the production of IL - 4 and IL - 5 , and only partially inhibited the production of other cytokines . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 2 2 0 1 2 2 0 0 0 0 0 0 0 0 0 1 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Therefore , the effects of PGE2 vary depending on the mode of T cell activation , and the IL - 4 and IL - 5 are regulated differently from other cytokines . \nClassified Tokens List: 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 1 2 2 0 0 0 0 0 1 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In a mobility shift assay , only the NF - kappa B ( p50 / p50 ) homodimer was observed in a complex formed with the kappa B sequence in unstimulated SP - B21 cells . \nClassified Tokens List: 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 2 2 2 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: When cells were stimulated with anti - CD3 mAb or PMA / A23187 , a complex formation of NF - kappa B ( p50 / p65 ) heterodimer with the kappa B sequence was induced . \nClassified Tokens List: 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0 0 0 1 2 2 2 0 1 1 2 0 0 0 0 1 2 2 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Interestingly , PGE2 or di - butyryl ( Bt2 ) cAMP abolished the binding of NF - kappa B ( p50 / p65 ) heterodimer to the kappa B sequence in cells stimulated with anti - CD3 mAb but not with PMA / A23187 . \nClassified Tokens List: 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 2 2 2 0 0 1 2 2 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Our results suggest that the target of PGE2 action is a component in the signal transduction pathway leading to the activation of protein kinase C . \nClassified Tokens List: 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: However , the inhibition of the T cell activation signals by PGE2 is selective . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: PGE2 enhanced the complex formation with NF - AT , AP - 1 and CLE0 sequences when the cells were activated by either anti - CD3 mAb or PMA / A23187 stimulation . \nClassified Tokens List: 1 0 0 0 0 0 1 2 2 2 2 2 2 2 2 2 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Characterization of NF ( P ) , the nuclear factor that interacts with the regulatory P sequence ( 5 ' - CGAAAATTTCC - 3 ' ) of the human interleukin - 4 gene : relationship to NF - kappa B and NF - AT . \nClassified Tokens List: 0 0 1 2 2 2 0 0 1 2 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 0 0 0 1 2 2 2 0 1 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The P sequence of the human interleukin - 4 ( IL - 4 ) gene , which was defined as a responsive element for phorbol 12 - myristate 13 - acetate and calcium ionophore ( A23187 ) in Jurkat T cells , shares sequence similarity with the NF - kappa B and the NF - AT binding sites . \nClassified Tokens List: 0 1 2 0 0 1 2 2 2 2 2 2 2 2 2 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: We examined whether NF ( P ) , a nuclear factor specific for the P sequence , is related to NF - kappa B and NF - AT . \nClassified Tokens List: 0 0 0 1 2 2 2 0 0 1 2 0 0 0 1 2 0 0 0 0 1 2 2 2 0 1 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: NF - kappa B ( P65 or P65 / P50 heterodimer ) bound to the P sequence in electrophoretic mobility shift assays ( EMSA ) and activated transcription through the P sequence when expression plasmids were cotransfected with P sequence - driven reporter plasmids in Jurkat T cells . \nClassified Tokens List: 1 2 2 2 0 1 0 1 2 2 2 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 1 2 0 0 0 1 2 2 2 2 2 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In EMSAs , NF ( P ) binding was inhibited by the unlabeled NF - AT binding site but not by the unlabeled AP1 binding site and purified NF - AT contained an activity that bound to the P sequence . \nClassified Tokens List: 0 0 0 1 2 2 2 0 0 0 0 0 1 2 2 2 2 2 0 0 0 0 1 2 2 2 0 1 2 2 2 0 0 0 0 0 0 0 1 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Both mobility shift and sequence specificity of NF - AT were similar to those of NF ( P ) and only a small amount of P65 was detected in NF ( P ) in crude nuclear extracts . \nClassified Tokens List: 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 1 0 0 0 1 2 2 2 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: These results indicate that the component ( s ) of NF - AT has the potential to reconstitute NF ( P ) whereas NF - kappa B alone can not account for NF ( P ) in crude extracts . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 1 2 2 2 0 1 2 2 2 0 0 0 0 0 1 2 2 2 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Unlike NF - AT , NF ( P ) does not contain AP1 as its DNA binding component . \nClassified Tokens List: 0 1 2 2 0 1 2 2 2 0 0 0 1 0 0 1 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Activation of early growth response 1 gene transcription and pp90rsk during induction of monocytic differentiation . \nClassified Tokens List: 0 0 1 2 2 2 2 0 0 1 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The present work has studied mechanisms responsible for induction of early growth response 1 ( EGR - 1 ) gene expression during monocytic differentiation of U - 937 myeloid leukemia cells . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Differentiation of U - 937 cells with 12 - O - tetradecanoylphorbol - 13 - acetate ( TPA ) , an activator of the serine / threonine protein kinase C , was associated with transcriptional activation of EGR - 1 promoter - reporter constructs . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 0 0 0 0 0 0 0 1 2 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The EGR - 1 promoter contains six CC ( A / T ) 6GG ( CArG ) motifs . \nClassified Tokens List: 0 1 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The two 5 ' - most distal CArG sequences conferred TPA inducibility . \nClassified Tokens List: 0 0 1 2 2 2 2 2 2 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In contrast , there was little effect of TPA on EGR - 1 transcription in a TPA - resistant U - 937 cell variant , designated TUR . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Treatment of both U - 937 and TUR cells with okadaic acid , an inhibitor of serine / threonine protein phosphatases 1 and 2A , was associated with induction of monocytic differentiation and EGR - 1 transcription through the 5 ' - most CArG element . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 2 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 1 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Since these findings supported the involvement of serine / threonine protein phosphorylation in the regulation of EGR - 1 expression , we studied activation of the 40S ribosomal protein S6 serine / threonine kinases , pp70S6K and pp90rsk . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0 1 2 2 2 2 2 2 2 0 1 0 1 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Although both kinases participate in regulating cell growth , there was no detectable activation of pp70S6K during TPA - or okadaic acid - induced monocytic differentiation . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Okadaic acid treatment of both cell types was associated with activation of pp90rsk . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 1 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Antioxidants inhibit monocyte adhesion by suppressing nuclear factor - kappa B mobilization and induction of vascular cell adhesion molecule - 1 in endothelial cells stimulated to generate radicals . \nClassified Tokens List: 0 0 0 0 0 0 1 2 2 2 2 0 0 0 0 1 2 2 2 2 2 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Cell adhesion to endothelial cells stimulated by tumor necrosis factor - alpha ( TNF ) is due to induction of surface receptors , such as vascular cell adhesion molecule - 1 ( VCAM - 1 ) . \nClassified Tokens List: 0 0 0 0 0 1 2 2 2 2 2 2 0 1 0 0 0 0 0 0 1 2 0 0 0 1 2 2 2 2 2 0 1 2 2 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The antioxidant pyrrolidine dithiocarbamate ( PDTC ) specifically inhibits activation of nuclear factor - kappa B ( NF - kappa B ) . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 0 1 2 2 2 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Since kappa B motifs are present in VCAM - 1 and intercellular adhesion molecule - 1 ( ICAM - 1 ) promoters , we used PDTC to study the regulatory mechanisms of VCAM - 1 and ICAM - 1 induction and subsequent monocyte adhesion in TNF - treated human umbilical vein endothelial cells ( HUVECs ) . \nClassified Tokens List: 0 1 2 2 0 0 0 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 0 0 0 0 0 0 0 0 0 0 1 2 2 0 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Gel - shift analysis in HUVECs demonstrated that PDTC prevented NF - kappa B mobilization by TNF , suggesting that only VCAM - 1 induction was controlled by NF - kappa B . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 1 0 0 0 0 1 2 2 0 0 0 0 1 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Since HUVECs released superoxide anions in response to TNF , and H2O2 induces VCAM - 1 , PDTC may act as a radical scavenger . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Although ICAM - 1 induction was unaffected , inhibitors of NADPH oxidase ( apocynin ) or cytochrome P - 450 ( SKF525a ) suppressed VCAM - 1 induction by TNF , revealing that several radical - generating systems are involved in its regulation . \nClassified Tokens List: 0 1 2 2 0 0 0 0 0 0 1 2 0 0 0 0 1 2 2 2 0 0 0 0 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: PDTC , apocynin , or SKF525a decreased adhesion of monocytic U937 cells to TNF - treated HUVECs ( by 75 % at 100 mumol / L PDTC ) . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Inhibition by anti - VCAM - 1 monoclonal antibody 1G11 indicated that U937 adhesion was VCAM - 1 dependent and suppression by antioxidants was due to reduced VCAM - 1 induction . \nClassified Tokens List: 0 0 1 2 2 2 2 2 2 1 0 0 0 0 0 1 2 2 0 0 0 0 0 0 0 0 0 1 2 2 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Displacement of an E - box - binding repressor by basic helix - loop - helix proteins : implications for B - cell specificity of the immunoglobulin heavy - chain enhancer . \nClassified Tokens List: 0 0 0 1 2 2 2 2 2 0 1 2 2 2 2 2 2 0 0 0 0 0 0 0 0 0 1 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The activity of the immunoglobulin heavy - chain ( IgH ) enhancer is restricted to B cells , although it binds both B - cell - restricted and ubiquitous transcription factors . \nClassified Tokens List: 0 0 0 0 1 2 2 2 2 2 2 2 0 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 2 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Activation of the enhancer in non - B cells upon overexpression of the basic helix - loop - helix ( bHLH ) protein E2A appears to be mediated not only by the binding of E2A to its cognate E box but also by the resulting displacement of a repressor from that same site . \nClassified Tokens List: 0 0 0 1 0 0 0 0 0 0 0 0 0 1 2 2 2 2 2 2 2 2 2 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 2 0 0 0 0 0 0 0 0 1 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Hence , we propose that a necessary prerequisite of enhancer activity is the B - cell - specific displacement of a ZEB - like repressor by bHLH proteins . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 1 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Inhibition of NF - kappa B by sodium salicylate and aspirin [ see comments ] \nClassified Tokens List: 0 0 1 2 2 2 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The transcription factor nuclear factor - kappa B ( NF - kappa B ) is critical for the inducible expression of multiple cellular and viral genes involved in inflammation and infection including interleukin - 1 ( IL - 1 ) , IL - 6 , and adhesion molecules . \nClassified Tokens List: 0 1 2 1 2 2 2 2 0 1 2 2 2 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 1 2 2 0 1 2 2 0 0 1 2 2 0 0 1 2 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: The anti - inflammatory drugs sodium salicylate and aspirin inhibited the activation of NF - kappa B , which further explains the mechanism of action of these drugs . \nClassified Tokens List: 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: This inhibition prevented the degradation of the NF - kappa B inhibitor , I kappa B , and therefore NF - kappa B was retained in the cytosol . \nClassified Tokens List: 0 0 0 0 0 0 0 1 2 2 2 2 0 1 2 2 0 0 0 1 2 2 2 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Sodium salicylate and aspirin also inhibited NF - kappa B - dependent transcription from the Ig kappa enhancer and the human immunodeficiency virus ( HIV ) long terminal repeat ( LTR ) in transfected T cells . \nClassified Tokens List: 0 0 0 0 0 0 1 2 2 2 0 0 0 0 0 1 2 2 0 0 1 2 2 2 2 2 2 2 2 0 1 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: Expression of antisense myb RNA reduced the amount of c - myb mRNA , and the percentage of Hb - synthesizing cells was decreased to 20 % . \nClassified Tokens List: 0 0 1 2 2 0 0 0 0 1 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", + "output": [ + "0" + ] + }, + { + "input": "Tokens: In the presence of Epo , c - myb mRNA declined and 20 % of K562 cells synthesized Hb regardless of antisense myb RNA expression . \nClassified Tokens List: 0 0 0 0 1 0 1 2 2 2 0 0 0 0 0 0 0 0 1 0 0 1 2 2 0 0", + "output": [ + "0" + ] + } + ] +} diff --git a/tasks/task1701_bn_hate_speech_machine_translation.json b/tasks/task1701_bn_hate_speech_machine_translation.json new file mode 100644 index 000000000..7fd31c0f3 --- /dev/null +++ b/tasks/task1701_bn_hate_speech_machine_translation.json @@ -0,0 +1,801 @@ +{ + "Contributors": [ + "Sagar Rudagi" + ], + "Source": [ + " Bengali Hate Speech (https://huggingface.co/datasets/bn_hate_speech)" + ], + "Input_language": [ + "Bengali" + ], + "Output_language": [ + "English" + ], + "Instruction_language": [ + "English" + ], + "Categories": [ + "Machine Translation" + ], + "Definition": "In this task, the news article will be provided in Bengali as the input and it is to be translated into English.", + "Positive Examples": [ + { + "input": "\u0987\u09a8\u09bf\u0987 \u09b9\u099a\u09cd\u099b\u09c7\u09a8 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf\u09b0\u0995\u09cd\u09b7\u09be\u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0 \u09ae\u09a8\u09c7\u09be\u09b9\u09b0 \u09aa\u09be\u09b0\u09bf\u0995\u09b0 \u098f\u0987 \u0995\u09a6\u09bf\u09a8 \u0986\u0997\u09c7\u0987 \u09af\u09bf\u09a8\u09bf \u0998\u09cb\u09b7\u09a8\u09be \u09a6\u09c7\u09a8 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09a6\u0996\u09b2 \u0995\u09b0\u09c7 \u09ae\u09b9\u09be\u09ad\u09be\u09b0\u09a4 \u0997\u09a0\u09a8 \u0995\u09b0\u09ac\u09c7\u09a8 \u0986\u09b6\u09cd\u099a\u09b0\u09cd\u09af \u09a4\u09bf\u09a8\u09bf\u0987 \u0995\u09bf\u09a8\u09be \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09ac\u09b0\u09c7\u09a8\u09cd\u09af \u09b0\u09be\u09b7\u09cd\u099f\u09cd\u09b0\u09c0\u09df \u0985\u09a4\u09bf\u09a5\u09bf", + "output": "This is Manohar Parrikar, the Defense Minister of India, who a few days ago announced that he would occupy Bangladesh and form the Mahabharata. I wonder if he is our distinguished state guest.", + "explanation": "This sentence is translated accurately from Bengali to English with no grammatical errors." + }, + { + "input": " \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u0995\u09c7 \u09aa\u09c3\u09a5\u09c0\u09ac\u09bf\u09b0 \u09ae\u09be\u09a8\u099a\u09bf\u098f \u09a5\u09c7\u0995\u09c7 \u09ae\u09c1\u099a\u09c7 \u09ab\u09c7\u09b2\u09a4\u09c7 \u09b9\u09ac\u09c7 ", + "output": "India must be removed from the map of the world", + "explanation": "This sentence translation to English from Bengali is on point." + }, + { + "input": "\u098f\u0987 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09b0\u09be \u09ac\u09be\u0982\u0997\u09be\u09b2\u09bf\u09a6\u09c7\u09b0 \u09b8\u09be\u09ab\u09b2\u09cd\u09af \u09a6\u09c7\u0996\u09c7 \u09b9\u09bf\u0982\u09b8\u09be \u0995\u09b0\u09c7 \u09ac\u09be\u09b9\u09bf\u09b0 \u09a6\u09c7\u09b6\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c0\u09a6\u09c7\u09b0 \u09a6\u09c7\u0996\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7\u09a8\u09be \u098f\u0987 \u098f\u0995\u099f\u09bf \u09ae\u09be\u098f \u099c\u09be\u09a4\u09bf \u09b8\u09c1\u09a4\u09b0\u09be\u0982 \u09b8\u09be\u09ac\u09a7\u09be\u09a8 ", + "output": "These Malauns are jealous of the success of the Bengalis and can't see Bangladeshis abroad. This is a mother nation, so be careful.", + "explanation": "This sentence is translated accurately from Bengali to English with appropriate punctuation marks." + } + ], + "Negative Examples": [ + { + "input": "\u0986\u09ae\u09b0\u09be \u09ac\u09b2\u09a4\u09c7 \u0995\u09be\u09b0\u09be \u09ad\u09be\u09b0\u09a4 \u09a4\u09be\u0987\u09a4\u09cb ", + "output": "We say india is", + "explanation": "This sentence is translated inaccurately as it contains some grammatical errors and as India is a proper noun the starting letter should be capital. The sentence translation results to 'We say who India is.'" + }, + { + "input": "\u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u0986\u09ae\u09be\u09b0 \u09ac\u09be\u09b2 ", + "output": "Pakistan is ball", + "explanation": "This translation contains grammatical errors. The sentence correctly translates into, 'Pakistan is my ball'." + }, + { + "input": "\u09a4\u09cb\u09a6\u09c7\u09b0 \u09ae\u09a4\u09cb \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09be \u09b8\u09cb\u09a8\u09bf\u0995\u09be\u09b0 \u09ae\u09a4\u09cb \u09ae\u09c7\u09df\u09c7\u09b0\u09be \u09aa\u09be\u0987\u09b2\u09c7 \u09b6\u09bf\u0993\u09b0 \u0997\u09cd\u09af\u09be\u0982\u09ac\u09cd\u09af\u09be\u0982 \u09a6\u09bf\u09ac\u09bf", + "output": "I'm sure I'll give you a gangbang if you get bitch girls", + "explanation": "This sentence translation contains some sentence formation errors where a name of Sonika is missed out." + } + ], + "Instances": [ + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09b0\u09be \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09a2\u09c1\u0995\u09b2\u09c7 \u0995\u09bf \u09a4\u09cb\u09b0 \u0995\u09cb\u09a8 \u09b8\u09ae\u09b8\u09cd\u09af\u09be ", + "output": [ + "Do you have any problem when the Rohingyas of Khanki enter Bangladesh?" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u09ae\u09cb\u09a6\u09c7\u09b0 \u09ac\u09be\u0981\u09b6\u09ad\u09be\u0987 \u09a6\u09be\u09a6\u09be\u09b0\u09be \u0986\u09b8\u09be\u09b0\u09a6\u09b0\u0995\u09be\u09b0 \u09a8\u09be\u0987 \u0993 \u0986\u09b6\u09be\u09ae\u09be\u09a8\u09c7 \u09af\u09c7\u0995\u09cb\u09a8\u09ad\u09be\u09ac\u09c7 \u09ac\u09be\u0982\u09a6\u09c7\u09b6\u09c7\u09b0\u0995\u09c7 \u09ac\u09be\u09b6\u09a6\u09bf\u09df\u09c7\u099c\u09be\u09ac\u09c7 ", + "output": [ + "Bharat Mode's Banshabhai Dadara doesn't need Asard and will hopefully defeat Bangladesh in any way" + ] + }, + { + "input": "\u098f\u09a6\u09c7\u09b0 \u0995\u09c7 \u099a\u09cb\u09a6\u09cd\u09a6 \u09ac\u099b\u09b0\u09c7 \u09ab\u09be\u09b8\u09bf \u09a6\u09c7\u09df\u09be \u09b9\u09cb\u0995", + "output": [ + "Let them be hanged for fourteen years" + ] + }, + { + "input": "\u098f\u099c\u09a8\u09cd\u09af \u09ad\u09be\u09b0\u09a4 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u098f\u09b8\u09c7 \u09b9\u09cb\u09df\u09be\u0987\u099f \u0993\u09df\u09be\u09b8 \u09b9\u09df\u09c7\u0997\u09c7\u099b\u09c7 \u09ae\u09a8\u09c7 \u09a8\u09c7\u0987 ", + "output": [ + "That is why I don't remember India being whitewashed in Bangladesh" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u09a6\u09c7\u09b0 \u09ae\u09be\u0987\u09b0\u09be \u09ab\u09be\u09b2\u09be \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be \u09b8\u09ac \u09ac\u09bf\u09a4\u09be\u09dc\u09bf\u09a4 \u0995\u09b0\u09be \u09a6\u09b0\u0995\u09be\u09b0 ", + "output": [ + "All the Rohingyas need to be expelled from Myra Fala of Khankir Polad" + ] + }, + { + "input": "\u0985\u09b8\u09cd\u09a4\u09cd\u09b0 \u09a8\u09bf\u09b0\u09cd\u09ae\u09be\u09a8 \u0995\u09cb\u09a8 \u099b\u09cb\u099f\u0996\u09be\u099f \u09ac\u09bf\u09b7\u09df \u09a8\u09df \u0987\u09b9\u09be \u09ad\u09be\u09b0\u09a4\u09bf\u0993 \u09b0\u09be\u09b8\u09cd\u099f\u09bf\u09df \u09b8\u09b9\u09be\u09df\u09a4\u09be \u099b\u09be\u09b0\u09be \u09b8\u09ae\u09cd\u09ac\u09ad \u09a8\u09be", + "output": [ + "Weapons manufacturing is not a trivial matter, it is not possible without Indian state support" + ] + }, + { + "input": "\u098f\u0987\u09b8\u09ac \u0990\u0995\u09cd\u09af\u09a7\u09be\u09b0\u09c0\u09b0\u09be \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u098f\u0995\u099f\u09be \u0993\u09df\u09be\u09b0\u09cd\u09a1\u09c7\u09b0 \u099a\u09cc\u0995\u09bf\u09a6\u09be\u09b0 \u09b9\u0993\u09df\u09be\u09b0\u09cb \u09af\u09cb\u0997\u09cd\u09af\u09a4\u09be \u09b0\u09be\u0996\u09c7 \u09a8\u09be ", + "output": [ + "These unity holders do not qualify to be a ward chowkidar in Bangladesh" + ] + }, + { + "input": "\u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09ad\u09be\u0987 \u0986\u09aa\u09a8\u09bf \u0996\u09c1\u09ac \u0989\u09aa\u09af\u09c1\u0995\u09cd\u09a4", + "output": [ + "Razakar brother you are very suitable" + ] + }, + { + "input": "\u0986\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7 \u09aa\u09be\u0987\u09b2\u09bf \u09a8\u09be \u099c\u09be\u09ab\u09b0 \u09ac\u09be\u09b2\u09a1\u09be \u09b0\u09c7 \u0995\u09b2 \u09a6\u09bf\u099b\u09cb\u09b8 ", + "output": [ + "And people did not find Jafar Bala Ray called" + ] + }, + { + "input": "\u09ae\u09be\u09b9\u09bf \u09ac\u09bf \u099a\u09cb\u09a7\u09c1\u09b0\u09c0 \u098f \u09a4\u09cb \u09a6\u09c7\u0996\u09bf \u09aa\u09c1\u09b0\u09be\u0987 \u0986\u0993\u09df\u09be\u09ae\u09c0 \u09a6\u09be\u09b2\u09be\u09b2 ", + "output": [ + "I see Mahi B Chowdhury is a complete Awami Dalal" + ] + }, + { + "input": "\u09af\u0996\u09a8 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u09a6\u0996\u09b2\u09c7 \u099b\u09bf\u09b2 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09a4\u0996\u09a8 \u0995\u09bf\u09b0\u0995\u09ae \u0985\u09a4\u09af\u09be\u099a\u09be\u09b0 \u0995\u09b0\u09c7\u099b\u09bf\u09b2 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 ", + "output": [ + "What kind of atrocities did Pakistan commit when Bangladeshis were under Pakistan's occupation?" + ] + }, + { + "input": "\u09b8\u09a4\u09cd\u09af \u0998\u099f\u09a8\u09be \u098f\u0995\u09ac\u09be\u09b0 \u09a8\u09bf\u09ac\u09c7\u09a6\u09bf\u09a4\u09be \u09b9\u09b0\u09bf\u09af\u09bc\u09be\u09a8\u09be\u09b0 \u09ae\u09df\u09a6\u09be\u09a8\u09c7 \u0987\u099c\u09bf \u099a\u09c7\u09df\u09be\u09b0\u09c7 \u0997\u09ad\u09c0\u09b0 \u09b0\u09be\u09a4\u09c7 \u09ac\u09b8\u09c7\u099b\u09bf\u09b2\u09c7\u09a8 \u09b9\u09a0\u09be\u09a4 \u09a4\u09bf\u09a8\u09bf \u09b6\u09c1\u09a8\u09a4\u09c7 \u09aa\u09be\u09a8 \u09af\u09a6\u09be\u09af\u09a6\u09be\u09b9\u09bf \u09a4\u09be\u0981\u09b0 \u09ae\u09a8\u09c7 \u09b9\u09b2 \u0990 \u09ae\u09df \u09a6\u09be\u09a8\u09c7\u09b0 \u09ac\u09be\u0981\u09a6\u09bf\u0995 \u09a5\u09c7\u0995\u09c7 \u0993\u0987 \u09ae\u09a8\u09cd\u09a4\u09cd\u09b0 \u0989\u099a\u09cd\u099a\u09be\u09b0\u09bf\u09a4 \u09b9\u099a\u09cd\u099b\u09c7 \u09a4\u09bf\u09a8\u09bf \u099b\u09c1\u099f\u09c7 \u09af\u09be\u09a8 \u0990\u09a6\u09bf\u0995\u09c7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09a8\u09be \u0985\u09a8\u09cd\u09af \u09aa\u09cd\u09b0\u09be\u09a8\u09cd\u09a4\u09c7 \u09a5\u09c7\u0995\u09c7 \u09b8\u09c1\u09b0 \u09ad\u09c7\u09b8\u09c7 \u0986\u09b8\u09c7 \u09aa\u09b0\u09c7 \u09a4\u09bf\u09a8\u09bf \u09ae\u09be\u099d\u0996\u09be\u09a8\u09c7 \u098f\u09b2\u09c7\u09a8 \u09a4\u09bf\u09a8\u09bf \u09b6\u09c1\u09a8\u09a4\u09c7 \u09aa\u09c7\u09b2\u09c7\u09a8 \u09b8\u0995\u09b2 \u09a6\u09bf\u0995 \u09a5\u09c7\u0995\u09c7 \u09b8\u09c1\u09b0 \u09ad\u09c7\u09b8\u09c7 \u0986\u09b8\u099b\u09c7 \u09a4\u09bf\u09a8\u09bf \u09ac\u09b2\u09b2\u09c7\u09a8 \u09ae\u09b9\u09be\u09ad\u09be\u09b0\u09a4 \u09b8\u09a4\u09cd\u09af \u0995\u09c3\u09b7\u09cd\u09a3 \u09b8\u09a4\u09cd\u09af \u09af\u09c1\u09a6\u09cd\u09a7 \u09b8\u09a4\u09cd\u09af \u09a4\u09bf\u09a8\u09bf \u0986\u09aa\u09a4\u09cd\u09a4 \u099c\u09a8 \u09a4\u09be\u0987 \u09a4\u09be\u0981\u09b0 \u0995\u09a5\u09be \u09ac\u09bf\u09b6\u09cd\u09ac\u09be\u09b8 \u0995\u09b0\u09a4\u09c7 \u0987 \u09b9\u09ac\u09c7 \u09aa\u09cd\u09b0\u09ae\u09be\u09a3\u09c7\u09b0 \u09a6\u09b0\u0995\u09be\u09b0 \u09b9\u09df \u09a8\u09be ", + "output": [ + "The truth is that once Nivedita was sitting in an easy chair in the Maidan of Haryana in the middle of the night when suddenly she heard the mantra being recited from the left side of May Dan. The melody is coming. He says Mahabharata Satya Krishna Satya Juddha Satya." + ] + }, + { + "input": "\u099c\u09be\u09b9\u09be\u09a8\u09cd\u09a8\u09be\u09ae\u09c7\u09b0 \u0995\u09c0\u099f \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u099f\u09be \u09a8\u09be \u09ae\u09b0\u09c7 \u09b9\u09be\u099c\u09be\u09b0 \u09ae\u09b0\u09b2\u09c7 \u09ac\u09c7\u09b6\u09c0 \u0996\u09c1\u09b6\u09bf \u09b9\u09a4\u09be\u09ae ", + "output": [ + "I would have been happier if the insects of hell had not died a thousand times" + ] + }, + { + "input": "\u09b8\u09be\u09b2\u09be \u09aa\u09be\u0997\u09b2 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09b0\u09be \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09af\u09c7\u09ad\u09be\u09ac\u09c7 \u09b6\u09be\u09a8\u09cd\u09a4\u09bf\u09a4\u09c7 \u09a5\u09be\u0995\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u0993 \u098f\u09ad\u09be\u09ac\u09c7 \u09a5\u09be\u0995\u09c7 \u09a8\u09be", + "output": [ + "Sala Pagal Hindus live in peace in Bangladesh but not in India" + ] + }, + { + "input": "\u09b8\u09be\u09ac\u09be\u09b8 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09af\u09c7\u0996\u09be\u09a8\u09c7 \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u099c\u09be\u09a8\u09cb\u09df\u09be\u09b0 \u0997\u09c1\u09b2\u09bf\u09b0", + "output": [ + "Sabas Pakistan is Bangladesh where Indian animals are shot" + ] + }, + { + "input": "\u0995\u09bf\u099b\u09c1\u0987 \u09b9\u09ac\u09c7\u09a8\u09be \u09b8\u09ac \u09ae\u09bf\u09a1\u09bf\u09df\u09be\u09b0 \u09ac\u09be\u09dc\u09be\u09ac\u09be\u09dc\u09bf \u09ad\u09be\u09b0\u09a4 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u0995\u09c7 \u09aa\u09be\u0997\u09b2\u09be \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09df \u0995\u09be\u09ae\u09dc\u09be\u09df\u09a8\u09bf \u09af\u09c7 \u098f\u0995\u099c\u09a8 \u0986\u09b0\u09c7\u0995\u099c\u09a8\u0995\u09c7 \u09ad\u09df\u09be\u09ac\u09b9 \u0986\u0995\u09cd\u09b0\u09ae\u09a3 \u0995\u09b0\u09ac\u09c7 \u0993\u0987\u09b0\u0995\u09ae \u09ae\u09be\u099d\u09c7\u09ae\u09be\u099d\u09c7 \u09a6\u09c1\u0987\u099a\u09be\u09b0\u0986\u099f\u09a6\u09b6\u099c\u09a8 \u09ae\u09b0\u09ac\u09c7 \u09a4\u09be\u09b0 \u09ac\u09c7\u09b6\u09bf\u0995\u09bf\u099b\u09c1 \u09b9\u09ac\u09c7\u09a8\u09be", + "output": [ + "Nothing will happen. The exaggeration of all the media." + ] + }, + { + "input": "\u0986\u099c\u0995\u09c7\u09b0 \u09b8\u09cb \u09ac\u09be\u09b2\u09c7\u09b0 \u09b9\u0987\u099b\u09c7 \u099c\u09ae\u09c7 \u09a8\u09be\u0987 ", + "output": [ + "Today's So Baal is not frozen" + ] + }, + { + "input": "\u09ae\u09be\u09a8\u09c1\u09b7\u09c7\u09b0 \u099c\u09c0\u09ac\u09a8\u099f\u09be \u0985\u09ad\u09bf\u09a8\u09df \u09a4\u09ac\u09c7 \u0986\u09aa\u09a8\u09be\u09a6\u09c7\u09b0 \u0985\u09ad\u09bf\u09a8\u09df \u09a6\u09c7\u0996\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u09b2\u0995\u09cd\u09b7 \u0995\u09cb\u099f\u09bf \u09ae\u09be\u09a8\u09c1\u09b7 \u09aa\u09be\u0997\u09b2 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09ac\u09be\u0982\u09b2\u09be \u09b8\u09bf\u09a8\u09c7\u09ae\u09be\u09b0 \u09a4\u09be\u09b0\u0995\u09be\u09a6\u09c7\u09b0 \u0985\u09ad\u09bf\u09a8\u09df \u099c\u09a8\u09aa\u09cd\u09b0\u09bf\u09df \u09b9\u09df \u0993\u09a0\u09c7\u099b\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09ac\u09be\u0982\u09b2\u09be \u09b8\u09bf\u09a8\u09c7\u09ae\u09be\u09df \u099c\u09a8\u09aa\u09cd\u09b0\u09bf\u09df \u0985\u09ad\u09bf\u09a8\u09c7\u09a4\u09be \u0985\u09ad\u09bf\u09a8\u09c7\u09a4\u09cd\u09b0\u09c0 \u099c\u09ae\u09cd\u09ae \u09b9\u09df\u09c7\u099b\u09c7 \u09ac\u09b0\u09cd\u09a4\u09ae\u09be\u09a8\u09c7\u09b0 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09ac\u09be\u0982\u09b2\u09be \u09b8\u09bf\u09a8\u09c7\u09ae\u09be \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09b8\u09bf\u09a8\u09c7\u09ae\u09be\u09b0 \u099a\u09c7\u09df\u09c7 \u0995\u09cb\u09a8\u09cb \u0985\u0982\u09b6\u09c7 \u0995\u09ae \u09a8\u09df \u0985\u09ac\u09b6\u09c7\u09b7\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09af\u09cc\u09a5 \u09aa\u09b0\u09bf\u099a\u09be\u09b2\u09a8\u09be \u09b8\u09bf\u09a8\u09c7\u09ae\u09be \u0995\u09b0\u09be\u09a4\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7 \u0993 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09ac\u09be\u0982\u09b2\u09be \u09b8\u09bf\u09a8\u09c7\u09ae\u09be\u09b0 \u099c\u09a8\u09aa\u09cd\u09b0\u09bf\u09df \u09b9\u099a\u09cd\u099b\u09c7 \u09a6\u09c1\u0987 \u09ac\u09be\u0982\u09b2\u09be \u098f\u0995 \u09b8\u09be\u09a5\u09c7 \u0995\u09be\u099c \u0995\u09b0\u09be", + "output": [ + "Man's life is acting but millions of people are crazy to watch your acting. The acting of Bengali movie stars of Bangladesh has become popular. Popular actors and actresses have been born in Bangladeshi Bengali movies. The popularity of cinema is that the two Bengalis work together" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u0986\u09b8\u09b2\u09c7 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u0995\u09c7 \u0995\u09bf \u09aa\u09b0\u09bf\u09ae\u09be\u09a3 \u09ad\u09df \u09aa\u09be\u09df \u09a4\u09be \u0986\u09b0 \u09ac\u09b2\u09be\u09b0 \u0985\u09aa\u09c7\u0995\u09cd\u09b7\u09be \u09b0\u09be\u0996\u09c7\u09a8\u09be", + "output": [ + "India can't wait to tell you how much it is afraid of Pakistan" + ] + }, + { + "input": " \u099b\u09be\u098f \u09b6\u09bf\u09ac\u09bf\u09b0\u09c7\u09b0 \u09b8\u09ae\u09df \u0989\u09aa\u09af\u09cb\u0997\u09c0 \u098f\u0995\u099f\u09bf \u0989\u09a6\u09cb\u0997 \u09ac\u09bf\u09b0\u09cb\u09a7\u09bf\u09a4\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u09b0\u09bf\u09b0\u09cb\u09a7\u09bf\u09a4\u09be \u09a8\u09be \u0995\u09b0\u09c7 \u09b8\u0995\u09b2\u09c7 \u098f\u0995\u09a4\u09cd\u09b0\u09c7 \u098f\u0987 \u0995\u09ae\u09b8\u09c2\u099a\u09bf \u09a4\u09c7 \u0985\u0982\u09b6\u0997\u09cd\u09b0\u09b9\u09a8 \u0995\u09b0\u09be \u09a6\u09b0\u0995\u09be\u09b0 \u09ac\u09be\u09b0\u09ae\u09be\u09b0 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09b0\u09be \u0986\u0993\u09df\u09be\u09ae\u09bf\u09b2\u09c0\u0997 \u09ac\u09bf\u098f\u09a8\u09aa\u09bf \u09ac\u09be \u099c\u09be\u09ae\u09be\u09a4\u09c7\u09b0 \u09a8\u09be \u09a4\u09be\u09b0\u09be \u09aa\u09c3\u09a5\u09bf\u09ac\u09c0 \u09b8\u0995\u09b2 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09a6\u09c7\u09b0 \u09ad\u09be\u0987 \u09ac\u09cb\u09a8 ", + "output": [ + "The Burmese Muslims need to participate in this program together without protesting for a useful initiative during the shadow camp" + ] + }, + { + "input": "\u0985\u09a8\u09cd\u09af\u09c7\u09b0 \u09ab\u09be\u09b8\u09bf \u09a8\u09bf\u09df\u09c7 \u0995\u09a4\u099f\u09be \u09ad\u09df\u0982\u0995\u09b0 \u09b9\u09df\u09c7 \u0989\u09a0\u09c7\u099b\u09bf\u09b2 \u098f\u0987 \u09a6\u09bf\u09df\u09be\u099c \u0986\u099c \u09b8\u09c7 \u09a8\u09bf\u099c\u09c7\u0987 \u09ab\u09be\u09b8\u09bf\u09a4\u09c7 \u099d\u09c1\u09b2\u09a4\u09c7 \u09b9\u09b2 \u09aa\u09be\u09aa\u09c7 \u09ac\u09be\u09aa \u0995\u09c7 \u099b\u09be\u09dc\u09c7\u09a8\u09be \u09ac\u09c1\u099d\u09b2\u09c7\u09a8 ", + "output": [ + "How horrible this Diaz became with the execution of another. Today he has to hang himself." + ] + }, + { + "input": "\u09b8\u09ac \u099f\u09bf\u09ad\u09bf \u09a8\u09be\u099f\u09cd\u09af \u09b6\u09bf\u09b2\u09cd\u09aa\u09c0\u09b0\u09be\u0987 \u0995\u09c1\u0995\u09c1\u09b0\u09c7\u09b0 \u09a6\u09b2 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09a8\u09be\u099f\u0995 \u0997\u09c1\u09b2\u09cb \u09ac\u09be\u0982\u09b2\u09be\u09b0 \u09ae\u09be \u09ac\u09cb\u09a8\u09a6\u09c7\u09b0 \u0996\u09be\u09b0\u09be\u09aa \u0995\u09b0\u09be \u09ac\u09cb\u099d\u09c7\u09a8\u09be \u09b8\u09c7 \u09ac\u09cb\u099d\u09c7\u09a8\u09be \u09aa\u09be\u0996\u09bf \u09b8\u09bf\u09b0\u09bf\u09df\u09be\u09b2\u09c7\u09b0 \u09b8\u09ae\u09df \u09b6\u09bf\u09b2\u09cd\u09aa \u0995\u09bf \u09a8\u09bf\u099a\u09c7 \u09a2\u09c1\u0995\u09be\u09a8\u09cb \u099b\u09bf\u09b2 \u0995\u0987 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u099a\u099e\u09cd\u099a\u09b2 \u09af\u09a6\u09bf \u09ac\u09a8\u09cd\u09a7 \u09b9\u09df \u09a4\u09ac\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7 \u09b8\u09bf\u09b0\u09bf\u09df\u09be\u09b2\u09c7\u09b0 \u09b8\u09ae\u09df \u0986\u0997\u09c7 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09a6\u09c7\u09b0 \u09ae\u09c1\u0996 \u0996\u09cb\u09b2\u09be \u09a8\u09be\u09b8\u09cd\u09a4\u09bf\u0995 \u09a4\u09cc\u0995\u09bf\u09b0 \u09ac\u09b0\u09cd\u09a4\u09ae\u09be\u09a8\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09b0 \u099f\u09bf\u09ad\u09bf \u09a8\u09be\u099f\u0995\u09c7 \u09ae\u09c7\u09df\u09c7 \u09b6\u09bf\u09b2\u09cd\u09aa\u09c0\u09a6\u09c7\u09b0 \u09a1\u09cd\u09b0\u09c7\u09b8\u09c7\u09b0 \u0995\u09be\u09b9\u09bf\u09a8\u09c0 \u09a6\u09c7\u0996\u09b2\u09c7 \u09ad\u09be\u09b0\u09a4\u0995\u09c7\u0993 \u09b9\u09be\u09b0 \u09ae\u09be\u09a8\u09be\u09df \u098f\u0997\u09c1\u09b2\u09cb \u09aa\u09b0\u09bf\u09ac\u09b0\u09cd\u09a4\u09a8 \u0995\u09b0 ", + "output": [ + "All TV dramatists are a dog team. Indian dramas don't mean to hurt Bengali mothers and sisters. They don't understand what art was put down during bird serials. Where is Malaun Chanchal? Change these to suit India too" + ] + }, + { + "input": "\u0985\u09cd\u09af\u09be\u099f\u09a8\u09bf \u099c\u09c7\u09a8\u09be\u09b0\u09c7\u09b2 \u09aa\u09a6\u09a4\u09cd\u09af\u09be\u0997 \u0995\u09b0\u09b2\u09c7 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09a6\u09c7\u09b0 \u09ab\u09be\u09b8\u09bf \u09a6\u09c7\u09ac\u09c7 \u0995\u09c7 ", + "output": [ + "Who will hang Razakar if the Attorney General resigns?" + ] + }, + { + "input": "\u09a6\u09be\u09b2\u09be\u09b2 \u0995\u09c7\u09be\u09a5\u09be\u0995\u09be\u09b0 \u09a4\u09b0 \u09af \u09a6\u09bf \u09b2\u099c\u09cd\u099c\u09be \u09a5\u09be \u0995\u09c7 \u0990\u0995\u09cd\u09af\u09c7\u09b0 \u09ac\u09c7\u09aa\u09be \u09b0\u09c7 \u098f\u0995\u099f\u09be \u0995\u09a5\u09be \u09ac\u09b2 \u09ac\u09bf \u09a8\u09be ", + "output": [ + "If the broker is ashamed, don't say a word about unity" + ] + }, + { + "input": "\u09b8\u09c7 \u0997\u09a8\u09cd\u09a7 \u09a8\u09c7\u0993\u09df\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09b0\u09be \u09a6\u09cc\u09b0\u09c7", + "output": [ + "The Malauns ran to get that smell" + ] + }, + { + "input": "\u0986\u09ae\u09be\u09b0 \u09ae\u09a8\u09c7 \u09b9\u09df \u0986\u09aa\u09a8\u09bf \u09a6\u09c1 \u09b2\u09be\u0987\u09a8 \u09ac\u09c7\u09b6\u09bf \u09ac\u09c1\u099d\u09c7\u09a8 \u099a\u09c0\u09a8 \u0986\u099b\u09c7 \u09ac\u09b2\u09c7\u0987 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u0986\u09aa\u09a8\u09be\u09a6\u09c7\u09b0 \u09ac\u09be\u0981\u09b6 \u09a6\u09bf\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 \u0986\u09b0 \u099a\u09c0\u09a8\u09c7\u09b0 \u09b9\u09be\u09a4 \u09af\u09be\u09b0 \u09ae\u09be\u09a5\u09be\u09b0 \u0989\u09aa\u09b0 \u09b8\u09c7 \u09ae\u09be\u09a5\u09be \u09a4\u09c1\u09b2\u09c7 \u09a6\u09be\u09dc\u09be\u099a\u09cd\u099b\u09c7 \u0986\u09ab\u09cd\u09b0\u09bf\u0995\u09be\u09b0 \u0985\u09a8\u09c7\u0995 \u09a6\u09c7\u09b6 \u099a\u09c0\u09a8\u09c7\u09b0 \u0995\u09be\u099b \u09a5\u09c7\u0995\u09c7 \u09b8\u09c1\u09ac\u09bf\u09a7\u09be \u09a8\u09bf\u099a\u09cd\u099b\u09c7 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u0985\u09b8\u09cd\u09a4\u09cd\u09b0 \u099a\u09c0\u09a8\u09c7\u09b0 \u09a6\u09be\u09a8 \u0985\u09ac\u09b6\u09cd\u09af \u098f\u099f\u09be \u09ae\u09be\u09a8\u09a4\u09c7 \u09b9\u09ac\u09c7 \u09af\u09c7 \u09ad\u09be\u09b0\u09a4 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09ad\u09be\u09b2 \u09ac\u09a8\u09cd\u09a7\u09c1 ", + "output": [ + "I think you understand more than two lines that Pakistan can give you bamboo because there is China and the hand of China on whose head he is raising his head. Many African countries are taking advantage of China. Pakistan's arms are donated by China." + ] + }, + { + "input": " \u098f\u09ac\u0982 \u099c\u09be\u09ae\u09be\u09a4 \u09b6\u09bf\u09ac\u09bf\u09b0 \u0995\u09c7 \u09a8\u09bf\u09df\u09c7 \u09b8\u09ae\u09cd\u09ae\u09c7\u09b2\u09a8 \u0995\u09b0\u09c1\u0995 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 ", + "output": [ + "And let Pakistan hold a conference on Jamaat Shibir" + ] + }, + { + "input": "\u09b6\u09c1\u09a7\u09c1 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u0986\u09b0 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b2\u09dc\u09be\u0987\u09df\u09c7 \u09ad\u09be\u09b0\u09a4 \u098f\u0997\u09bf\u09df\u09c7", + "output": [ + "Only Bangladesh and India are ahead in the fight" + ] + }, + { + "input": "\u09ac\u09be\u09b2 \u09aa\u09be\u0995\u09a8\u09be \u09ad\u09be\u09b2\u09cb \u098f\u09a4 \u09ac\u09c7\u09b6\u09bf \u09ac\u09be\u09b2 \u09aa\u09be\u0995\u09a8\u09be \u09ad\u09be\u09b2\u09cb \u09a8\u09be ", + "output": [ + "Bal Pakna is good, so much Bal Pakna is not good" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u09ae\u09b0\u09ac\u09bf \u09b9\u09be\u09b8\u09aa\u09be\u09a4\u09be\u09b2 \u09a8\u09bf\u09df\u09c7 \u09af\u09be\u09ac\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u09b8\u09ac\u09be\u0987 \u0995\u09c7 \u09a1\u09be\u0995\u09ac\u09bf \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u0995\u09be\u0989\u0995\u09c7 \u09aa\u09be\u09ac\u09bf \u09a8\u09be \u09b8\u09ac\u09be\u0987 \u09ad\u09be\u09ac\u09ac\u09c7 \u09aa\u09cd\u09b0\u09be\u0982\u0995 ", + "output": [ + "You call everyone to take Morbi to the hospital but if you don't find anyone, everyone will think prank" + ] + }, + { + "input": "\u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09a6\u09c7\u09b0 \u098f\u0987 \u09b8\u09ae\u09b8\u09cd\u09af\u09be \u09a6\u09c0\u09b0\u09cd\u0998\u09a6\u09bf\u09a8\u09c7\u09b0 \u09af\u09be \u0995\u09bf\u09a8\u09be \u09b6\u09c1\u09a7\u09c1 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09a8\u09be\u09ae\u0995 \u09b0\u09be\u09b7\u09cd\u099f\u099f\u09bf \u09a4\u09be\u09b0 \u09ac\u09b0\u09cd\u09a1\u09be\u09b0 \u0996\u09c1\u09b2\u09c7 \u09a6\u09bf\u09b2\u09c7\u0987 \u09b8\u09ae\u09b8\u09cd\u09af\u09be\u09b0 \u09b8\u09ae\u09be\u09a7\u09be\u09a8 \u09b9\u09ac\u09c7 \u09a8\u09be \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09a6\u09c7\u09b0 \u09a8\u09bf\u09af\u09bc\u09c7 \u0986\u09a8\u09cd\u09a4\u09b0\u09cd\u099c\u09be\u09a4\u09bf\u0995 \u098f\u0995\u099f\u09bf \u0997\u09c1\u09b7\u09cd\u09a0\u09bf \u098f\u0995 \u09a7\u09b0\u09a8\u09c7\u09b0 \u0996\u09c7\u09b2\u09be \u0996\u09c7\u09b2\u09a4\u09c7\u099b\u09c7 \u09af\u09be \u0995\u09bf\u09a8\u09be \u0986\u09aa\u09a8\u09be\u09a6\u09c7\u09b0 \u09ae\u09a4 \u0986\u09ac\u09c7\u0997\u09c0\u09b0\u09be \u09a0\u09bf\u0995 \u09ae\u09a4 \u09ac\u09c1\u099d\u09c7 \u0989\u09a0\u09be\u09b0 \u0986\u0997\u09c7\u0987 \u099a\u09bf\u09b2\u09cd\u09b2\u09be\u0987\u09af\u09bc\u09be \u09ad\u09b0\u09c7 \u09ab\u09c7\u09b2\u099b\u09c7\u09a8 \u098f\u09b0\u09be \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u098f\u09b0\u09be \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09ad\u09be\u0987 \u098f\u09a6\u09c7\u09b0 \u0995\u09c7 \u099c\u09be\u09af\u09bc\u0997\u09be \u09a6\u09c7\u0993\u09af\u09bc\u09be \u09b9\u09cb\u0995 \u0986\u0997\u09c7\u09b0\u09be \u09ac\u09be\u0997\u09c7\u09b0\u09be \u099f\u09be\u0987\u09aa\u09c7\u09b0 \u0986\u09ac\u09c7\u0997\u09c0 \u0995\u09a5\u09be \u09ac\u09b2\u09c7 \u09b6\u09c1\u09a8\u09c7\u09a8 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09a6\u09c7\u09b0 \u0986\u09b6\u09cd\u09b0\u09af\u09bc\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09ae\u09c1\u0995\u09cd\u09a4\u09bf\u09af\u09c1\u09a6\u09cd\u09a7\u09c7\u09b0 \u09b8\u09ae\u09af\u09bc\u09c7\u09b0 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09b6\u09b0\u09a8\u09be\u09b0\u09cd\u09a5\u09c0\u09a6\u09c7\u09b0 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u0986\u09b6\u09cd\u09b0\u09af\u09bc \u09a4\u09c1\u09b2\u09a8\u09be \u0995\u09b0\u09c7 \u09af\u0996\u09a8 \u0995\u09a5\u09be \u09ac\u09b2\u09c7\u09a8 \u09a4\u0996\u09a8 \u09b6\u09bf\u0989\u09b0 \u09b9\u0987 \u0986\u09aa\u09a8\u09bf \u09b6\u09a7\u09c1 \u098f\u0995\u099c\u09a8 \u0989\u0997\u09cd\u09b0\u09ac\u09be\u09a6\u09c0 \u0986\u09b0 \u0995\u09bf\u099b\u09c1 \u09a8\u09be", + "output": [ + "This problem of Rohingyas has been going on for a long time. Even if only Bangladesh opens its border, the problem will not be solved. An international group is playing a kind of game with Rohingyas. Agara Baghera listens to the emotional talk and compares the Rohingya asylum with the asylum seekers of Bangladesh during the liberation war. When I speak, I am sure that you are nothing but an extremist." + ] + }, + { + "input": "\u0997\u09b0\u09c1\u09b0 \u09b9\u09be\u099f\u09c7\u09b0 \u09a7\u09cb\u09b2\u09be\u0987 \u0993 \u09ae\u09be\u09ab \u099a\u09be\u0993\u09df\u09be\u099f\u09be \u0995\u09c7\u09ae\u09a8 \u099b\u09bf\u09b2\u09cb \u0986\u09ac\u09be\u09b2 ", + "output": [ + "Abal was like washing the cattle market and apologizing" + ] + }, + { + "input": "\u09aa\u09c3\u09a5\u09bf\u09ac\u09c0\u09b0 \u09ae\u09be\u099d\u09c7 \u09b8\u09ac\u099a\u09c7\u09df\u09c7 \u0985\u09ad\u09a6\u09cd\u09b0 \u0986\u09b0 \u099c\u09be\u09a8\u09df\u09be\u09b0 \u09ac\u09b2\u09a4\u09c7 \u098f\u0995\u099f\u09be \u09a6\u09c7\u09b6\u0987 \u09b0\u09df\u09c7\u099b\u09c7 \u09a4\u09be\u09b0 \u09a8\u09be\u09ae \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u0986\u09b0 \u09ac\u09be\u0982\u0997\u09be\u09b2\u09c0 \u098f\u0995 \u099c\u09be\u09a8\u09df\u09be\u09b0 \u0995\u09ae\u09c7\u09a8\u09cd\u099f\u09c7 \u09b2\u09bf\u0996\u09c7\u099b\u09c7 \u099f\u09be\u0995\u09be \u09ab\u09c7\u09b0\u09a4 \u09a6\u09bf\u09a4\u09c7 \u098f\u0987\u09b9\u09b2 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u0986\u09b0 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09a4\u09ac\u09c7 \u0986\u09ae\u09be\u09b0 \u09ae\u09a4\u09c7 \u09af\u09be\u09b0\u09be \u09aa\u09be\u0995\u09bf\u09a6\u09c7\u09b0 \u09b8\u09c1\u09b0\u09c7 \u0997\u09be\u09a8\u0997\u09be\u09df \u09a4\u09be\u09a6\u09c7\u09b0 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u099a\u09b2\u09c7 \u09af\u09be\u0993\u09df\u09be \u0989\u099a\u09bf\u09a4 \u0986\u09ae\u09b0\u09be \u09ac\u09bf\u09b0\u09c7\u09b0\u099c\u09be\u09a4\u09bf \u09b9\u09be\u09b0\u09a4\u09c7 \u09b6\u09bf\u0996\u09bf\u09a8\u09c0 \u09ac\u09bf\u099c\u09df\u09c0 \u09b9\u09df\u09c7\u099b\u09bf \u09b8\u09c7\u099f\u09be\u0993 \u09af\u09be\u09a8\u09be \u0986\u099b\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0 \u09b8\u09c7\u0987 \u09b8\u09be\u09b9\u09b8 \u09a8\u09c7\u0987 \u099f\u09be\u0995\u09be \u099a\u09be\u0993\u09df\u09be\u09b0 \u0995\u09c1\u09a4\u09cd\u09a4\u09be \u09b6\u09c1\u09a7\u09c2 \u0998\u09c8\u0993 \u0998\u09c8\u0993 \u0987 \u0995\u09b0\u09a4\u09c7 \u09af\u09be\u09a8\u09c7 \u0986\u09b0 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u0995\u09c7 \u0995\u09bf\u09ad\u09be\u09ac\u09c7 \u0994\u09b7\u09a6 \u09a6\u09bf\u09a4\u09c7 \u09b9\u09df \u09ad\u09be\u0999\u09be\u09b2\u09bf\u09b0\u09be \u09af\u09be\u09a8\u09c7", + "output": [ + "There is only one country in the world that is rude and cruel, its name is Pakistan and Bengali wrote in a commentary, this is our Bangladesh and Razakar to return the money, but in my opinion those who sing in the tune of Pakis should go to Pakistan. Dogs don't have the courage to ask for money." + ] + }, + { + "input": "\u09a4\u09b8\u09b2\u09bf\u09ae\u09be \u09a8\u09be\u09b8\u09b0\u09bf\u09a8\u09c7\u09b0 \u09ae\u09a4 \u09a4\u09c1\u09ae\u09bf \u0993 \u099f\u09be\u0995\u09be \u09aa\u09be\u0993 \u0995\u09be\u09ab\u09c7\u09b0", + "output": [ + "Like Taslima Nasrin, you also get money" + ] + }, + { + "input": "\u09b8\u09c7\u099f\u09be \u0995\u09cb\u09b0\u09cd\u099f\u09c7 \u09ac\u09b2 \u09ad\u09be\u09b0\u09a4\u09c7 \u0986\u09b8\u09a4\u09c7 \u098f\u09a4 \u09ad\u09df \u0995\u09bf\u09b8\u09c7\u09b0 \u09ac\u09be\u09aa \u09ae\u09be\u09b0\u09be \u0997\u09c7\u09b2\u09cb \u09a4\u09be\u0993 \u098f\u09b2\u09bf\u09a8\u09be \u098f\u0996\u09a8 \u09b8\u09be\u09ae\u09cd\u09aa\u09cd\u09b0\u09a6\u09be\u09df\u09c0\u0995 \u09a4\u09be\u09b8 \u0996\u09c7\u09b2\u099b\u09bf\u09b8 \u098f\u09a4\u09c7 \u0995\u09cb\u09a8\u09cb \u09b2\u09be\u09ad \u09b9\u09ac\u09c7 \u09ac\u09b2\u09c7 \u09ae\u09a8\u09c7 \u09b9\u09df\u09a8\u09be \u09aa\u09be\u09b0\u09b2\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7 \u0986\u09df \u0995\u09cb\u09b0\u09cd\u099f\u09c7 \u09af\u09be \u09a8\u09bf\u099c\u09c7\u0995\u09c7 \u09a8\u09bf\u09b0\u09cd\u09a6\u09cb\u09b7 \u09aa\u09cd\u09b0\u09ae\u09be\u09a8 \u0995\u09b0 ", + "output": [ + "Tell it to the court. Why is your father so scared to come to India? Elena is playing communal cards now. It doesn't seem to be of any use." + ] + }, + { + "input": "\u09ae\u09c7\u09df\u09c7\u09b0\u09be \u09ac\u09c7\u0995\u09c1\u09ac\u0987 \u09b9\u09df \u09a8\u09a4\u09c1\u09a8 \u0995\u09bf\u099b\u09c1 \u09a8\u09be \u09b9\u09be \u09b9\u09be \u09b9\u09be", + "output": [ + "The girl is stupid, nothing new ha ha ha" + ] + }, + { + "input": "\u09ae\u09be\u09a8\u09a8\u09c0\u09df \u09aa\u09cd\u09b0\u09a7\u09be\u09a8 \u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0 \u0986\u09aa\u09a8\u09be\u0995\u09c7 \u09ac\u09b2\u099b\u09bf \u09b8\u09cd\u09ac\u09b0\u09a8 \u0995\u09b0\u09c1\u09a3 \u09b8\u09c7\u0987 \u098f\u09b0 \u0995\u09a5\u09be \u09af\u09c7\u09a6\u09bf\u09a8 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09c7\u09b6\u09c7\u09b0 \u099c\u09a8\u0997\u09a3 \u098f\u09b0\u09c1\u09aa \u098f\u0995\u099f\u09bf \u09aa\u09b0\u09bf\u09b8\u09cd\u09a5\u09bf\u09a4\u09bf\u09b0 \u09ae\u09cb\u0995\u09be\u09ac\u09bf\u09b2\u09be \u0995\u09b0\u09c7\u099b\u09bf\u09b2 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09c7\u09b6\u09c7\u09b0 \u0985\u09b8\u09b9\u09be\u09df \u099c\u09a8\u0997\u09a3 \u09b8\u09c7\u09a6\u09bf\u09a8 \u09ac\u09bf\u09a7\u09b0\u09cd\u09ae\u09c0 \u09b0\u09be\u09b7\u09cd\u099f\u09cd\u09b0 \u09ad\u09be\u09b0\u09a4 \u09a4\u09be\u09a6\u09c7\u09b0 \u09b8\u09bf\u09ae\u09be\u09a8\u09cd\u09a4\u0995\u09c7 \u0989\u09a8\u09cd\u09ae\u0995\u09cd\u09a4 \u0995\u09b0\u09c7 \u09a6\u09bf\u09df\u09c7 \u0995\u09cb\u099f\u09be\u09b0 \u0993 \u09ac\u09c7\u09b6\u09bf \u09b8\u09cd\u09ac\u09b0\u09a8\u09be\u09b0\u09cd\u09a5\u09c0\u0995\u09c7 \u0986\u09b6\u09cd\u09b0\u09df \u09a6\u09c7\u09df \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09aa\u09b0\u09bf\u09b8\u09cd\u09a5\u09bf\u09a4\u09bf \u0985\u09a8\u09c1\u0995\u09c1\u09b2\u09c7 \u0986\u09b6\u09be\u09df \u09ac\u09be\u0982\u09b2\u09be\u09b0 \u099c\u09a8\u0997\u09a3 \u0986\u09ac\u09be\u09b0 \u09ac\u09be\u0982\u09b2\u09be\u09df \u09ab\u09bf\u09b0\u09c7 \u0986\u09b0 \u0986\u09ae\u09bf \u0993 \u099a\u09be\u09df \u098f\u0987 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09a6\u09c7\u09b0 \u098f\u09ae\u09a8 \u098f\u0995\u099f\u09bf \u09b8\u09c1\u099c\u09cb\u0997 \u09a6\u09c7\u0993\u09df\u09be \u09b9\u09cb\u0995 \u09a6\u09c1\u09b0\u09cd\u09a6\u09bf\u09a8 \u09b8\u09be\u09b0\u09be\u099c\u09c0\u09ac\u09a8 \u09a5\u09be\u0995\u09c7\u09a8\u09be \u09b8\u09c1 \u09a6\u09bf\u09a8 \u0993 \u0986\u09b8\u09c7 \u09af\u09c7\u09ae\u09a8\u09bf \u098f\u09b8\u09c7\u099b\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u0986\u09b0\u09be \u09b8\u09c7\u0987 \u09a6\u09bf\u09a8\u09c7\u09b0 \u0995\u09a5\u09be \u09b8\u09cd\u09ac\u09b0\u09a8 \u0995\u09b0\u09c7 \u09ad\u09be\u09b0\u09a4\u0995\u09c7 \u0986\u099c\u0993 \u09b8\u09ae\u09cd\u09ae\u09be\u09a8\u09c7\u09b0 \u0986\u09b8\u09a8 \u0989\u09a8\u09cd\u09ae\u0995\u09cd\u09a4 \u0995\u09b0\u09c7 \u09a6\u09c7\u0993\u09df\u09be \u09b9\u09df \u0986\u09ae\u09bf", + "output": [ + "Hon'ble Prime Minister, I am telling you, Swaran Karun, on the day when the people of our country faced such a situation, the helpless people of our country, the infidel state of India opened their borders and gave shelter to the quota and more Swaranarthi but the people of Bengal returned to Bengal I want these Rohingyas to be given such an opportunity. There will be no misery for the rest of their lives. Good days come and go." + ] + }, + { + "input": "\u0993\u0987 \u0995\u09c1\u0995\u09c1\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09ae\u09c7\u09df\u09c7 \u09a6\u09c7\u0996\u09b2\u09c7 \u09a6\u09a8 \u0996\u09be\u09b0\u09be \u09b9\u09df\u09c7 \u09af\u09be\u0987 \u09a8\u09be\u0995\u09bf \u09b8\u09be\u09b2\u09be\u09b0 ", + "output": [ + "When I see the baby girl of this dog, Dhoni gets up or Salar" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09b8\u09c0\u09ae\u09be\u09a8\u09cd\u09a4\u09b0\u0995\u09cd\u09b7\u09c0 \u09ac\u09be\u09b9\u09bf\u09a8\u09c0 \u09ac\u09bf\u098f\u09b8\u098f\u09ab \u099a\u09c0\u09a8 \u09b8\u09c0\u09ae\u09be\u09a8\u09cd\u09a4\u09c7 \u09a6\u09c1\u0987\u099c\u09a8 \u099a\u09c0\u09a8\u09be \u09a8\u09be\u0997\u09b0\u09bf\u0995\u0995\u09c7 \u0997\u09c1\u09b2\u09bf \u0995\u09b0\u09c7 \u0995\u09bf \u09b9\u09a4\u09cd\u09af\u09be \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09c7 \u09a8\u09bf\u09b6\u09cd\u099a\u0987 \u09a8\u09be \u099a\u09c0\u09a8\u09be \u09a8\u09be\u0997\u09b0\u09bf\u0995\u0995\u09c7 \u0997\u09c1\u09b2\u09bf \u0995\u09b0\u09c7 \u09b9\u09a4\u09cd\u09af\u09be\u09b0 \u09b8\u0999\u09cd\u0997\u09c7 \u09b8\u0999\u09cd\u0997\u09c7\u0987 \u09af\u09c1\u09a6\u09cd\u09a7 \u09b6\u09c1\u09b0\u09c1 \u09b9\u09a4 \u09aa\u09be\u0995 \u09ad\u09be\u09b0\u09a4 \u09b8\u09c0\u09ae\u09be\u09a8\u09cd\u09a4\u09c7\u0993 \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09b8\u09c0\u09ae\u09be\u09a8\u09cd\u09a4\u09b0\u0995\u09cd\u09b7\u09c0 \u09ac\u09be\u09b9\u09bf\u09a8\u09c0 \u098f\u0987 \u09a6\u09c1\u0987\u099c\u09a8 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c0 \u09a8\u09be\u0997\u09b0\u09bf\u0995\u0995\u09c7 \u0997\u09c1\u09b2\u09bf \u0995\u09b0\u09c7 \u09b9\u09a4\u09cd\u09af\u09be \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09c7 \u09a8\u09be \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ac\u09a8\u09cd\u09a7\u09c1 \u09b0\u09be\u09b7\u09cd\u099f\u09cd\u09b0 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u099b\u09cb\u099f \u09b0\u09be\u09b7\u09cd\u099f\u09cd\u09b0 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u099a\u09c0\u09a8\u09c7\u09b0 \u09ae\u09a4\u09cb \u09b6\u0995\u09cd\u09a4\u09bf \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09a8\u09be\u0987 \u09ae\u09be\u09a8\u09b2\u09be\u09ae \u09af\u09c7 \u09a6\u09c1\u099c\u09a8 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09bf \u09ac\u09bf\u098f\u09b8\u098f\u09ab\u09c7\u09b0 \u0997\u09c1\u09b2\u09bf\u09a4\u09c7 \u09a8\u09bf\u09b9\u09a4 \u09b9\u09df\u09c7\u099b\u09c7 \u09a4\u09be\u09b0\u09be \u099a\u09cb\u09b0\u09be\u0995\u09be\u09b0\u09ac\u09be\u09b0\u09bf \u09ae\u09be\u09a6\u0995 \u09ac\u09cd\u09af\u09ac\u09b8\u09be\u09df\u09c0 \u09b9\u09df\u09a4\u09cb\u09ac\u09be \u09a4\u09be\u09b0\u09be \u0997\u09b0\u09c1 \u0986\u09a8\u09a4\u09c7 \u0997\u09bf\u09df\u09c7\u099b\u09bf\u09b2 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b8\u09c0\u09ae\u09be\u09a8\u09cd\u09a4\u09c7 ", + "output": [ + "Can Indian Border Security Force (BSF) shoot and kill two Chinese nationals on the Chinese border? Surely, the war started with the shooting death of a Chinese national. Bangladesh is not as strong as Pakistan or China. I believe that two Bangladeshis were killed in BSF firing. They are smugglers, drug dealers." + ] + }, + { + "input": "\u098f\u09ae\u09a8 \u098f\u0995\u099f\u09be \u09aa\u09be\u0987\u09b2\u09c7 \u098f\u0995 \u0995\u09ae \u0995\u09b0\u09c7 \u09b9\u09b2\u09c7\u0993 \u098f\u0995 \u09b0\u09be\u09a4\u09c7 \u099a\u09be\u09b0\u099f\u09bf \u09b8\u099f \u09a6\u09bf\u09a4\u09be\u09ae ", + "output": [ + "If I got one, I would give four shots in one night even if it was less" + ] + }, + { + "input": "\u098f\u09b0\u09be \u0986\u09b8\u09b2\u09c7\u0987 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09a4\u09be\u0987 \u09a8\u09be \u0995\u0996\u09a8 \u0993 \u09ac\u09dc\u09c1\u0987 \u0997\u09be\u099b\u09c7 \u0989\u09a0\u099b\u09c7\u09a8 \u09a8\u09be \u0989\u09a0\u09c7 \u09a5\u09be\u0995\u09b2\u09c7 \u0986\u099c\u0987 \u0997\u09be\u099b\u09c7 \u0989\u09a0\u09c7 \u09a6\u09c7\u0996\u09ac\u09c7\u09a8 \u09a8\u09bf\u099a\u09c7\u09b0 \u09a6\u09bf\u0995\u09c7 \u098f\u0995\u099c\u09a8 \u0995\u09c7 \u0995\u09df \u099c\u09a8 \u09a6\u09c7\u0996\u09be \u09af\u09be\u09df \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09ac\u09b2\u099b\u09c7\u09a8 \u09ac\u09bf \u098f\u09a8 \u09aa\u09bf \u0995\u09c7 \u09a6\u09c7\u0996\u09c1\u09a8 \u09a4\u09cb \u098f\u09a6\u09c7\u09b0 \u09a8\u09be\u09ae \u099c\u09be\u09a8\u09c7\u09a8 \u0995\u09bf \u0996\u09a8\u09a6\u0995\u09be\u09b0 \u09ae\u09cb\u09b6\u09be\u09b0\u09ab \u09af\u09bf\u09a8\u09bf \u09b6\u09c7\u0996 \u09b9\u09be\u09b8\u09bf\u09a8\u09be\u09b0 \u09ac\u09c7\u09df\u09be\u0987 \u09ae\u09b9\u09bf\u0989\u09a6\u09a6\u09bf\u09a8 \u0986\u09b2\u09ae\u0997\u09c0\u09b0 \u09ae\u09cb\u099c\u09be\u09ab\u09ab\u09b0 \u09af\u09bf\u09a8\u09bf \u0986\u0993\u09df\u09be\u09ae\u09c0\u09b2\u09c0\u0997 \u098f\u09b0 \u09b8\u09ad\u09be\u09aa\u09a4\u09bf\u09ae\u09a8\u09a1\u09b2\u09bf\u09b0 \u09b8\u09a6\u09b8\u09cd\u09af \u0986\u09b0\u09cb \u09a6\u09c7\u0996\u09be\u09ac\u09cb \u09a8\u09be \u099c\u09be\u09a8\u09bf \u0995\u09b7\u099f \u09aa\u09be\u09ac\u09c7\u09a8 \u09ae\u09a8\u09c7 \u09b0\u09be\u0996\u09ac\u09c7\u09a8 \u0995\u09a5\u09be\u09df \u09ac\u09b2\u09c7 \u098f\u0995 \u09ae\u09be\u0998\u09c7 \u09b6\u09c0\u09a4 \u09af\u09be\u09df \u09a8\u09be \u09ae\u09be\u0998 \u0986\u09ac\u09be\u09b0 \u0998\u09c1\u09b0\u09c7 \u09ab\u09bf\u09b0\u09c7 \u0986\u09b8\u09ac\u09c7\u0987 \u09af\u09a4\u09cb\u099f\u09c1\u0995\u09c1 \u09b2\u09bf\u0996\u09b2\u09be\u09ae \u09a4\u09be\u09b0 \u09ad\u09bf\u09a4\u09b0 \u09b8\u09c1\u0987 \u09a1\u09c1\u0995\u09be\u09a8\u09cb\u09b0 \u09b9\u09bf\u09ae\u09ae\u09a4 \u09a5\u09be\u0995\u09b2\u09c7 \u09ac\u09b2\u09ac\u09c7\u09a8 \u0986\u09ae\u09be\u09df \u0986\u09ae\u09bf \u09ae\u09c1\u0995\u09cd\u09a4\u09bf\u09af\u09cb\u09a6\u09cd\u09a7\u09be \u0986\u09ae\u09be\u0995\u09c7 \u0995\u09b0\u09be \u0995\u09b7\u099f \u0995", + "output": [ + "They are really razakars, so if they don't climb the tree, you will see how many people can be seen in the trees today. Razakars say look at the BNP. Do you know their names? Khandaker Mosharraf I don't want to show more members, I don't know, I will get in trouble." + ] + }, + { + "input": "\u09ac\u09dc \u09a7\u09cb\u0981\u0995\u09be\u09ac\u09be\u099c \u09a4\u09be\u09b0\u09be \u0995\u09be\u09ab\u09c7\u09b0\u09a6\u09c7\u09b0 \u09aa\u0995\u09cd\u09b7\u09c7 \u09ac\u09dc \u0986\u0997\u09c1\u09df\u09be\u09a8 \u0997\u09b2\u09be\u09ac\u09be\u099c \u0986\u09b0 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09a8\u09bf\u09b0\u09cd\u09af\u09be\u09a4\u09a8\u09c7\u09b0 \u09ac\u09bf\u09b0\u09c1\u09a6\u09cd\u09a7\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0 \u09ae\u09c1\u0996\u09c7 \u09a0\u09c1\u09b8\u09bf \u09aa\u09b0\u09be\u09a8\u09cb \u09a5\u09be\u0995\u09c7 \u09aa\u09b6\u09cd\u099a\u09bf\u09ae\u09be\u09a6\u09c7\u09b0 \u098f\u0995\u09a8\u09bf\u09b7\u09cd\u09a0 \u09a6\u09be\u09b2\u09be\u09b2 \u0986\u09b2\u09cd\u09b2\u09be\u09b9\u09b0 \u09a6\u09c1\u09b6\u09ae\u09a8 \u098f\u0996\u09a8 \u09b6\u09c7\u09b7 \u09ac\u09c7\u09b2\u09be\u09df \u098f\u09b8\u09c7 \u0996\u09c1\u09ac \u09a6\u09b0\u09a6 \u09a6\u09c7\u0996\u09be\u09a8\u09cb \u09b9\u099a\u09cd\u099b\u09c7 \u098f\u09b8\u09ac \u09ad\u09a8\u09cd\u09a1\u09be\u09ae\u09bf \u0986\u09ae\u09b0\u09be \u09ac\u09c1\u099d\u09bf \u0995\u09cb\u09a5\u09be\u09df \u0997\u09c7\u099b\u09c7 \u0986\u099c \u099c\u09be\u09a4\u09bf\u09b8\u0982\u0998 \u0993\u09df\u09be\u0987\u09b8\u09bf\u0993 \u0995\u09cb\u09a5\u09be\u09df \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09a8\u09bf\u09b0\u09cd\u09af\u09be\u09a4\u09bf\u09a4 \u09b9\u09b2\u09c7 \u09ad\u09be\u09b0\u09a4 \u0995\u09be\u0981\u09a6\u09c7 \u0996\u09c3\u09b7\u09cd\u099f\u09be\u09a8 \u09b9\u09b2\u09c7 \u0986\u09ae\u09c7\u09b0\u09bf\u0995\u09be \u0995\u09be\u0981\u09a6\u09c7 \u0987\u09b9\u09c1\u09a6\u09bf \u09b9\u09b2\u09c7 \u0987\u099c\u09b0\u09be\u0987\u09b2 \u0995\u09be\u0981\u09a6\u09c7 \u09ac\u09cc\u09a6\u09cd\u09a7 \u09b9\u09b2\u09c7 \u099a\u09c0\u09a8 \u0995\u09be\u0981\u09a6\u09c7 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u09a8\u09bf\u09b0\u09cd\u09af\u09be\u09a4\u09bf\u09a4 \u09b9\u09b2\u09c7 \u0995\u09cb\u09a8 \u09a6\u09c7\u09b6 \u0995\u09be\u0981\u09a6\u09c7 \u09a8\u09be \u09ae\u09bf\u09df\u09be\u09a8\u09ae\u09be\u09b0\u09c7 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09a6\u09c7\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf \u09ac\u09b0\u09cd\u09ac\u09b0 \u09a8\u09bf\u09b0\u09cd\u09af\u09be\u09a4\u09a8 \u09a6\u09c7\u0996\u09c7 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u0995\u09bf \u098f\u0995\u099f\u09c1\u0993 \u09ae\u09a8 \u0995\u09be\u0981\u09a7\u09c7 \u09a8\u09be \u098f\u0987 \u0995\u09c7\u09ae\u09a8 \u09a8", + "output": [ + "They are big deceivers, they are big advocates for the infidels and they are shoving their mouths against the persecution of Muslims. If Israel cries, Buddhism cries, China cries, Muslims are persecuted, no country cries." + ] + }, + { + "input": "\u0995\u09bf\u099b\u09c1 \u09b2\u09bf\u0996\u09b2\u09c7\u0987 \u099c\u09bf\u09df\u09be \u09aa\u09b0\u09bf\u09ac\u09be\u09b0 \u09ac\u09bf\u098f\u09a8\u09aa\u09bf \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09b6\u09bf\u09ac\u09bf\u09b0 \u099c\u09be\u09ae\u09be\u09a4 \u0986\u09b0\u09c7 \u09ad\u09be\u0987 \u098f\u099f\u09be \u0997\u09a8\u09a4\u09a8\u09cd\u09a4\u09cd\u09b0\u09a6\u09c7\u09b6 \u09b8\u09ac\u09be\u0987\u0995\u09c7 \u09ac\u09b2\u09be\u09b0 \u0985\u09a7\u09bf\u0995\u09be\u09b0 \u09a6\u09bf\u09df\u09c7\u099b\u09c7 \u09a4\u09be\u0987 \u0986\u09ae\u09bf \u09ac\u09b2\u09c7\u099b\u09bf \u09a4\u09be\u09a4\u09c7 \u0986\u09aa\u09a8\u09be\u09a6\u09c7\u09b0 \u0997\u09be\u0981 \u099c\u09b2\u09c7 \u0995\u09c7\u09a8 \u099a\u09cb\u09b0\u09c7\u09b0 \u09ae\u09a8 \u09aa\u09c1\u09b2\u09bf\u09b6 \u09aa\u09c1\u09b2\u09bf\u09b6 \u09a4\u09be\u0987 \u09a8\u09be", + "output": [ + "If you write anything, Zia family, BNP, Razakar Shibir, Jamaat, brother, it is a democracy, everyone has the right to say so, so I said, why is the mind of a thief in the water of your village, not the police?" + ] + }, + { + "input": "\u09b8\u09c7 \u09a4\u09cb \u09ac\u09b0\u09bf\u09b6\u09be\u09b2\u09c7\u09b0 \u099b\u09c7\u09b2\u09c7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u0995\u09c7\u09ae\u09a8 \u0995\u09b0\u09c7 \u09a8\u09bf\u099c\u09c7\u09b0 \u09ac\u09bf\u09ad\u09be\u0997\u0995\u09c7 \u09b9\u09be\u09b0\u09bf\u09df\u09c7 \u09a6\u09bf\u09b2 \u09b8\u09c7 \u09a4\u09cb \u09ac\u09dc \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09b8\u09be\u09ac\u09bf\u09ac\u09b0", + "output": [ + "He is the son of Barisal but how he lost his division is the big Razakar Sabibar" + ] + }, + { + "input": "\u09b8\u09a4\u09cd\u09af\u09bf \u099c\u09be\u09ae\u09a6\u09be\u09a8\u09c0 \u09b6\u09be\u09dc\u09bf\u09a4\u09cb \u09ad\u09be\u09b0\u09a4\u09c0 \u09ac\u09be\u0982\u09b2\u09be \u09b8\u09bf\u09b0\u09bf\u09df\u09be\u09b2\u09c7 \u09b8\u09ac\u09b8\u09ae\u09df \u09a6\u09c7\u0996\u09bf ", + "output": [ + "I always watch Indian Bangla serials in true Jamdani sarees" + ] + }, + { + "input": "\u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09af\u09a6\u09bf \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u0989\u09aa\u09b0 \u0995\u09cb\u09a8 \u09b8\u09b9\u09bf\u0982\u09b8\u09a4\u09be \u0998\u099f\u09c7 \u09a4\u09be\u09b9\u09b2\u09c7 \u09ad\u09be\u09b0\u09a4 \u0989\u09a6\u09cd\u09ac\u09c7\u0997 \u099c\u09be\u09a8\u09be\u09df \u09b6\u09c1\u09a7\u09c1 \u09ad\u09be\u09b0\u09a4 \u09a8\u09df \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u0993 \u0985\u09a8\u09c7\u0995 \u09ae\u09be\u09a8\u09ac\u09be\u09a7\u09bf\u0995\u09be\u09b0 \u0995\u09b0\u09cd\u09ae\u09bf \u098f\u09ac\u0982 \u09ac\u09bf\u09b6\u09bf\u09b7\u09cd\u099f \u099c\u09a8\u09c7\u09b0\u09be \u099a\u09bf\u09a8\u09cd\u09a4\u09bf\u09a4 \u09a5\u09be\u0995\u09c7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09ad\u09be\u09b0\u09a4\u09c7 \u098f\u09ac\u0982 \u0985\u09a8\u09cd\u09af\u09be\u09a8\u09cd\u09af \u09a6\u09c7\u09b6\u09c7 \u09af\u09a6\u09bf \u0995\u09cb\u09a8 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09c7\u09b0 \u0989\u09aa\u09b0 \u0985\u09a4\u09cd\u09af\u09be\u099a\u09be\u09b0 \u0995\u09b0\u09be \u09b9\u09df \u09a4\u0996\u09a8 \u0995\u09cb\u09a8 \u09ae\u09be\u09a8\u09ac\u09be\u09a7\u09bf\u0995\u09be\u09b0 \u0995\u09b0\u09cd\u09ae\u09bf \u098f\u09ac\u0982 \u0995\u09cb\u09a8 \u09ac\u09bf\u09b6\u09bf\u09b7\u09cd\u099f \u099c\u09a8 \u0996\u09bf\u099c\u09c7 \u09aa\u09be\u0993\u09df\u09be \u09af\u09be\u09df\u09a8\u09be \u09a4\u0996\u09a8 \u09a4\u09be\u09b0\u09be \u0995\u09bf\u099b\u09c1 \u09a6\u09c7\u0996\u09a4\u09c7 \u09aa\u09be\u09df\u09a8\u09be \u09b6\u09c1\u09a8\u09a4\u09c7\u0993 \u09aa\u09be\u09df\u09a8\u09be", + "output": [ + "India is concerned if there is any violence against Hindus in Bangladesh Many human rights activists and prominent people are concerned not only in India but also in Bangladesh Can't even hear" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u098f\u0995\u099f\u09be \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09b0\u09be\u09b7\u09cd\u099f\u09cd\u09b0 \u09b9\u09df\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u09b8\u09be\u09b9\u09be\u09af\u09cd\u09af \u0995\u09b0\u09c7\u099b\u09c7 \u09a0\u09be\u0987 \u09a6\u09bf\u09df\u09c7\u099b\u09c7 \u0986\u09ac\u09be\u09b0 \u09b6\u09a4\u09cd\u09b0\u09c1\u09b0 \u09ac\u09bf\u09b0\u09c1\u09a6\u09cd\u09a7\u09c7 \u09af\u09c1\u09a6\u09cd\u09a7 \u0995\u09b0\u09c7\u099b\u09c7 \u0986\u09b0 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09b9\u09df\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u09b8\u09be\u09b9\u09be\u09af\u09cd\u09af \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7\u09a8 \u09a8\u09be", + "output": [ + "India has become a Hindu state and has helped the Muslims. Again it has fought against the enemy and Bangladesh cannot help the Muslims by becoming a Muslim." + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u09b0 \u0993\u09b0 \u0986\u09ac\u09cd\u09ac\u09be \u098f\u0995 \u0997\u09cb\u09b2 \u09a6\u09bf\u09b2\u09c7\u0987 \u09af\u09be\u09a6\u09c1 \u09a4\u09cb\u0997\u09c7\u09b0 \u09ac\u09bf\u099a\u09be\u09b0\u09bf\u0995 \u099e\u09cd\u099c\u09be\u09a8\u09c7\u09b0 \u09a6\u09cb\u09a8 \u0993 \u09a8\u09c7\u0987 \u09b6\u09be\u09b2\u09be\u09b0\u09be \u0993\u0987 \u09a6\u09bf\u09a8 \u098f\u0995\u09be\u0987 \u09aa\u09be\u099a \u09aa\u09be\u099a \u099f\u09be \u0997\u09cb\u09b2 \u09a6\u09bf\u099b\u09c7 \u09a4\u09be\u09b0 \u0995\u09cb\u09a8 \u0996\u09ac\u09b0 \u09a8\u09c7\u0987", + "output": [ + "There is no news that if the father of a bitch's polar bear scored a goal, he would not have the judicial knowledge of magic." + ] + }, + { + "input": "\u09aa\u09c1\u09b0\u09be \u09ac\u09c7\u09b6\u09cd\u09af\u09be \u09ae\u09be\u0997\u09c0 ", + "output": [ + "The whole whore begs" + ] + }, + { + "input": "\u09a4\u09be\u09b0\u09bf\u09ab \u09b9\u09be\u09b8\u09be\u09a8 \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09a4\u09c7 \u0995\u09bf \u09a4\u09c1\u09b0\u09c7 \u09ae\u09be\u0995\u09c7 \u09ad\u09be\u09a1\u09be \u09a6\u09c7\u099a \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09ae\u09c1\u09b8\u09cd\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf \u09a6\u09b0\u09a6 \u09a8\u09be\u0987 \u09b6\u09be\u09b2\u09be \u09ae\u09c1\u09a8\u09be\u09ab\u09c7\u0995 \u09ae\u09be\u09a6\u09be\u09b0\u09bf\u099a\u09c1\u09a6", + "output": [ + "Tarif Hasan Randia Ki Ture Make Bhada Dech Malaun's Baby Has No Compassion For Muslims Shala Munafek Madarichud" + ] + }, + { + "input": "\u09b0\u09ac\u09bf\u09a8 \u09a4\u09cb\u09ae\u09be\u09b0 \u099c\u09a8\u09cd\u09ae \u09ae\u09a8\u09c7 \u09b9\u09df \u09ad\u09be\u09b0\u09a4\u09c7", + "output": [ + "Robin I think you were born in India" + ] + }, + { + "input": "\u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09b0 \u09b8\u09b0\u0995\u09be\u09b0 \u0985\u09a8\u09cd\u09a7 \u0986\u09b0 \u09ad\u09be\u09b0\u09a4 \u09b8\u09b0\u0995\u09be\u09b0 \u0995\u09be\u09a8\u09be", + "output": [ + "The government of Bangladesh is blind and the government of India is blind" + ] + }, + { + "input": "\u0990 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09b8\u09ae\u09df \u099f\u09bf\u09ad\u09bf \u09a4\u09cb\u09a6\u09c7\u09b0 \u0995\u09c7 \u099c\u09c1\u09a4\u09be \u09aa\u09bf\u099f\u09be \u0995\u09b0\u09ac \u098f\u09b0\u09be \u0985\u09b8\u09b9\u09be\u09df \u09ae\u09be\u09a8\u09c1\u09b7 \u098f\u09a6\u09c7\u09b0 \u09a8\u09bf\u0989\u099c \u09a4\u09c8\u09b0\u09c0 \u0995\u09b0\u09a4\u09c7 \u09b0\u09be\u09a4 \u099c\u09be\u0997\u09b8 \u0985\u09a5\u099a \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u0985\u09ac\u09c8\u09a7\u09ad\u09be\u09ac\u09c7 \u098f\u09a8\u09c7 \u098f\u0987 \u09a6\u09c7\u09b6\u09c7 \u09aa\u09c1\u09b2\u09bf\u09b6\u09c7\u09b0 \u099a\u09be\u0995\u09b0\u09bf \u09a6\u09bf\u099b\u09c7 \u09b8\u09c7\u0987 \u09a8\u09bf\u0989\u099c \u0995\u0987 \u09ad\u09be\u09b2\u09cb \u09b9\u09df\u09c7 \u09af\u09be", + "output": [ + "I will beat your shoes on the TV when you are a child of a prostitute. They are helpless people." + ] + }, + { + "input": "\u09b9\u09c1 \u09a0\u09bf\u0995\u09bf \u09ac\u09b2\u099b\u09c7\u09a8 \u09ad\u09be\u09b0\u09a4 \u09af\u09a6\u09bf \u098f\u09b0 \u099c\u09ac\u09be\u09ac\u09c7 \u09b0\u09be\u09a8\u09c7 \u0985\u09b2 \u0986\u0989\u099f \u09b9\u09df \u09a4\u09be\u09b9\u09b2\u09c7 \u098f\u09b0 \u09ac\u09c7\u09b6\u09bf \u09b0\u09be\u09a8 \u0995\u09b0\u09be\u09b0 \u0995\u09bf \u09a6\u09b0\u0995\u09be\u09b0 \u0986\u099b\u09c7 ", + "output": [ + "Hu is right when he says that if India are all out for a run, then what is the need to score more runs" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf \u09af\u09be \u09a6\u09c1\u09a7 \u09b0\u09c7 \u09b8\u09ac \u0996\u09c1\u09b2 ", + "output": [ + "Ask for all the milk" + ] + }, + { + "input": " \u0987\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09df \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09b0\u09be \u0995\u09c1\u0993\u09be\u09b0 \u09b8\u09be\u09a5\u09c7 \u09ac\u09bf\u09ac\u09be\u09b9 \u0995\u09b0\u099b\u09c7 \u0997\u09b0\u09c1\u09b0 \u09ae\u09c2\u09a4 \u0996\u09be\u09df ", + "output": [ + "India Malauns are married to wells and eat cow urine" + ] + }, + { + "input": "\u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09b8\u09b0\u0995\u09be\u09b0 \u098f \u09af\u09c1\u09a6\u09cd\u09ac\u09c7 \u09a8\u09bf\u09b9\u09a4 \u09ad\u09be\u09b0\u09a4\u09c0\u09df\u09a6\u09c7\u09b0 \u0985\u09b0\u09cd\u09a5 \u09a6\u09bf\u09ac\u09c7 \u09b8\u09c7\u099f\u09be \u09ad\u09be\u09b2\u09cb \u0995\u09a5\u09be \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u098f \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09b8\u09c8\u09a8\u09cd\u09af\u09b0\u09be \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09a5\u09c7\u0995\u09c7 \u09af\u09c7 \u09b8\u09ae\u09cd\u09aa\u09b0 \u09b2\u09c1\u099f \u0995\u09b0\u09c7\u099b\u09c7 \u09b8\u09c7\u099f\u09be \u0995\u09bf \u09b8\u09b0\u0995\u09be\u09b0 \u09ab\u09bf\u09b0\u09bf\u09df\u09c7 \u0986\u09a8\u09ac\u09c7 \u09ab\u09bf\u09b0\u09bf\u09df\u09c7 \u0986\u09a8\u09ac\u09c7 \u0995\u09bf \u09b9\u09be\u099c\u09be\u09b0\u09cb \u09a8\u09bf\u09b0\u09be\u09aa\u09b0\u09be\u09a7 \u09ab\u09c7\u09b2\u09be\u09a8\u09c0\u09b0 \u0996\u09c1\u09a8\u09c7\u09b0 \u09ae\u09c1\u09b2\u09cd\u09af \u09aa\u09be\u09b0\u09ac\u09c7 \u09a8\u09be \u09b8\u09b0\u0995\u09be\u09b0 \u09ae\u09c1\u09b2\u09a4 \u098f\u09b0 \u09ae\u09be\u09a7\u09cd\u09af\u09ae\u09c7 \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u0997\u09cb\u09b2\u09be\u09ae\u09bf\u09b0 \u09aa\u09b0\u09c0\u0995\u09cd\u09b7\u09be\u09df \u0989\u09ce\u09a4\u09cd\u09a4\u09c0\u09b0\u09cd\u09a8 \u09b9\u0993\u09df\u09be\u09b0 \u099a\u09c7\u09b7\u09cd\u099f\u09be \u0995\u09b0\u099b\u09c7", + "output": [ + "It is a good thing that the Bangladesh government will pay the Indians killed in this war, but will the government bring back the money looted from Bangladesh by these Indian soldiers or will it not be able to pay for the murder of thousands of innocent people? The government is basically trying to pass the test of Indian slavery." + ] + }, + { + "input": " \u0986\u09b8\u09c7\u09be\u09b2\u09c7 \u09ac\u09bf\u098f\u09a8\u09aa\u09bf \u098f\u0995\u099f\u09be \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09b8\u09ad\u09be\u09df \u099c\u09c7\u09a8\u09c7 \u0997\u09c7\u099b\u09c7 ", + "output": [ + "The real BNP came to know in a Razakar meeting" + ] + }, + { + "input": "\u0986\u09b0\u09cb \u0995\u09bf\u099b\u09c1 \u09b6\u09c1\u09b9\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09a4\u09cb\u09b0 \u0986\u09b0\u09cb \u09a4\u09cb\u09b0 \u09ac\u09be\u09aa \u0986\u099b\u09c7 \u09a4\u09be\u09b0\u09be\u0993 \u0995\u09bf\u099b\u09c1 \u0995\u09b0\u09b2\u09c7 \u09b8\u09c7\u099f\u09be \u09a0\u09bf\u0995 \u0986\u099b\u09c7 \u0986\u09b0 \u099c\u09be\u0995\u09bf\u09b0 \u09a8\u09be\u09df\u09c7\u0995 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09b2\u09c0\u0997\u09c7\u09b0 \u09a4\u09be\u0987 \u09b8\u09c7 \u09b8\u09a8\u09cd\u09a4\u09be\u09ac\u09be\u09a7\u09bf \u09ad\u09be\u09b0\u09a4\u09c7 \u0986\u09b0\u09cb \u09a8\u09c7\u09a4\u09be \u0986\u099b\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0 \u09a6\u09b0", + "output": [ + "You have more fathers, you have more fathers. If they do something, it's okay." + ] + }, + { + "input": "\u0986\u0997\u09c7\u09b0 \u09b8\u09c7\u09a8\u09be \u0986\u099b\u09bf\u09b2\u09cb \u09aa\u09be\u0997\u09b2 \u0986\u09b0 \u098f\u0996\u09a8 \u098f\u099f\u09be \u09aa\u09be\u0997\u09b2 \u09a8\u09bf\u0989\u099c\u09aa\u09c7\u09aa\u09be\u09b0 \u099c\u09c7 \u09b2\u09bf\u0996\u09c7\u099b\u09c7 \u0993\u0987 \u09b8\u09be\u09b2\u09be\u09df \u098f\u0995\u099f\u09bf \u099b\u09be\u0997\u09b2 \u09b6\u09be\u09b2\u09be\u09b0 \u09aa\u09cb \u0993\u0987 \u09b8\u09c7\u09a8\u09be \u09ad\u09be\u09b0\u09a4 \u099a\u09c1\u09a6\u09c7\u09a8\u09be \u09ae\u09be\u09a6\u09be\u09b0 \u099a\u09cb\u09a6 \u098f\u0987 \u09b0\u0995\u09ae \u09b2\u09bf\u0995\u09b2\u09c7 \u09a4\u09cb\u09b0 \u09a8\u09bf\u0989\u099c \u09aa\u09c7\u09aa\u09be\u09b0\u09c7 \u0997\u09be\u09df\u09c7 \u099c\u09c1\u09a4\u09be \u09ae\u09be\u09b0\u09bf \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u099b\u09c7\u09b2\u09c7 \u0993\u09b0\u09be \u09ac\u09df \u09aa\u09be\u09df \u09ac\u09b2\u09c7 \u09b8\u09c7\u09a8\u09be \u09ac\u09be\u09a4\u09bf\u09b2 \u0995\u09b0\u09c7\u099b\u09c7 \u09a4\u09c1\u0987 \u09b6\u09be\u09b2\u09be \u09ac\u09c1\u099d\u09cb\u09b8 \u09a8\u09be\u0987 \u0993\u09b0\u09be \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7\u0987 \u09aa\u09be\u09b0\u09c7\u09a8\u09be\u0987 \u0986\u09b0\u09a4\u09cb \u09ad\u09be\u09b0\u09a4 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u098f\u0995\u099f\u09bf \u09ac\u09be\u09b2 \u0986\u09b0 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09b8\u09ae\u09be\u09a8 \u0995\u09a5\u09be \u09ae\u09be\u09a6\u09be\u09b0 \u099a\u09cb\u09a6", + "output": [ + "The previous army was crazy and now it is crazy. India is a child of India and Razakar is equal to Mother Chod" + ] + }, + { + "input": " \u099a\u09c1\u09b0\u09c7\u09b0 \u09ae\u09be\u09b0 \u09ac\u09dc \u0997\u09b2\u09be \u09b6\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09aa\u09cd\u09b0\u09a4\u09bf\u099f\u09be \u0996\u09c7\u09b2\u09be\u09df \u09a4\u09c1\u09b0\u09be \u099a\u09c1\u09b0\u09bf \u0995\u09b0\u099b \u0986\u09ac\u09be\u09b0 \u09aa\u09be\u0995\u09a8\u09be\u09ae\u09bf \u099a\u09c1\u09a6\u09be\u099b \u09a4\u09c1\u09a6\u09c7\u09b0 \u09b2\u099c\u09cd\u099c\u09be \u09ac\u09b2\u09a4\u09c7 \u0986\u099b\u09c7 \u0995\u09bf\u099b\u09c1\u09b0\u09c7 ", + "output": [ + "You are stealing every game, you are stealing Paknami again, you have something to be ashamed of." + ] + }, + { + "input": "\u09b8\u09c7\u09b8\u09c7\u09b0\u099f\u09be \u09b8\u09c1\u09a8\u09c7 \u09ae\u09a8 \u099a\u09c7\u09df\u09c7\u099b\u09bf\u09b2\u09cb \u0993\u0995\u09c7 \u099c\u09c1\u09a4\u09be\u09a6\u09bf\u09df\u09c7 \u09aa\u09bf\u099f\u09bf\u09df\u09c7 ", + "output": [ + "Hearing the last one, I wanted to beat him with my shoes" + ] + }, + { + "input": " \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be \u09a8\u09bf\u099c\u09c7\u09b0 \u09a6\u09c7\u09b6\u09c7\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7\u09c7\u09b0 \u09a8\u09bf\u09b0\u09be\u09aa\u09a4\u09cd\u09a4\u09be \u09a6\u09bf\u09a4\u09c7 \u09ac\u09cd\u09af\u09b0\u09cd\u09a5 \u09b9\u0993\u09df\u09be \u09b8\u09a4\u09cd\u09a4\u09cd\u09ac\u09c7\u0993 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u0995\u09c7 \u09a8\u09bf\u09df\u09c7 \u09a8\u09be\u0995 \u0997\u09b2\u09be\u09df ", + "output": [ + "Despite failing to provide security to the people of her country, Randia sniffs at Bangladesh" + ] + }, + { + "input": "\u098f\u0987 \u09b8\u09ac \u09ac\u09be\u0987\u09a8\u099b\u09cb\u09a6\u09b0\u09c7 \u0997\u09be\u09b0\u09be\u09a8\u09cb \u09a6\u09b0\u0995\u09be\u09b0 ", + "output": [ + "All this needs to be done" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u098f\u09b8\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u098f\u09b0 \u09b8\u09ac\u09be\u09b0 \u09a7\u09a8 \u09b2\u09be\u09b0\u09a4", + "output": [ + "After coming to India, everyone in Bangladesh is happy" + ] + }, + { + "input": "\u0993\u09a8\u09be\u09b0 \u09a8\u09bf\u099c\u09c7\u09b0 \u09a6\u09c7\u09b6\u09c7 \u099f\u09cd\u09b0\u09c7\u09a8 \u09a6\u09c1\u09b0\u09cd\u0998\u099f\u09a8\u09be\u09df \u0986\u099c \u099c\u09a8 \u09ae\u09be\u09b0\u09be \u0997\u09c7\u099b\u09c7 \u0993\u0987\u099f\u09be\u09b0 \u0996\u09ac\u09b0 \u09a8\u09be\u0987 \u0989\u09a8\u09bf \u0986\u099a\u09cd\u099a\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u0996\u09cb\u099c \u09a8\u09bf\u09a4\u09c7 \u09aa\u09be\u09b2\u09a4\u09c1 \u09b8\u09ac", + "output": [ + "John died today in a train accident in his own country." + ] + }, + { + "input": "\u0986\u0997\u09c7 \u09a8\u09bf\u099c\u09c7 \u09b2\u09c1\u099a\u09cd\u099a\u09be\u09ae\u09bf \u099b\u09be\u09dc \u09ad\u09be\u09b2\u09cb \u09b9 \u09ae\u09be\u09a8\u09c1\u09b7\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09ad\u09be\u09b2\u09cb \u0995\u09bf\u099b\u09c1 \u0995\u09b0 \u09a4\u09be\u09b0\u09aa\u09b0 \u0985\u09a8\u09cd\u09af\u09a6\u09c7\u09b0 \u0989\u09aa\u09a6\u09c7\u09b6 \u09a6\u09bf\u09b8 \u0985\u09a5\u09ac\u09be \u0985\u09a8\u09cd\u09af\u09c7\u09b0 \u0995\u09be\u099c\u09c7\u09b0 \u09b8\u09ae\u09be\u09b2\u09cb\u099a\u09a8\u09be \u0995\u09b0\u09bf\u09b8 ", + "output": [ + "Do good to people first, then give advice to others or criticize the work of others." + ] + }, + { + "input": "\u09b8\u09c2\u099a\u09bf \u0995\u09c7 \u09af\u09a6\u09bf \u0987\u099a\u09cd\u099b\u09be \u09ae\u09a4 \u099c\u09c1\u09a4\u09be \u09aa\u09bf\u099f\u09be \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09a4\u09be\u09ae \u098f\u0995\u099f\u09c1 \u09b6\u09be\u09a8\u09cd\u09a4\u09bf \u09aa\u09c7\u09a4\u09be\u09ae \u09b8\u09c2\u099a\u09bf \u0986\u0997\u09c7 \u0998\u09b0 \u09ac\u09a8\u09cd\u09a7\u09bf \u099a\u09bf\u09b2 \u0986\u09b0 \u098f\u0996\u09a8 \u09b8\u09c2\u099a\u09bf\u0995\u09c7 \u09ac\u09be\u09a5\u09b0\u09c1\u09ae \u09ac\u09a8\u09cd\u09a6\u09bf \u0995\u09b0\u09c7 \u0996\u09be\u0993\u09df\u09be \u09a8\u09be \u09a6\u09bf\u09df\u09c7 \u0986\u099f\u0995\u09c7 \u09b0\u09be\u0996\u09be \u0989\u099a\u09bf\u09a4 \u098f\u09a4 \u0997\u09c1\u09b2\u09cb \u0985\u09b8\u09b9\u09be\u09df \u09ae\u09be\u09a8\u09c1\u09b7 \u09ae\u09be\u09b0\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u09b8\u09c2\u099a\u09bf\u09b0 \u09ab\u09be\u09b8\u09bf \u099a\u09be\u0987 \u09ab\u09be\u0981\u09b8\u09bf \u099a\u09be\u0987 \u09ab\u09be\u0981\u09b8\u09bf \u099a\u09be\u0987 ", + "output": [ + "If Suu Kyi could have beaten her shoes as she wished, I would have got some peace" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09c0\u09b0\u09c7 \u09a6\u09c7\u0996\u09b2\u09c7\u0987 \u09ae\u09c7\u099c\u09be\u099c \u0996\u09be\u09b0\u09be\u09aa \u09b9\u09df\u09c7 \u09af\u09be\u09df ", + "output": [ + "The mood gets worse when you see Magir" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7 \u099a\u09be\u09aa \u09aa\u09dc\u09c7\u09a8\u09be \u09a4\u09be\u09a4\u09c7 \u0995\u09bf \u09b9\u09df\u09c7\u099b\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09a4\u09cb \u09aa\u09dc\u09c7\u099b\u09c7 \u09a4\u09be\u099b\u09be\u09dc\u09be \u09ad\u09be\u09b0\u09a4\u09c0\u09df\u09b0", + "output": [ + "What has happened in Bangladesh is not under the pressure of India, moreover it is Indian" + ] + }, + { + "input": "\u09a2\u09c7\u09b2\u09be\u09b0 \u09a8\u09be\u09ae \u09ac\u09be\u09ac\u09be\u099c\u09c0 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u0998\u09c2\u09ae \u09b9\u09be\u09b0\u09be\u09ae", + "output": [ + "Dhela's name is Babaji. Night sleep is forbidden" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09c1\u0997\u09cb \u099a\u09c1\u09a6\u09be \u09ae\u09c1\u09a6\u09bf\u09b0 \u099c\u09be\u09b0\u099c \u09b8\u09a8\u09cd\u09a4\u09be\u09a8 \u09a4\u09cb\u09b0 \u09a6\u09bf\u09a6\u09bf\u09b0\u09c7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u099a\u09c1\u0987\u09a6\u09cd\u09a6\u09be \u09ae\u09be\u0987\u09b0\u09be \u09aa\u09be\u09b2\u09be\u09ae\u09c1 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be", + "output": [ + "Malugo chuda grocer's illegitimate child in your sister but chuidda mira palamu khankir pola" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf\u09b0 \u09a6\u09be\u09a4 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09b9\u09b2\u09c1\u09a6 ", + "output": [ + "Magir's teeth are yellow" + ] + }, + { + "input": "\u09a4\u09b0\u09be \u09aa\u09ae\u09be\u09a8 \u0995\u09b0\u09b2\u09bf \u09a4\u09b0\u09be \u09ac\u09be\u0982\u09b2\u09be \u09ae\u09be\u0997\u09bf ", + "output": [ + "Tara paman karli tara bangla magi" + ] + }, + { + "input": "\u0986\u09b2\u09cd\u09b2\u09be\u09b9\u09c1\u0986\u0995\u09ac\u09be\u09b0 \u0986\u09b2\u09cd\u09b2\u09be\u09b9 \u098f\u09ac\u09be\u09b0 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09b0\u09be \u09a8\u09bf\u09b0\u09cd\u09af\u09be\u09a4\u09bf\u09a4\u09cb \u09ae\u09be\u09a8\u09c1\u09b7\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09af\u09c1\u09a6\u09cd\u09a7\u09c7 \u09a8\u09be\u09ae\u099b\u09c7 \u0986\u09b2\u09cd\u09b2\u09be\u09b9 \u0986\u09aa\u09a8\u09bf \u0995\u09be\u09b6\u09cd\u09ae\u09bf\u09b0 \u0995\u09c7 \u09b9\u09bf\u0982\u09b8\u09cd\u09b0 \u09ad\u09be\u09b0\u09a4\u09c0\u09af\u09bc\u09a6\u09c7\u09b0 \u09a5\u09c7\u0995\u09c7 \u09b8\u09cd\u09ac\u09be\u09a7\u09c0\u09a8 \u0995\u09b0\u09c7 \u09a6\u09bf\u09a8", + "output": [ + "Allahu Akbar, this time the Muslims are fighting for the oppressed people. May Allah liberate Kashmir from the violent Indians." + ] + }, + { + "input": "\u09ad\u09a8\u09cd\u09a1 \u0995\u09be\u09a6\u09bf\u09df\u09be\u09a8\u09c0 \u09a5\u09c7\u0995\u09c7 \u09b8\u09be\u09ac\u09a7\u09be\u09a8", + "output": [ + "Beware of Bhand Qadiani" + ] + }, + { + "input": "\u09af\u09c7 \u09b8\u09ac \u09ac\u09bf\u09aa\u09cd\u09b2\u09ac\u09bf \u09a6\u09c7\u09b0 \u0995\u09a5\u09be \u09ac\u09b2\u099b \u09a4\u09be\u09b0\u09be \u09b8\u09ac \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09af\u09be\u09a6\u09c7\u09b0 \u0995\u09c7 \u09a4\u09cb\u09ae\u09b0\u09be \u09ad\u09c2\u09b2\u09c7 \u0997\u09c7\u099b \u0986\u09ae\u09b0\u09be \u0989\u09a8\u09be\u09a6\u09c7\u09b0 \u09ad\u0997\u09ac\u09be\u09a8 \u09b9\u09bf\u09b8\u09be\u09ac\u09c7 \u09aa\u09c2\u099c\u09be \u0995\u09b0\u09bf \u098f\u0987\u09b8\u09ac \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09a6\u09c7\u09b0 \u09a8\u09bf\u09df\u09c7 \u0997\u09b0\u09cd\u09ac \u0995\u09b0 \u0986\u09b0 \u098f\u09a6\u09c7\u09b0 \u0995\u09c7\u0987 \u098f\u0996\u09a8 \u09a4\u09be\u09a1\u09bc\u09be \u0993 \u09a4\u09be\u099b\u09be\u09dc\u09be \u09a4\u09be\u09b0\u09be \u09ad\u09be\u09b0\u09a4 \u09ae\u09be\u09a4\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u09b2\u09a1\u09bc\u09be\u0987 \u0995\u09b0\u09c7\u099b\u09bf\u09b2 \u09a4\u09be\u0987 \u09a6\u09c7\u09b6 \u09ad\u09be\u0997 \u09b9\u09b2\u09c7 \u09aa\u09be\u0995 \u09ac\u09be\u09a7 \u09a6\u09bf\u09df\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7 \u099a\u09b2\u09c7 \u098f\u09b8\u09c7\u099b\u09bf\u09b2 \u09a4\u09c0\u09a4\u09c1\u09ae\u09c0\u09b0 \u09b8\u09b9 \u09af\u09c7 \u099c\u09a8\u09c7\u09b0 \u0995\u09a5\u09be \u09ac\u09b2\u09cb \u09a4\u09be\u09b0\u09be \u09a6\u09c7\u09b6 \u09b8\u09cd\u09ac\u09be\u09a7\u09c0\u09a8\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09b2\u09a1\u09bc\u09be\u0987 \u0995\u09b0\u09c7 \u09a8\u09bf \u0995\u09b0\u09c7\u099b\u09c7 \u09a8\u09bf\u099c\u09c7\u09b0 \u09a7\u09b0\u09cd\u09ae\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09b2\u0995\u09cd\u09b7\u09cd\u09af \u099b\u09bf\u09b2 \u0987\u09b8\u09b2\u09be\u09ae\u09bf\u0995 \u09b6\u09be\u09b8\u09a8 \u09aa\u09cd\u09b0\u09a4\u09bf\u09b7\u09cd\u09a0\u09be\u09b0 \u0986\u09b0 \u09b0\u09be\u09b6\u09bf\u09df\u09be\u09b0 \u09b8\u09be\u09ac\u09ae\u09c7\u09b0\u09bf\u09a8 \u098f\u09b8\u09c7\u099b\u09bf\u09b2 \u09a4\u0996\u09a8 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u09b8\u09ae\u09a5\u09a8 \u0995\u09b0\u09a4\u09c7 \u0986\u09b8\u09be \u0986\u09ae\u09c7\u09b0\u09bf\u0995\u09be \u0993 \u09ac\u09cd\u09b0\u09bf\u099f\u09bf\u09b6 \u09af\u09c1\u09a6\u09cd\u09a7 \u099c\u09be\u09b9\u09be\u099c \u09a4\u09be\u09a1\u09bc\u09be \u09a4\u09c7 \u09ad\u09be\u09b0\u09a4 \u0995\u09c7 \u09b8\u09be\u09b9\u09be\u09af\u09cd\u09af \u0995\u09b0\u09a4\u09c7 \u0995\u09be\u09b0\u09a3 \u09b0\u09be\u09b6\u09bf\u09df\u09be", + "output": [ + "The revolutionaries you are talking about are all Hindus whom you have forgotten. We worship them as gods. Be proud of these Hindus and who are they now? Including those who did not fight for the country's independence, the goal for their religion was to establish Islamic rule and when the Russian submarine came to help India in chasing the American and British warships that came to support Pakistan because Russia" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u09b6\u09be\u09b2\u09be \u0986\u0993\u09df\u09be\u09ae\u09c0\u09b2\u09c0\u0997 \u09a6\u09be\u09b2\u09be\u09b2 ", + "output": [ + "You are the broker of Shala Awami League" + ] + }, + { + "input": "\u09b8\u09cc\u09a6\u09bf \u09ae\u09be\u09a6\u09be\u09b0 \u099a\u09cb\u09a6 ", + "output": [ + "Saudi mother fuck" + ] + }, + { + "input": " \u098f\u0996\u09a8 \u0995\u09cb\u09a8 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09aa\u09cd\u09b0\u09a4\u09bf\u09ac\u09be\u09a6 \u0995\u09b0\u09ac\u09c7 \u09a8\u09be \u09af\u0996\u09a8 \u09ae\u09be\u09b2\u0989\u09a8\u09a6\u09c7\u09b0 \u0995\u09bf\u099b\u09c1 \u09b9\u09df \u09a4\u0996\u09a8 \u09a4\u0996\u09a8 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09b0\u09be\u0987 \u09b8\u09ac\u09be\u09b0 \u0986\u0997\u09c7 \u09aa\u09cd\u09b0\u09a4\u09bf\u09ac\u09be\u09a6 \u0995\u09b0\u09c7 \u0986\u09b0 \u09b9\u09c7 \u09ac\u09cc\u09a6\u09cd\u09a6\u09b0\u09be \u0995\u09bf \u09aa\u09cd\u09b0\u09a4\u09bf\u09ac\u09be\u09a6 \u0995\u09b0\u09ac\u09c7\u09a8\u09be \u09a8\u09be\u0995\u09bf \u09a4\u09be\u0995\u09bf\u09df\u09c7 \u09a6\u09c7\u0996\u09ac\u09c7 \u0986\u09b0 \u09ae\u099c\u09be \u09b2\u09ac\u09c7 ", + "output": [ + "Now no Malaun will protest When something happens to the Maluns then the Muslims are the first to protest and O Buddhists will not protest or look and have fun" + ] + }, + { + "input": "\u09b8\u09ae\u09cd\u09aa\u09cd\u09b0\u09a4\u09bf \u099c\u09be\u09ae\u09be\u09df\u09be\u09a4\u09c7\u09b0 \u0986\u09ae\u09c0\u09b0 \u099c\u09a8\u09be\u09ac \u09ae\u0995\u09ac\u09c1\u09b2 \u0986\u09b9\u09ae\u09be\u09a6 \u09a6\u09b2\u09c7\u09b0 \u0986\u09ae\u09c0\u09b0 \u09a8\u09bf\u09b0\u09cd\u09ac\u09be\u099a\u09bf\u09a4 \u09b9\u0993\u09df\u09be\u09b0 \u09aa\u09b0 \u09a4\u09be\u09b0\u09be \u09b0\u09be\u09a4\u09be\u09b0\u09be\u09a4\u09bf \u09a4\u09be\u0981\u0995\u09c7 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09ac\u09be\u09a8\u09bf\u09df\u09c7 \u099b\u09be\u09dc\u099b\u09c7\u09a8 \u09a8\u09bf\u09b0\u09cd\u09b2\u099c\u09cd\u099c \u09ac\u09be\u09a8\u09cb\u09df\u09be\u099f \u0995\u09be\u09b2\u09cd\u09aa\u09a8\u09bf\u0995 \u0997\u09be\u0981\u099c\u09be\u0996\u09c1\u09b0\u09bf \u0997\u09b2\u09cd\u09aa\u09ac\u09be\u099c\u09c0 \u09b6\u09c1\u09b0\u09c1 \u0995\u09b0\u09c7\u099b\u09c7\u09a8", + "output": [ + "After the recent election of Mr. Maqbool Ahmad as the Ameer of Jamaat, they are making him a Razakar overnight." + ] + }, + { + "input": "\u0997\u09cb\u09a4\u09ae \u09ae\u09be\u09a6\u09be\u09b0\u099a\u09c1\u09a6 \u09ac\u09b2\u09c7\u0995\u09bf \u09b8\u09be\u09b2\u09c7 \u09ac\u09be\u09b2 \u09ab\u09be\u09b2\u09be\u09a4\u09c7 \u098f\u09b8\u09c7\u099b\u09bf\u09b2 \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u09b0\u09be \u0986\u09ae\u0997\u09cb \u09b8\u09ac \u099a\u09c1\u09b0\u09bf\u0995\u09b0\u09c7 \u09ad\u09be\u09b0\u09a4 \u09a8\u09bf\u09df\u09c7 \u0997\u09c7\u099b\u09c7 ", + "output": [ + "Gotham Madarchud Baleki came to Baal Falate in the year Randia Khanki's Polara Amgo stole everything and took it to India" + ] + }, + { + "input": " \u0986\u0995\u09be\u09b6\u09c7 \u0998\u09c1\u09b0\u09c7 \u09ac\u09c7\u09dc\u09be\u099a\u09cd\u099b\u09c7 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09a8\u09be\u09ae \u09a6\u09bf\u09df\u09c7 \u09af\u09be\u09a6\u09c7\u09b0 \u0995\u09c7 \u09b9\u09a4\u09cd\u09af\u09be \u09ac\u09be \u09ab\u09be\u09b8\u09bf\u0981 \u09a6\u09c7\u0993\u09df\u09be \u09b9\u09df\u09c7\u099b\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0 \u0986\u09a4\u09cd\u09af\u09be \u09b8\u09c1\u09a4\u09be\u09b0\u0982 \u0989\u09aa\u09b0\u09c7\u0993 \u099c\u099f\u09bf\u09b2\u09a4\u09be \u09ac\u09be\u09dc\u099b\u09c7 ", + "output": [ + "Those who have been killed or hanged under the name of Razakar are floating in the sky." + ] + }, + { + "input": "\u09af\u09c7 \u09a6\u09cb\u09b7 \u0995\u09b0\u09c7\u099b\u09c7 \u09a4\u09be\u09b0 \u09ac\u09bf\u099a\u09be\u09b0 \u09b9\u0993\u09af\u09bc\u09be \u0989\u099a\u09bf\u09a4 \u098f\u09b0\u099c\u09a8\u09cd\u09af \u09af\u09c7\u09a8 \u09b8\u09ae\u09cd\u09aa\u09cd\u09b0\u09a6\u09be\u09af\u09bc \u0989\u09aa\u09b0 \u09a6\u09cb\u09b7 \u09a6\u09bf\u09af\u09bc\u09be \u0989\u099a\u09bf\u09a4 \u09a8\u09be \u09a4\u09be\u09b9\u09b2\u09c7 \u09ad\u09be\u09b0\u09a4 \u0986\u09b0 \u0986\u09ae\u09be\u09b0 \u09ae\u09a7\u09cd\u09af\u09c7 \u09aa\u09be\u09b0\u09cd\u09a5\u0995\u09cd\u09af \u09a5\u09be\u0995\u09ac\u09c7 \u09a8\u09be ", + "output": [ + "The culprit should be brought to justice so that the community should not be blamed so that there is no difference between me and India." + ] + }, + { + "input": "\u09a6\u09c1\u0983\u0996\u09c7\u09b0 \u09ac\u09bf\u09b7\u09df \u09a8\u09be\u09b8\u09bf\u09b0\u09a8\u0997\u09b0 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09b8\u09ae\u09cd\u09aa\u09cd\u09b0\u09a6\u09be\u09df\u09c7\u09b0 \u0989\u09aa\u09b0 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09aa\u09b0\u09b0\u09be\u09b7\u09cd\u099f\u09cd\u09b0\u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09bf \u09ac\u09bf\u09ac\u09c3\u09a4 \u09aa\u09cd\u09b0\u09a6\u09be\u09a8 \u0995\u09b0\u09b2\u09c7\u0993 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be \u0997\u09a3\u09b9\u09a4\u09cd\u09af\u09be \u09a8\u09bf\u09df\u09c7 \u0995\u09bf\u099b\u09c1\u0987 \u09ac\u09b2\u09c7\u09a8 \u09a8\u09bf ", + "output": [ + "Sadly, the Indian foreign minister issued a statement on the Nasirnagar Hindu community, but did not say anything about the Rohingya genocide." + ] + }, + { + "input": " \u09a4\u09be\u09b0\u09c7\u0995 \u099c\u09bf\u09df\u09be\u09b0 \u099c\u09a8\u09cd\u09ae\u09a6\u09bf\u09a8 \u0989\u09aa\u09b2\u0995\u09cd\u09b7\u09c7 \u09aa\u09cb\u09b7\u09cd\u099f\u09c7 \u0995\u09bf\u099b\u09c1 \u09b2\u09cb\u0995 \u09af\u09be\u09b0\u09be \u0986\u09b8\u09b2\u09c7 \u09a6\u09b2\u0995\u09be\u09a8\u09be \u09a4\u09be\u09b0\u09be \u09af\u09c7\u09ad\u09be\u09b7\u09be\u09df \u09ae\u09a8\u09cd\u09a4\u09ac\u09cd\u09af \u09a6\u09bf\u099a\u09cd\u099b\u09c7 \u09a4\u09be\u09a4\u09c7 \u09ac\u09c1\u099d\u09be \u09af\u09be\u09df \u098f\u09b8\u0995\u09b2 \u09b2\u09cb\u0995 \u09b9\u09df \u0986\u0993\u09df\u09be\u09ae\u09c0 \u0998\u09b0\u09a8\u09be\u09b0 \u09a8\u09be \u09b9\u09df \u0986\u09ac\u09be\u09b2 \u0995\u09be\u09b0\u09a8 \u098f\u0995\u099c\u09a8 \u09b2\u09cb\u0995 \u0995\u09c7 \u099a\u09cb\u09b0 \u09ac\u09b2\u09a4\u09c7 \u09b9\u09b2\u09c7 \u09aa\u09cd\u09b0\u09ae\u09be\u09a8 \u09aa\u09cd\u09b0\u09cb\u09df\u099c\u09a8 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u098f\u09b0\u09be\u0995\u09cb\u09a8 \u09aa\u09cd\u09b0\u09ae\u09be\u09a8 \u099b\u09be\u09b0\u09be\u0987 \u09af\u09be \u09ae\u09a8\u09c7\u09b9\u09df \u09ac\u09b2\u09c7 \u09af\u09be\u09df \u09a4\u09be\u09b0\u09c7\u0995 \u09af\u09a6\u09bf \u099a\u09cb\u09b0 \u09b9\u09a4 \u09a4\u09be\u09b9\u09b2\u09c7 \u098f\u0987 \u0986\u0993\u09df\u09be\u09ae\u09c0 \u09b8\u09b0\u0995\u09be\u09b0 \u098f\u09a4 \u09a6\u09bf\u09a8\u09c7 \u09a4\u09be\u0995\u09c7 \u09ab\u09be\u09b8\u09c0 \u09a8\u09be\u09a6\u09c0\u09b2\u0993 \u0995\u09ae\u0995\u09b0\u09c7 \u09ac\u099b\u09b0 \u098f\u09b0 \u09b8\u09be\u099c\u09be \u09a6\u09c0\u09df\u09c7 \u099b\u09c7\u09b0\u09c7 \u09a6\u09bf\u09a4 ", + "output": [ + "In the post on the occasion of Tareq Zia's birthday, some people who are actually Dalkana are commenting on the language. In so many days, even Fasi Nadil would have let him go with a sentence of less than a year" + ] + }, + { + "input": "\u0985\u09b8\u09ad\u09cd\u09af \u09b2\u09ae\u09cd\u09aa\u099f \u09a8\u09cb\u0982\u09b0\u09be \u0995\u09cb\u09a5\u09be\u0995\u09be\u09b0 ", + "output": [ + "The vulgar lustful dirty somewhere" + ] + }, + { + "input": "\u09ae\u09be\u09b9\u09bf \u0995\u09cb\u09a8 \u099a\u09c7\u099f\u09c7\u09b0 \u09ac\u09be\u09b2 \u09ae\u09c7\u09ae\u09cd\u09ac\u09be\u09b0 \u09b9\u09cb\u0993\u0986\u09b0 \u099c\u09c1\u0997\u0997\u09cb\u09a4\u09be \u0986\u09b8\u09c7\u09a8\u09bf \u09b8\u09be\u0989\u0986\u09b0 \u09aa\u09c1\u09a4\u09c7\u09b0 ", + "output": [ + "Mau and Sau Put did not qualify to be members of any chat" + ] + }, + { + "input": "\u09a6\u09c7\u0996 \u09a6\u09be\u09a6\u09be\u09b0\u09be \u09a4\u09cb\u09ae\u09b0\u09be \u09ad\u09be\u09b0\u09a4\u09c7 \u09a5\u09be\u0995\u09cc \u0986\u09b0 \u09af\u09c7\u0996\u09be\u09a8\u09c7\u0987 \u09a5\u09be\u0995\u09cc \u09a8\u09be \u0995\u09c7\u09a8 \u09a4\u09be\u09a4\u09c7 \u0995\u09c1\u09a8\u09cb \u0985\u09b6\u09cb\u09ad\u09bf\u09a6\u09be \u09a8\u09c7\u0987 \u09a4\u09ac\u09c7 \u09ac\u09be\u0982\u0999\u09cd\u0997\u09be\u09b2\u09bf \u09a4\u09cc \u09ac\u099f\u09c7 \u09a4\u09cb\u09ae\u09b0\u09be \u0995\u09b2\u0995\u09be\u09a4\u09be\u09b0 \u09ac\u09be\u0982\u0999\u09cd\u0997\u09be\u09b2\u09bf \u0986\u09b0 \u0986\u09ae\u09b0\u09be \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09bf \u09ac\u09be\u0982\u0999\u09cd\u0997\u09be\u09b2\u09bf \u09b6\u09cb\u09a7\u09c1 \u09b6\u09cb\u09a7\u09c1 \u09ac\u09bf\u09a8\u09be \u09a4\u09b0\u0995\u09c7 \u09a8\u09be \u099c\u09c7\u09df\u09c7 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09ad\u09be\u09b7\u09be \u0995\u09c7 \u09b8\u09a0\u09bf\u0995 \u09ad\u09be\u09ac\u09c7 \u09ac\u09cd\u09af\u09be\u09ac\u09b9\u09be\u09b0 \u0995\u09b0\u09bf \u0986\u09ae\u09b0\u09be", + "output": [ + "Look, grandparents, no matter where you live in India and wherever you are, there is nothing wrong with that, but you are a Bengali, you are a Bengali from Kolkata and we are Bangladeshi Bengalis." + ] + }, + { + "input": "\u09ac\u09b8\u09cd\u09a4\u09be\u09ad\u09b0\u09cd\u09a4\u09bf \u09ae\u09c7\u0995\u09be\u09aa \u09a8\u09bf\u09df\u09c7 \u09ac\u09be\u09b2\u09c7\u09b0 \u0995\u09a8\u09ad\u09be\u09b0\u09b8\u09c7\u09b6\u09a8 \u09a8\u09bf\u09df\u09be \u09ac\u09b8\u099b\u09c7 ", + "output": [ + "Ball is sitting with a conversation with a bag full of makeup" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09ae\u09bf\u09df\u09be\u09a8\u09ae\u09be\u09b0\u09c7\u09b0 \u09a6\u09bf\u0995\u09c7 \u09af\u09be \u09ad\u09be\u09b0\u09a4 \u0995\u09c7 \u09a8\u09bf\u09df\u09c7 \u098f\u09a4 \u099a\u09bf\u09a8\u09a4\u09bf\u09a4 \u0995\u09c7\u09a8 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u09b6\u09c7\u09b7 \u0995\u09b0\u09c7 \u09a6\u09bf\u099a\u099b\u09c7 \u0986\u09b0 \u09ac\u09be\u0987\u09a8\u099a\u09cb\u09a6 \u09ac\u09cd\u09af\u09b8\u09cd\u09a4 \u09ad\u09be\u09b0\u09a4 \u0995\u09c7 \u09a8\u09bf\u09df\u09c7", + "output": [ + "The bitch's pola is towards Myanmar which is why Muslims are so worried about India and why Bainchod is busy with India" + ] + }, + { + "input": "\u09af\u09be\u09b0\u09be \u099c\u09be\u09ae\u09be\u09df\u09be\u09a4 \u0995\u09b0\u09c7 \u09a4\u09be\u09b0\u09be \u09b8\u09ac\u09be\u0987 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u0995\u09bf \u0985\u09a6\u09cd\u09ad\u09c1\u09a4 \u09ac\u09cd\u09af\u09be\u09aa\u09be\u09b0 ", + "output": [ + "It is strange that all those who join Jamaat are Razakars" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c0\u09df\u09b0\u09be \u09a4\u09c7 \u098f\u09b8\u09c7 \u0995\u09be\u099c\u09c7\u09b0 \u09b8\u09a8\u09cd\u09a7\u09be\u09a8\u09c7 \u09b9\u09be\u09a4\u09c7 \u09a8\u09bf\u09df\u09c7 \u09ac\u09bf\u09ad\u09bf\u09a8\u09cd\u09a8 \u09aa\u09cd\u09b0\u09a4\u09bf\u09b7\u09cd\u099f\u09be\u09a8\u09c7 \u09a7\u09b0\u09a8\u09be \u09a6\u09bf\u099a\u09cd\u099b\u09c7 \u0986\u09b0 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09c7\u09b6\u09c7\u09b0 \u09b2\u09cb\u0995\u09c7\u09b0\u09be \u09af\u09be\u09ac\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7 \u0995\u09be\u099c \u0995\u09b0\u09a4\u09c7 \u0995\u09bf \u0995\u09b0\u09ac\u09c7 \u0986\u09b0 \u0985\u09a8\u09c7\u0995 \u09a6\u09c7\u09b6\u09c7\u09a4\u09cb \u09ad\u09bf\u09b8\u09be \u09ac\u09a8\u09cd\u09a7 \u09ac\u09be\u0982\u0997\u09be\u09b2\u09bf\u09b0 \u099c\u09a8\u09cd\u09af \u09ad\u09be\u09b0\u09a4\u09c7 \u0997\u09bf\u09df\u09c7 \u0995\u09bf\u099b\u09c1 \u0987\u099c\u09cd\u099c\u09a4 \u09b9\u09be\u09b0\u09bf\u09df\u09c7 \u0986\u09b8\u09c1\u0995 \u09a4\u09be\u09b0\u09aa\u09b0 \u09ac\u09c1\u099d\u09ac\u09c7 \u09ad\u09be\u09b2 \u0986\u09b0 \u09ae\u09a8\u09cd\u09a7 \u0995\u09bf \u09ae\u09a8\u09c7 \u09b9\u099a\u09cd\u099b\u09c7 \u0986\u09b0 \u0995\u09bf\u099b\u09c1\u09a6\u09bf\u09a8 \u09aa\u09b0 \u098f\u0987 \u09a6\u09c7\u09b6 \u09a6\u09c7\u0989\u09b2\u09bf\u09df\u09be \u09b9\u09df\u09c7 \u09af\u09be\u09ac\u09c7 ", + "output": [ + "Indians are coming here in search of work and swearing in different institutions and our people will go to India to work and what to do and many countries go to India for visa off Bengalis lose some dignity then you will understand what is good and bad and after a while this country will go bankrupt" + ] + }, + { + "input": "\u0997\u09b0\u09cd\u09ac \u0995\u09c0\u09b8\u09c7\u09b0 \u09af\u09c7\u0987 \u09a6\u09c7\u09b6 \u09ad\u09be\u09b0\u09a4 \u09a4\u09a5\u09be \u09ac\u09bf\u09b6\u09cd\u09ac \u099c\u09c1\u09b0\u09c7 \u09ad\u09bf\u0995\u09cd\u09b7\u09be\u09ac\u09c3\u09a4\u09cd\u09a4\u09bf \u0995\u09b0\u09c7 \u09a4\u09be\u0981\u09a6\u09c7\u09b0 \u098f\u09a4 \u09ab\u09c1\u099f\u09be\u09a8\u09bf \u0995\u09c0\u09b8\u09c7\u09b0 \u09af\u09c7\u0987 \u09a6\u09c7\u09b6\u09c7\u09b0 \u09b2\u09cb\u0995\u09c7\u09b0\u09be \u099a\u09cb\u09b0\u09c7\u09b0 \u09ae\u09a4 \u09b0\u09be\u09a4\u09c7\u09b0 \u0985\u09a8\u09cd\u09a7\u0995\u09be\u09b0\u09c7 \u0985\u09a8\u09cd\u09af \u09a6\u09c7\u09b6\u09c7\u09b0 \u0997\u09cb\u09af\u09bc\u09be\u09b2 \u0998\u09b0 \u09a5\u09c7\u0995\u09c7 \u0997\u09b0\u09c1 \u099a\u09c1\u09b0\u09bf \u0995\u09b0\u09c7 \u099c\u09ae\u09bf \u09a5\u09c7\u0995\u09c7 \u09a7\u09be\u09a8 \u0995\u09c7\u099f\u09c7 \u09a8\u09bf\u09af\u09bc\u09c7 \u09af\u09be\u09af\u09bc \u09ac\u09c7\u0986\u0987\u09a8\u09c0 \u0985\u09a8\u09c1\u09aa\u09cd\u09b0\u09ac\u09c7\u09b6 \u0995\u09b0\u09c7 \u09a4\u09be\u0981\u09a6\u09c7\u09b0 \u098f\u09a4 \u0985\u09b9\u0982\u0995\u09be\u09b0 \u0995\u09c0\u09b8\u09c7\u09b0 \u09af\u09c7\u0987 \u09a6\u09c7\u09b6 \u09ac\u09bf\u09a6\u09cd\u09af\u09c1\u09a4 \u09a5\u09c7\u0995\u09c7 \u099c\u09cd\u09ac\u09be\u09b2\u09be\u09a8\u09bf \u09b6\u09bf\u09b2\u09cd\u09aa\u09c7\u09b0 \u0995\u09be\u0981\u099a\u09be\u09ae\u09be\u09b2 \u09aa\u09a8\u09cd\u09af \u09b8\u09cd\u09af\u09be\u099f\u09c7\u09b2\u09be\u0987\u099f \u09b8\u09ac \u0995\u09bf\u099b\u09c1 \u09ad\u09cb\u0997 \u0995\u09b0\u09c7 \u09a4\u09be\u0981\u09a6\u09c7\u09b0 \u09ae\u09c1\u0996\u09c7 \u098f\u09a4 \u09ac\u09a1\u09bc \u09ac\u09a1\u09bc \u0995\u09a5\u09be \u0986\u09b8\u09c7 \u0995\u09cb\u09a5\u09be \u09a5\u09c7\u0995\u09c7 \u09af\u09be\u09a6\u09c7\u09b0 \u09a8\u09bf\u099c\u09b8\u09cd\u09ac \u09aa\u09a4\u09cd\u09b0\u09bf\u0995\u09be \u09a8\u09c7\u0987 \u09b8\u09be\u09b0\u09be\u09a6\u09bf\u09a8 \u0985\u09a8\u09cd\u09af \u09a6\u09c7\u09b6\u09c7\u09b0 \u09aa\u09a4\u09cd\u09b0\u09bf\u0995\u09be\u09a4\u09c7 \u09aa\u09a1\u09bc\u09c7 \u09a5\u09be\u0995\u09c7 \u09a4\u09be\u0981\u09a6\u09c7\u09b0 \u098f\u09a4 \u0995\u09a5\u09be \u0986\u09b8\u09c7 \u0995\u09cb\u09a5\u09be \u09a5\u09c7\u0995\u09c7 ", + "output": [ + "The country of pride is begging all over India and the world. The people of this country are so boisterous. The people of this country are like thieves. They steal cows from other countries' barns in the dark of night. Where do those who don't have their own magazine come from and where do they get so much talk from all over the country?" + ] + }, + { + "input": "\u0995\u09cb\u099f\u09bf \u099f\u09be\u0995\u09be\u09b0 \u0985\u09b8\u09cd\u09b0 \u0993 \u09b8\u09b0\u099e\u09cd\u099c\u09be\u09ae \u09b2\u09c1\u099f \u0995\u09b0\u09c7 \u09a8\u09bf\u09df\u09c7 \u09af\u09be\u09df \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09b8\u09c7\u09a8\u09be\u09ac\u09b9\u09bf\u09a8\u09c0", + "output": [ + "The Indian army looted arms and equipment worth crores of rupees" + ] + }, + { + "input": "\u09b0\u09ac\u09c0\u09a8\u09cd\u09a6\u09cd\u09b0\u09a8\u09be\u09a5 \u09a7\u09b0\u09cd\u09b7\u0995 \u09ae\u09c1\u09b9\u09ae\u09cd\u09ae\u09a6\u09c7\u09b0 \u09ae\u09a4 \u09eb\u09e9 \u09ac\u099b\u09b0 \u09ac\u09df\u09b8\u09c7 \u098f\u0995\u099f\u09be \u09ec \u09ac\u099b\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0 \u09b8\u09be\u09a5\u09c7 \u09ae\u09c1\u09ab\u09be\u0996\u09c7\u09a4\u09be (\u09a6\u09c1\u0987 \u09aa\u09be\u09df\u09c7\u09b0 \u09ae\u09be\u099d\u09c7 \u099c\u09a8\u09a8\u09be\u0999\u09cd\u0997 \u0998\u09b7\u09be) \u0995\u09b0\u09c7\u09a8 \u09a8\u09be\u0987 ", + "output": [ + "Rabindranath did not mufakheta (rubbing his genitals between two legs) with a 6-year-old boy at the age of 53 like the rapist Muhammad" + ] + }, + { + "input": "\u0986\u09b0 \u0995\u09bf \u09ac\u09b2\u09ac\u09cb \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09aa\u09cd\u09b0\u09ae\u09be\u09a3 \u09a4\u09be\u09b0\u09be \u0995\u09b0\u09a4\u09c7 \u099a\u09be\u099a\u09cd\u099b\u09c7 \u09a4 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09b9\u09df\u09c7\u0987 \u0993\u09a6\u09c7\u09b0 \u0986\u09ae\u09cd\u09ae\u09c1\u09b0 \u09aa\u09c7\u099f\u09c7", + "output": [ + "What else can I say, they want to prove that they are Razakars, they have become Razakars in their mother's womb" + ] + }, + { + "input": "\u0986\u0997\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ac\u09be\u0982\u09b2\u09be \u099a\u09cd\u09af\u09be\u09a8\u09c7\u09b2 \u0997\u09c1\u09b2\u09cb \u0985\u09ab \u0995\u09b0\u09a4\u09c7 \u09b9\u09ac\u09c7", + "output": [ + "First we have to turn off the Bengali channels in India" + ] + }, + { + "input": " \u09ad\u09be\u0987 \u09ac\u09bf\u09b2 \u0997\u09cd\u09b0\u09c7\u099f\u09b8 \u09a4\u09cb\u09b0 \u098f\u0987 \u0995\u09a5\u09be \u09af\u09c7\u09a8 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09aa\u09c1\u09b2\u09bf\u09b6 \u09a8\u09be \u09b6\u09c1\u09a8\u09c7 \u09a4\u09be\u09b9\u09b2\u09c7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09b0\u09be\u09b8\u09cd\u09a4\u09be\u09df \u09a6\u09be\u09dc \u0995\u09b0\u09be\u0987\u09df\u09be \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09ac\u09be\u09a8\u09be\u0987\u09df\u09be \u09b8\u09ac \u099f\u09be\u0995\u09be \u09b2\u09c1\u099f \u0995\u09b0\u09c7 \u09a8\u09c7\u09ac\u09c7 \u09a4\u09ac\u09c7 \u098f\u0995\u09ac\u09be\u09b0 \u09a4 \u0996\u09c1\u09b2\u09a8\u09be \u09ac\u09bf\u099c\u09cd\u099e\u09be\u09a8 \u0993 \u09aa\u09cd\u09b0\u09af\u09c1\u0995\u09cd\u09a4\u09bf \u09ac\u09bf\u09b6\u09cd\u09ac\u09ac\u09bf\u09a6\u09cd\u09af\u09be\u09b2\u09df\u09c7 \u0986\u09b8\u099b\u09bf\u09b2\u09bf \u09a4\u0996\u09a8 \u09ac\u09c7\u099a\u09c7 \u0997\u09c7\u099a\u09b8 ", + "output": [ + "Brother Bill Greets, if the police in Bangladesh don't listen to you, they will make you a razakar and rob you of all your money, but once you were coming to Khulna University of Science and Technology" + ] + }, + { + "input": "\u09b2\u09c1\u099a\u09cd\u099a\u09be \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09c1\u09b2\u09be", + "output": [ + "Luchcha khankir pula" + ] + }, + { + "input": "\u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09a6\u09c7\u09b0 \u099c\u09be\u09df\u0997\u09be\u09df \u09af\u09a6\u09bf \u09ad\u09be\u09b0\u09a4 \u09b9\u09a4 \u09ae\u09a8\u09c7 \u09b9\u09df \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09b8\u09b0\u0995\u09be\u09b0 \u09ac\u09b0\u09cd\u09a1\u09be\u09b0 \u09a8\u09df \u09ac\u09b0\u0982 \u09b6\u09be\u09dc\u09c0 \u09b8\u09b9 \u0996\u09c1\u09b2\u09c7 \u09a6\u09bf\u09a4", + "output": [ + "If India had been in the place of Rohingyas, it seems that the Bangladesh government would have opened it with a sari and not a border" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf \u098f\u0995\u099f\u09be \u09b8\u09cb\u099c\u09be \u0995\u09a5\u09be\u09df", + "output": [ + "Maggie in a simple word" + ] + }, + { + "input": "\u098f\u09b8\u09ac \u09ab\u09be\u09b2\u09a4\u09c1 \u09a6\u09c7\u09b0 \u09a8\u09bf\u09df\u09c7 \u098f\u09b8\u09c7 \u09b8\u09c7\u09b2\u09bf\u09ac\u09cd\u09b0\u09c7\u099f\u09bf \u09ac\u09be\u09a8\u09be\u09a8\u09cb\u09b0 \u09a6\u09b0\u0995\u09be\u09b0 \u09a8\u09be\u0987 ", + "output": [ + "There is no need to make celebrities with these nonsense" + ] + }, + { + "input": "\u0986\u09aa\u09c1 \u09ad\u09c1\u09c2\u09a6\u09be \u099a\u09c1\u0987\u09a4\u09c7 \u0995\u09c0 \u09b9\u09df ", + "output": [ + "What happens in Apu Bhuda Chuite" + ] + }, + { + "input": "\u0986\u09b8\u09b2\u09c7 \u099c\u09be\u09ae\u09be\u09df\u09be\u09a4\u09c7\u09b0 \u099a\u09c7\u09df\u09be\u09b0\u099f\u09be\u0987 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u0986\u09ae\u09c0\u09b0 \u09a8\u09be\u09ac\u09be\u09b2\u0995 \u09b8\u09be\u09ac\u09be\u09b2\u0995 \u098f\u099f\u09be \u0995\u09cb\u09a8 \u09ab\u09cd\u09af\u09be\u0995\u09cd\u099f\u09b0 \u09a8\u09be ", + "output": [ + "In fact, it is not a factor that Razakar Amir is a minor in the chair of Jamaat" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u099c\u09a8\u09cd\u09af\u0987 \u09af\u09a4 \u09ac\u09c7\u09a6\u09a8\u09be \u098f\u09a6\u09bf\u0995\u09c7 \u09b2\u09be\u0996 \u09b2\u09be\u0996 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u09ae\u09be\u09b0\u09be \u099c\u09be\u099a\u09cd\u099b\u09c7 \u09a4\u09be\u09a4\u09c7 \u09a4\u09be\u09b0 \u0995\u09cb\u09a8 \u0995\u09b8\u09cd\u099f \u09b9\u09df\u09a8\u09be", + "output": [ + "It does not cost India as much as millions of Muslims are dying" + ] + }, + { + "input": "\u09b9\u09be\u09b2\u09be\u09b0\u09be \u09b8\u09ac \u09ae\u09be\u09a4\u09be\u09b2 \u09b8\u09ae\u09be\u099c\u099f\u09be\u0995\u09c7 \u09a8\u09b7\u09cd\u099f \u0995\u09b0\u09c7 \u09aa\u09c7\u09b2\u099b\u09c7 ", + "output": [ + "Halar has ruined all the drunken society" + ] + }, + { + "input": "\u09b6\u09c7\u0996 \u09b9\u09be\u09b8\u09bf\u09a8\u09be\u0993 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b2\u09c0\u0997 \u0995\u09c7\u0989\u09a8\u09be \u0989\u09a8\u09bf \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09aa\u09cd\u09b0\u09ac\u09be\u09b8\u09c0 ", + "output": [ + "Sheikh Hasina Kutta League is not an Indian expatriate" + ] + }, + { + "input": "\u09aa\u09c2\u099c\u09be\u09b0 \u09a7\u09b0\u09cd\u09b7\u0995\u09c7\u09b0 \u09ab\u09be\u09b8\u09bf \u099a\u09be\u0987 \u09b8\u0995\u09b2 \u09a8\u09be\u09b0\u09c0 \u09a8\u09bf\u09b0\u09cd\u09af\u09be\u09a4\u09a8\u09c7\u09b0 \u09ac\u09bf\u099a\u09be\u09b0 \u099a\u09be\u0987 \u09b8\u0982\u0996\u09cd\u09af\u09be\u09b2\u0998\u09c1\u09a6\u09c7\u09b0 \u0989\u09aa\u09b0 \u09a7\u09b0\u09cd\u09ae \u0985\u09ac\u09ae\u09be\u09a8\u09a8\u09be\u09b0 \u09ae\u09bf\u09a5\u09cd\u09af\u09be \u0997\u09c1\u099c\u09ac \u09b0\u099f\u09bf\u09df\u09c7 \u09a8\u09bf\u09b0\u09cd\u09af\u09be\u09a4\u09a8\u09c7\u09b0 \u09b8\u09a0\u09bf\u0995 \u09ac\u09bf\u099a\u09be\u09b0 \u099a\u09be\u0987 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u09a8\u09bf\u09b0\u09be\u09aa\u09a4\u09cd\u09a4\u09be \u099a\u09be\u0987 \u0989\u0997\u09cd\u09b0 \u09ae\u09cc\u09b2\u09ac\u09be\u09a6 \u09ac\u09a8\u09cd\u09a7\u09c7\u09b0 \u09a6\u09be\u09ac\u09bf \u099c\u09be\u09a8\u09be\u0987 \u09af\u09be\u09b0\u09be \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09b8\u09be\u09ae\u09cd\u09aa\u09cd\u09b0\u09a6\u09be\u09df\u09bf\u0995 \u09a6\u09be\u0999\u09cd\u0997\u09be \u09b2\u09be\u0997\u09bf\u09df\u09c7\u099b\u09c7 \u09b8\u09c7\u0987 \u09b8\u0995\u09b2 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09a6\u09c7\u09b0 \u09ac\u09bf\u099a\u09be\u09b0 \u0993 \u09ab\u09be\u09b8\u09bf \u099a\u09be\u0987 ", + "output": [ + "I want the execution of the rapist of worship, I want justice for all the women tortured, I want justice for the torture of the minorities by spreading false rumors of insulting religion, I want the security of the Hindus, I demand an end to extremist fundamentalism" + ] + }, + { + "input": "\u099c\u09be\u09ae\u09be\u09a4\u09c7\u0987\u09b8\u09b2\u09be\u09ae\u09c0 \u09a6\u09b2\u09c7\u09b0 \u0986\u09ae\u09c0\u09b0 \u09b9\u09bf\u09b8\u09c7\u09ac\u09c7 \u098f\u0995\u099f\u09be \u0995\u09b2\u09be \u0997\u09be\u099b\u09c7\u09b0\u0993 \u09af\u09a6\u09bf \u09a6\u09be\u09df\u09bf\u09a4\u09cd\u09ac \u09a6\u09c7\u09df\u09be \u09b9\u09df \u09a4\u09ac\u09c1\u0993 \u09ae\u09be\u09a8\u09ac\u09a4\u09be\u09ac\u09bf\u09b0\u09cb\u09a7\u09c0 \u0986\u09aa\u09b0\u09be\u09a7\u09c7\u09b0 \u09a6\u09be\u09df\u09c7 \u09a4\u09be\u0995\u09c7 \u09ab\u09be\u09b8\u09bf\u09a4\u09c7 \u099d\u09be\u09b2\u09be\u09a8\u09cb \u09b9\u09ac\u09c7 \u098f\u099f\u09be \u0986\u0993\u09df\u09be\u09ae\u09c0\u09b2\u09c0\u0997\u09c7\u09b0 \u09aa\u09c7\u09b6\u09be \u0993 \u09a8\u09c7\u09b6\u09be\u09df \u09aa\u09b0\u09bf\u09a8\u09a4 \u09b9\u09df\u09c7\u0997\u09c7\u099b\u09c7 \u09ad\u09c7\u09ac\u09c7 \u09a6\u09c7\u0996\u09c1\u09a8 \u098f\u09a4\u09cb \u09a6\u09bf\u09a8 \u0995\u09cb\u09a8 \u0995\u09a5\u09be \u099b\u09bf\u09b2\u09cb\u09a8\u09be \u0990\u09ac\u09cd\u09af\u0995\u09cd\u09a4\u09bf\u09b0 \u09ac\u09bf\u09b0\u09c1\u09a6\u09cd\u09a7 \u09af\u09c7\u09ae\u09a8\u09c7 \u09a6\u09b2\u09c7 \u0986\u09ae\u09c0\u09b0 \u09b9\u09bf\u09b8\u09c7\u09ac\u09c7 \u09af\u09cb\u0997\u09a6\u09be\u09a8 \u0995\u09b0\u09b2\u09cb \u09a4\u09c7\u09ae\u09a8\u09bf \u09a4\u09be\u0995\u09c7 \u09ae\u09be\u09a8\u09ac\u09a4\u09be \u0985\u09aa\u09b0\u09be\u09a7\u09c0 \u09b9\u09bf\u09b8\u09c7\u09ac\u09c7 \u099a\u09bf\u09b9\u09cd\u09a8\u09bf\u09a4 \u0995\u09b0\u09be \u09b9\u09b2\u09cb \u098f\u09ac\u0982 \u09a4\u09a6\u09a8\u09cd\u09a4 \u09a8\u09be\u09ae\u09c7 \u09ae\u09a8 \u0997\u09dc\u09be \u09a4\u09a5\u09cd\u09af \u09b8\u0982\u09af\u09c1\u0995\u09cd\u09a4 \u0995\u09b0\u09c7 \u09b6\u09c7\u0996\u09be\u09a8\u09cb \u0995\u09a5\u09be\u09b0 \u09ae\u09be\u09ae\u09b2\u09be\u09b0 \u09b8\u09be\u0995\u09cd\u09b7\u09c0 \u09a4\u09c8\u09b0\u09c0 \u0995\u09b0\u09c7 \u09ad\u09bf\u09a4\u09cd\u09a4\u09bf \u09b9\u09c0\u09a8 \u09b8\u09be\u0995\u09cd\u09b7 \u09a6\u09bf\u09df\u09c7 \u09ab\u09be\u09b8\u09bf\u09b0 \u09b0\u09be\u09df \u09ac\u09c7\u09b0 \u0995\u09b0\u09c7 \u09a4\u09be\u0995\u09c7 \u09ab\u09be\u0981\u09b8\u09bf \u09a6\u09bf\u09df\u09c7 \u09ae\u09c7\u09b0\u09c7 \u09ab\u09c7\u09b2\u09be \u09b9\u09ac\u09c7 \u098f\u099f\u09be\u0987 \u0986\u0993\u09ae\u09c0\u09b0 \u09ae\u09c2\u09b2 \u09b2\u0995\u09cd\u09b7 \u0989\u09a6\u09cd\u09a6\u09c7\u09b6\u09cd\u09af \u0986\u0993\u09df\u09ae\u09c0\u09b2\u09c0\u0997 \u09b8\u09b0\u0995\u09be\u09b0 \u099c\u09be\u09b2\u09c7\u09ae \u09b8\u09b0\u0995\u09be", + "output": [ + "Even if a banana tree is given to him as the Amir of Jamaat-e-Islami, he will be hanged for crimes against humanity. It has become a profession and an addiction of the Awami League. The main objective of the Awami League is to make him a witness in a case of fabricated words by attaching fabricated information in the name of investigation." + ] + }, + { + "input": " \u09ae\u09be\u0987\u09b0\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u0997\u09b0\u09c7 \u09ac\u09b0\u09cd\u09ac\u09b0 \u099c\u09be\u09a4\u09bf\u09a6\u09c7\u09b0\u0995\u09c7 \u0997\u09be\u09a7\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0 \u09a5\u09c7\u0995\u09c7\u0993 \u0985\u09a7\u09ae\u09a6\u09c7\u09b0\u0995\u09c7 ", + "output": [ + "In Myra Malaunagar, the barbaric nations are worse than the donkeys" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u09af\u09c7 \u09ad\u09df \u09aa\u09c7\u09df\u09c7\u099b\u09c7 \u098f\u099f\u09be \u09a2\u09be\u0995\u09be \u099f\u09be\u0987\u09ae\u09b8 \u099c\u09be\u09a8\u09b2\u09cb \u0995\u09c7\u09ae\u09a8\u09c7 ", + "output": [ + "How did the Dhaka Times know that India was scared?" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u099f\u09cd\u09b0\u09c7\u09a8 \u09a6\u09c1\u09b0\u0998\u099f\u09a8\u09be \u09a6\u09c1\u0996\u09cb \u0995\u09b0\u09c7\u09a8 \u09ac\u09be\u09b0\u09ae\u09be \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09c7\u09b0 \u0993\u09aa\u09b0 \u09a8\u09bf\u09b0\u099c\u09be\u09a4\u09a8 \u099a\u09c1\u09aa\u099a\u09be\u09aa", + "output": [ + "Burma mourns train accident in India Burma persecutes Muslims silently" + ] + }, + { + "input": "\u0986\u09ae\u09b0\u09be \u0989\u09a8\u09cd\u09a8\u09a4\u09bf\u09b0 \u09a6\u09bf\u0995\u09c7 \u098f\u0997\u09bf\u09af\u09bc\u09c7 \u09af\u09be\u099a\u09cd\u099b\u09c7 \u09a4\u09be\u0987 \u09ad\u09be\u09b0\u09a4 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09ad\u09be\u09b2\u09cb \u099a\u09be\u09af\u09bc \u09a8\u09be \u09ad\u09ac\u09bf\u09b7\u09cd\u09af\u09a4\u09c7 \u09ad\u09be\u09b2\u09cb \u099a\u09be\u0987\u09ac\u09cb \u09a8\u09be", + "output": [ + "We are moving towards improvement so India does not want us well and will not want us well in the future" + ] + }, + { + "input": "\u09b9\u09c7 \u09ae\u09be\u09a8\u09ac \u09aa\u09cd\u09b0\u09c7\u09ae\u09c0 \u09b6\u09cd\u09b0\u09a6\u09cd\u09a7\u09c0\u09df \u09aa\u09cd\u09b0\u09a7\u09be\u09a8 \u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0 \u09ad\u09be\u09b0\u09a4\u09c7 \u099f\u09cd\u09b0\u09c7\u09a8 \u09a6\u09c2\u09b0\u09cd\u0998\u099f\u09a8\u09be\u09df \u09ae\u09be\u09a8\u09c1\u09b7 \u09ae\u09be\u09b0\u09be \u0997\u09c7\u09b2\u09c7 \u0986\u09aa\u09a8\u09be\u09b0 \u09ae\u09a8 \u0995\u09be\u09a6\u09c7 \u09b6\u09cb\u0995 \u09aa\u09cd\u09b0\u0995\u09be\u09b6 \u0995\u09b0\u09c7\u09a8 \u0986\u09b0 \u09ae\u09be\u09df\u09be\u09a8\u09ae\u09be\u09b0\u09c7 \u0986\u09ae\u09be\u09b0 \u09a7\u09b0\u09cd\u09ae\u09c0\u0993\u09a6\u09c7\u09b0 \u09af\u0996\u09a8 \u09aa\u09b6\u09c1\u09b0 \u09ae\u09a4 \u09b9\u09a4\u09cd\u09af\u09be \u0995\u09b0\u09be \u09b9\u099a\u09cd\u099b\u09c7 \u09b8\u09c7\u0996\u09be\u09a8\u09c7 \u0986\u09aa\u09a8\u09be\u09b0 \u09ae\u09be\u09a8\u09ac\u09a4\u09be \u0998\u09c1\u09ae\u09bf\u09df\u09c7 \u09a5\u09be\u0995\u09c7 \u09a8\u09be \u09ae\u09a8\u0995\u09c7 \u09b8\u09be\u09a8\u09cd\u09a4\u09a8\u09be \u09a6\u09bf\u09a4\u09c7 \u09aa\u09be\u09b0\u09a4\u09be\u09ae \u09af\u09a6\u09bf \u098f\u0995 \u09a6\u09bf\u09a8 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09a6\u09c7\u09b0 \u0995\u09a5\u09be \u09ae\u09c1\u0996\u09c7 \u0986\u09a8\u09a4\u09c7\u09a8 \u09a7\u09bf\u0995\u09cd\u0995\u09be\u09b0 \u099c\u09be\u09a8\u09be\u0987 \u0986\u09aa\u09a8\u09be\u09b0 \u09ae\u09be\u09a8\u09ac\u09a4\u09be\u09b0", + "output": [ + "Dear Prime Minister, your heartfelt condolences when people died in a train accident in India and your humanity is not sleeping when my religionists are being killed like animals in Myanmar." + ] + }, + { + "input": "\u09b8\u09bf\u09ab\u09be\u09a4 \u0989\u09b2\u09cd\u09b2\u09be\u09b9 \u098f\u0997\u09c1\u09b2\u09cb \u09a6\u09c7\u0996\u09be\u0987 \u09e8\u09af\u09bc \u09ac\u09be\u09b0 \u09b9\u09be\u09b0\u09cd\u099f\u09ab\u09c7\u09b2 \u0995\u09b0\u09ac\u09c7", + "output": [ + "Sifat Ullah will be heartbroken for the second time after seeing these" + ] + }, + { + "input": " \u099c\u09be\u09ae\u09be\u09a4\u09bf \u0987\u09b8\u09b2\u09be\u09ae\u09bf \u09b8\u0982\u0997\u09a0\u09a8 \u0995\u09b0\u09b2\u09c7\u0987 \u09a4\u09be\u09b0\u09be \u09b9\u09df \u09ae\u09be\u09a8\u09ac\u09a4\u09be \u09ac\u09bf\u09b0\u09a7\u09c0 \u0985\u09a5\u09ac\u09be \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u0995\u09cb\u09a8 \u0986\u0987\u09a8 \u09ac\u0987 \u09a5\u09c7\u0995\u09c7 \u098f\u0987 \u09a8\u09bf\u09df\u09ae \u09aa\u09be\u09b6 \u09b9\u09df ", + "output": [ + "As soon as Jamaat-e-Islami is formed, they either pass this rule from any anti-humanitarian or Razakar law book" + ] + }, + { + "input": "\u098f\u0995 \u09ac\u09be\u09b0 \u09b8\u09be\u09ae\u09a8\u09c7 \u09a5\u09c7\u0995\u09c7 \u09b2\u09a1\u09bc\u09be\u0987 \u09b6\u09c1\u09b0\u09c1 \u0995\u09b0\u09c7 \u09a6\u09c7\u0996 \u09ae\u09c0\u09b0 \u099c\u09be\u09ab\u09b0 \u09ae\u09a4\u09cb \u0996\u09be\u09b2\u09bf \u09aa\u09c7\u099b\u09a8\u09c7 \u09a5\u09c7\u0995\u09c7 \u099b\u09c1\u09b0\u09bf \u09ae\u09be\u09b0\u09be\u09b0 \u099a\u09c7\u09b7\u09cd\u099f\u09be \u0995\u09b0\u09bf\u09b8 ", + "output": [ + "Once you start fighting from the front, try to stab like Mir Zafar from behind" + ] + }, + { + "input": "\u0986\u09dc\u09be \u099a\u09cb\u09a6\u09be \u09b0\u09c7\u09aa\u09be\u09b0 \u0997\u09cb\u09b0\u09c7 \u09aa\u09c1\u099f\u0995\u09bf \u09ae\u09be\u09b0\u09a4\u09c7 \u09ae\u09a8 \u099a\u09be\u09df", + "output": [ + "Aara choda rapper Gore wants to kill Putki" + ] + }, + { + "input": "\u099a\u09c1\u09a4\u09ae\u09be\u09b0\u09be\u09a8\u09bf \u09a4\u09cb\u09b0\u09c7 \u099a\u09c1\u09a6\u09c0 \u0995\u09c1\u09a4\u09cd\u09a4\u09be \u09a6\u09bf\u09af\u09bc\u09be \u099a\u09cb\u09a6\u09be\u09ae\u09c1 ", + "output": [ + "Chutmarani tore chudi kutta diya chodamu" + ] + }, + { + "input": "\u0995\u09cb\u09a5\u09be\u09df \u0997\u09c7\u09b2 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09ae\u09c1\u09b0\u0997\u09c0 \u0995\u09ac\u09bf\u09b0 \u09b6\u09c1\u09df\u09cb\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0 \u099a\u09cb\u0996\u09c7 \u098f\u0997\u09c1\u09b2\u09cb \u09aa\u09dc\u09c7\u09a8\u09be \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u0997\u09be\u09df\u09c7 \u09ac\u09be\u09a4\u09be\u09b8 \u09b2\u09be\u0997\u09b2\u09c7\u0993 \u09ae\u09be\u0997\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u09b0 \u099a\u09c7\u09a4\u09a8\u09be\u09df \u0986\u0998\u09be\u09a4 \u09b2\u09be\u0997\u09c7", + "output": [ + "Where did the bitch's pola chicken go?" + ] + }, + { + "input": "\u0986\u09b0\u09ac\u09c7\u09b0 \u09ae\u09c7\u09df\u09c7\u09a6\u09c7\u09b0 \u09ed-\u09ee \u09ac\u099b\u09b0 \u09ac\u09df\u09b8\u09c7 \u09ae\u09be\u09b8\u09bf\u0995 \u09b9\u09df \u09a4\u09be\u09b9\u09b2\u09c7 \u09a4\u09cb \u0997\u09be\u09df\u09c7-\u0997\u09a4\u09b0\u09c7 \u0985\u09a8\u09c7\u0995 \u09b6\u0995\u09cd\u09a4\u09bf\u09b6\u09be\u09b2\u09c0 \u09b9\u09ac\u09be\u09b0 \u0995\u09a5\u09be ", + "output": [ + "If Arab girls start menstruating at the age of 6-7, then they should be much stronger" + ] + }, + { + "input": "\u09af\u09be\u09b0\u09be \u09ac\u09b2\u09c7 \u09ad\u09be\u09b0\u09a4 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09b0 \u09ac\u09a8\u09cd\u09a7\u09c1 \u09a4\u09be\u09b0\u09be\u0987 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09b6\u09a4\u09cd\u09b0\u09c1 ", + "output": [ + "Those who say that India is a friend of Bangladesh are the enemies of Bangladesh" + ] + }, + { + "input": "\u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09a6\u09c7\u09b0 \u09ae\u09a4\u09cb \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09c7\u09b6 \u09a5\u09be\u0995\u09a4 \u09a4\u09be\u0987\u09b2\u09c7 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09a7\u09b0\u09b7\u09a8 \u0995\u09b0\u09a4\u09be\u09ae ", + "output": [ + "If our country was like Pakistan, then we would rape Hindus" + ] + } + ] +} diff --git a/tasks/task1702_bn_hate_speech_news_category_classification.json b/tasks/task1702_bn_hate_speech_news_category_classification.json new file mode 100644 index 000000000..3f560e465 --- /dev/null +++ b/tasks/task1702_bn_hate_speech_news_category_classification.json @@ -0,0 +1,5842 @@ +{ + "Contributors": [ + "Sagar Rudagi" + ], + "Source": [ + " Bengali Hate Speech (https://huggingface.co/datasets/bn_hate_speech)" + ], + "Categories": [ + "News Category Classification" + ], + "Definition": "In this task, the news article will be provided in Bengali as the input and it is to be classified into one of the five categories of 'Personal', 'Political', 'Religious', 'Geopolitical', 'Gender abusive'.", + "Input_language": [ + "Bengali" + ], + "Output_language": [ + "English" + ], + "Instruction_language": [ + "English" + ], + "Positive Examples": [ + { + "input": "\u0987\u09a8\u09bf\u0987 \u09b9\u099a\u09cd\u099b\u09c7\u09a8 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf\u09b0\u0995\u09cd\u09b7\u09be\u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0 \u09ae\u09a8\u09c7\u09be\u09b9\u09b0 \u09aa\u09be\u09b0\u09bf\u0995\u09b0 \u098f\u0987 \u0995\u09a6\u09bf\u09a8 \u0986\u0997\u09c7\u0987 \u09af\u09bf\u09a8\u09bf \u0998\u09cb\u09b7\u09a8\u09be \u09a6\u09c7\u09a8 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09a6\u0996\u09b2 \u0995\u09b0\u09c7 \u09ae\u09b9\u09be\u09ad\u09be\u09b0\u09a4 \u0997\u09a0\u09a8 \u0995\u09b0\u09ac\u09c7\u09a8 \u0986\u09b6\u09cd\u099a\u09b0\u09cd\u09af \u09a4\u09bf\u09a8\u09bf\u0987 \u0995\u09bf\u09a8\u09be \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09ac\u09b0\u09c7\u09a8\u09cd\u09af \u09b0\u09be\u09b7\u09cd\u099f\u09cd\u09b0\u09c0\u09df \u0985\u09a4\u09bf\u09a5\u09bf", + "output": "Geopolitical", + "explanation": "The is a good example as the input contains words like Defense Minister and Bangladesh which verify it to belong to a Geopolitical category." + }, + { + "input": "\u098f\u0987 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09b0\u09be \u09ac\u09be\u0982\u0997\u09be\u09b2\u09bf\u09a6\u09c7\u09b0 \u09b8\u09be\u09ab\u09b2\u09cd\u09af \u09a6\u09c7\u0996\u09c7 \u09b9\u09bf\u0982\u09b8\u09be \u0995\u09b0\u09c7 \u09ac\u09be\u09b9\u09bf\u09b0 \u09a6\u09c7\u09b6\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c0\u09a6\u09c7\u09b0 \u09a6\u09c7\u0996\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7\u09a8\u09be \u098f\u0987 \u098f\u0995\u099f\u09bf \u09ae\u09be\u098f \u099c\u09be\u09a4\u09bf \u09b8\u09c1\u09a4\u09b0\u09be\u0982 \u09b8\u09be\u09ac\u09a7\u09be\u09a8 ", + "output": "Religious", + "explanation": "The is a good example as religions are being compared making it a religious category." + } + ], + "Negative Examples": [ + { + "input": "\u09a4\u09cb\u09a6\u09c7\u09b0 \u09ae\u09a4\u09cb \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09be \u09b8\u09cb\u09a8\u09bf\u0995\u09be\u09b0 \u09ae\u09a4\u09cb \u09ae\u09c7\u09df\u09c7\u09b0\u09be \u09aa\u09be\u0987\u09b2\u09c7 \u09b6\u09bf\u0993\u09b0 \u0997\u09cd\u09af\u09be\u0982\u09ac\u09cd\u09af\u09be\u0982 \u09a6\u09bf\u09ac\u09bf", + "output": "Religious", + "explanation": "The is a bad example as the input does not contain anything about any religion." + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09b0\u09be \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09a2\u09c1\u0995\u09b2\u09c7 \u0995\u09bf \u09a4\u09cb\u09b0 \u0995\u09cb\u09a8 \u09b8\u09ae\u09b8\u09cd\u09af\u09be ", + "output": "Geopolitical", + "explanation": "The is a bad example as the input contains Bangladesh but the focus is not on that. It also does not talk about politics and ." + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u09ae\u09cb\u09a6\u09c7\u09b0 \u09ac\u09be\u0981\u09b6\u09ad\u09be\u0987 \u09a6\u09be\u09a6\u09be\u09b0\u09be \u0986\u09b8\u09be\u09b0\u09a6\u09b0\u0995\u09be\u09b0 \u09a8\u09be\u0987 \u0993 \u0986\u09b6\u09be\u09ae\u09be\u09a8\u09c7 \u09af\u09c7\u0995\u09cb\u09a8\u09ad\u09be\u09ac\u09c7 \u09ac\u09be\u0982\u09a6\u09c7\u09b6\u09c7\u09b0\u0995\u09c7 \u09ac\u09be\u09b6\u09a6\u09bf\u09df\u09c7\u099c\u09be\u09ac\u09c7 ", + "output": "Political", + "explanation": "The is a bad example as the emphasis is on both politics and the geolocation but only political viewpoint is taken into account." + } + ], + "Instances": [ + { + "input": "\u0995\u09c1\u09b2\u09be\u0999\u09cd\u0997\u09be\u09b0 \u09ae\u09b9\u09bf\u09b2\u09be", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f \u0996\u09be\u09a8\u0995\u09bf \u09a4\u09cb\u09b0 \u0997\u09c1\u09a6\u09c7 \u0995\u09a4\u09cb \u0996\u09bf\u09a6\u09c7 \u0986\u09ae\u09bf \u09a4\u09c7\u0995\u09c7 \u099a\u09c1\u09ac\u09cc", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09cb\u09b0 \u09ad\u09be\u09b7\u09be\u09df \u09ac\u09c1\u099c\u09be\u09af\u09be\u09df \u09a4\u09c1\u0987 \u0995\u09c7\u09ae\u09a8 \u0998\u09b0\u09c7\u09b0 \u09ae\u09c7\u09df\u09c7 \u09a4\u09cb\u09b0\u09c7 \u09aa\u09be\u0987\u09b2\u09c7 \u0995\u09c1\u09a4\u09cd\u09a4\u09be \u09a6\u09bf\u09df\u09be \u09aa\u09be\u09b2 \u09a6\u09c7\u0993\u09df\u09be\u0987\u09a4\u09be\u09ae \u09ac\u09c7\u09b6\u09cd\u09af\u09be ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09b0 \u09ae\u09a4\u09cb \u09ae\u09c7\u09df\u09c7\u09a6\u09c7\u09b0 \u099c\u09a8\u09cd\u09ae\u09c7\u09b0 \u099f\u09bf\u0995 \u09a8\u09be\u0987 \u09b0\u09be\u09b8\u09cd\u09a4\u09be\u09df \u099c\u09a8\u09cd\u09ae\u09c7\u099b\u09bf\u09b2\u09c7 \u09ae\u09a8\u09c7 \u09b9\u09df ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a8\u09be\u099a\u09bf\u09b0\u09be \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u09b0 \u0997\u09c1\u09b7\u09cd\u099f\u09bf\u09b0\u09c7 \u0995\u09c1\u09ae\u09bf\u09b2\u09cd\u09b2\u09be\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7\u09c7 \u0995\u09b0\u099b\u09c7", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09cb\u09b0\u09be \u0995\u09bf \u0986\u09be\u09ac\u09be\u09b8\u09bf\u0995\u09c7 \u099a\u09cb\u09a6\u09be \u09a6\u09c7\u09b8 \u09a4\u09b0 \u09ad\u09c1\u09a6\u09be \u09a6\u09bf\u09df\u09c7 \u09ac\u09be\u09b6 \u09a6\u09bf\u09ae\u09c1 \u09ae\u09be\u0997\u09bf \u0996\u09be\u09a8\u0995\u09bf \u09ae\u09be\u0997\u09bf \u09a4\u09b0\u09c7 \u09b9\u09be\u09a4\u09bf \u09a6\u09bf\u09df\u09c7 \u099a\u09c1\u09a6\u09be\u09ae\u09bf \u09ae\u09be\u0997\u09bf", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ac\u09be\u0982\u09b2\u09be \u09a6\u09c7\u09b6\u09c7\u09b0 \u09ae\u09c7\u09df\u09c7\u09b0\u09be \u098f\u09a4\u09cb \u0985\u09a8\u09c7\u0995 \u0996\u09be\u09b0\u09be\u09aa \u099b\u09bf \u099b\u09bf \u099b\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09cb\u09b0\u09ae\u09be\u09b0\u09c7 \u099a\u09c1\u09a6\u09bf \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u098f\u0997\u09c1\u09b2\u09bf \u0995\u09bf\u09a6\u09c7\u099a", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf \u09ae\u09be\u0997\u09bf \u09aa\u09c7\u09be \u09b0\u09be\u099c\u09a8\u09bf\u09a4\u09bf \u09ac\u09cb\u099c\u09a8\u09be \u09b8\u09be\u09b2\u09be \u09b9\u09bf\u09b2\u09be\u09b0\u09bf \u09af\u0997\u09cd\u09af \u09a8\u09c7\u09a4\u09be", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ac\u09cc\u09a6\u09cd\u09a7 \u09ae\u09be\u09df\u09be\u09a8\u09ae\u09be\u09b0 \u09b8\u09c7\u09a8\u09be\u09a6\u09c7\u09b0 \u0986\u09a8\u09cd\u09a4\u09b0\u09bf\u0995 \u0985\u09ad\u09bf\u09a8\u09a8\u09cd\u09a6\u09a8 \u099c\u09be\u09a8\u09be\u0987 \u098f\u0987 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be \u09ae\u09cb\u09b2\u09cd\u09b2\u09be \u09b6\u09c1\u0993\u09b0\u09a6\u09c7\u09b0 \u09ae\u09c7\u09b0\u09c7 \u09a6\u09cb\u099c\u0996\u09c7 \u099a\u09be\u09b2\u09be\u09a8 \u0995\u09b0\u09c7 \u09a6\u09c7\u0993\u09df\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u0996\u09c1\u09ac \u09ac\u09be\u09a1\u09bc \u09ac\u09c7\u09a1\u09bc\u09c7\u099b\u09bf\u09b2 \u09ae\u09cb\u09b2\u09cd\u09b2\u09be \u09b6\u09c1\u0993\u09b0\u09a6\u09c7\u09b0 \u09a6\u09b2\u099f\u09be\u09b0 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be \u09ae\u09cb\u09b2\u09cd\u09b2\u09be \u09b6\u09c1\u0993\u09b0\u09c7\u09b0\u09be \u09ae\u09be\u09df\u09be\u09a8\u09ae\u09be\u09b0\u09c7 \u0996\u09c1\u09a8 \u09a7\u09b0\u09cd\u09b7\u09a8 \u09b2\u09c1\u099f\u09aa\u09be\u099f \u09b2\u09c1\u099a\u09cd\u099a\u09be\u09ae\u09bf \u09a1\u09cd\u09b0\u09be\u0997 \u09aa\u09be\u099a\u09be\u09b0 \u09b8\u09ac \u09b0\u0995\u09ae\u09c7\u09b0 \u0986\u0995\u09be\u09ae \u0995\u09c1\u0995\u09be\u09ae \u0995\u09b0\u09c7 \u099a\u09c1\u09a6\u09a8\u09be \u09a8\u09ac\u09c0 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09b9\u099c\u09b0\u09a4 \u09ae\u09b9\u09be\u0989\u09a8\u09cd\u09ae\u09be\u09a6 \u0997\u09c1\u0983 \u09ac\u09be\u09a8\u09cd\u099a\u09cb\u09a4 \u09b0\u09b8\u09c1\u09a8\u09c7\u09b0 \u0995\u09a8\u09cd\u09a1\u09cb\u09ae \u09ab\u09be\u099f\u09be \u099c\u09be\u09b0\u099c \u09b8\u09a8\u09cd\u09a4\u09cd\u09b0\u09be\u09b8\u09c0 \u09ae\u09cb\u09b2\u09cd\u09b2\u09be \u09b6\u09c1\u0993\u09b0\u09a6\u09c7\u09b0 \u09aa\u09c1\u099f\u09c1\u09a4\u09c7 \u09ac\u09be\u09b2 \u0995\u09c1\u09b0\u09be\u09a8 \u0997\u09c1\u099c\u09c7 \u09a6\u09bf\u09a4\u09c7 \u09b9\u09ac\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u099a\u09c7\u09b9\u09be\u09b0\u09be\u099f\u09be \u09a6\u09c7\u0996\u099b\u09cb \u09ae\u09a8\u09c7 \u09b9\u09df \u09b8\u09be\u09b2\u09bf\u09b0 \u09b0\u09c7\u09ab \u0995\u09b0\u09be \u09b9\u09df\u099b\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09cb\u09ae\u09be\u0995\u09c7 \u099a\u09c1\u09a6\u09be\u09b0 \u09ac\u09c8\u09a6\u09a4\u09be \u0986\u09ae\u09bf \u09a6\u09bf\u09b2\u09be\u09ae \u09a7\u09b0\u09b7\u09a8 \u0995\u09b0\u09be\u09b0 \u0989\u09a8\u09ae\u09c1\u09a4\u09bf \u0986\u09ae\u09bf \u09a6\u09bf\u09b2\u09be\u09ae \u09ac\u09c7\u09b6\u09cd\u09af\u09be \u0996\u09be\u09a8\u0995\u09bf \u09b8\u09c1\u099a\u09bf", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987\u09b8\u09ac \u09ae\u09be\u0997\u09c0 \u09a6\u09c7\u09b0 \u0995\u09c7 \u099a\u09c1\u09a6\u09be \u09b6\u09be\u0989\u09df\u09be\u09a4\u09c7 \u09a8\u09be\u0997\u09be \u09ae\u09b0\u09bf\u099a \u09b2\u09be\u0997\u09be\u0987\u09df\u09be \u09a6\u09bf\u09b2\u09c7 \u09ad\u09be\u09b2\u09cb \u09b9\u09a4| ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0993\u09b0 \u09ac\u09cb\u09a6\u09be\u09df \u09ac\u09b6\u09bf \u09a6\u09bf\u09df\u09be \u09ac\u09bf\u09a6\u09be\u09df\u09be \u099f\u09be\u09a8 \u09a6\u09c7\u09df\u09be \u09b9\u09cb\u0995 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a8\u09a1\u09bf\u09b0 \u09aa\u09c1\u09a4\u09c7\u09b0\u09be \u09b8\u09ac \u09af\u09be\u09df\u0997\u09be\u09df \u09ad\u09c7\u099c\u09be\u09b2 \u09b2\u09be\u0997\u09bf\u09df\u09c7 \u09b0\u09be\u0996\u09c7 \u0986\u09b0 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u09b0\u09be \u09a4\u09c7\u09b2 \u09ae\u09be\u099c\u09be\u09b0 \u0995\u09a5\u09be \u09ac\u09b2\u09c7 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u098f\u09b0 \u0997\u09c1\u09b7\u09cd\u099f\u09bf \u09ae\u09be\u09b0\u09bf", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a8\u09be\u09df\u09bf\u0995\u09be \u09ab\u09c7\u09b2 \u09a4\u09b0\u09c7 \u098f\u0995 \u09b0\u09be\u09a4 \u099a\u09c1\u09a4\u09c7 \u09aa\u09be\u09b0\u09b2\u09c7 \u0985\u09a8\u09c7\u0995 \u09ac\u09be\u09b2 \u09b2\u09be\u0997\u09a4 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf\u09b0\u09c7 \u0995\u09c1\u09a4\u09cd\u09a4\u09be \u09a6\u09bf\u09df\u09c7 \u099a\u09c1\u09a6\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf \u0996\u09be\u09a8\u0995\u09bf \u09a4\u09cb\u09b0 \u0995\u09bf \u09ae\u09be \u09ac\u09be\u09ac\u09be \u09ad\u09be\u0987 \u09ac\u09cb\u09a8 \u09a8\u09be\u0987 \u09ae\u09be\u0997\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u099b\u09ac\u09bf \u09ae\u09be\u09a8\u09c1\u09b7 \u09a6\u09c7\u0996\u09c7 \u09a8\u09be\u0995\u09bf \u0996\u09be\u09a8\u0995\u09bf\u09b0\u09be \u09af\u09cc\u09a8\u09a4\u09be \u09a6\u09c7\u0996\u09be\u09df ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf \u09a4\u09b0 \u0995\u09bf \u09ac\u09dc \u09ad\u09be\u0987 \u09a8\u09be\u0987 \u09a4\u09be\u09b0 \u09b8\u09be\u09a5\u09c7 \u0993 \u09a4 \u0996\u09be\u09b0\u09be\u09aa \u0995\u09be\u099c \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09bf\u09b8 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf\u09b0 \u09ad\u09cb\u09a6\u09be\u09df \u098f\u09a4\u09cb \u099c\u09cd\u09ac\u09be\u09b2\u09be \u0995\u09c7\u09a8", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09b9\u09be\u09b2\u09be \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09c1\u09b2\u09be \u09a4\u09c1\u0987 \u09ac\u09a6\u09cd\u09a6\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099b\u09be \u0986\u0997\u09c7 \u09a4\u09b0\u09c7\u0987 \u09ae\u09be\u09b0\u09be \u09a6\u09b0\u0995\u09be\u09b0", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u0997\u09c1\u09b2\u09cb \u0996\u09be\u0999\u09cd\u0995\u09bf \u09ae\u09be\u0997\u09c0 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 2\u0987 \u09ae\u09be\u0997\u09bf\u09b0 \u09ad\u09c1\u09a7\u09be\u09b0 \u0996\u09be\u0987\u099c \u0989\u099f\u099b\u09c7 \u09b8\u09ac\u09be\u0987 \u099a\u09c1\u09a6\u09c7 \u09a6\u09be\u0989 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a6\u09c7\u09b6\u099f\u09be \u09ae\u09be\u0997\u09bf \u09a6\u09bf\u09df\u09be \u09ad\u0987\u09b0\u09be \u0997\u09c7\u099b\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0985\u09be\u09ae\u09be\u09b0 \u09ae\u09a8\u09c7 \u09b9\u09df \u09aa\u09c7\u0987\u099c\u09c7\u09b0 \u098f\u09a1\u09ae\u09bf\u09a8 \u09ab\u09be\u099c\u09bf\u09b2\u09c7\u09b0 \u09b8\u09be\u09aa\u09b0\u09cd\u099f \u0995\u09b0\u09c7 \u09a4\u09be\u0987 \u0985\u09be\u09b0\u099c\u09c7\u09a8\u099f\u09bf\u09a8\u09be\u0995\u09c7 \u0985\u09b8\u09b9\u09be\u09df \u09ac\u09b2\u099b\u09c7 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u0985\u09b8\u09b9\u09be\u09df \u0995\u0987\u09b2\u09bf \u0995\u09c7\u09b0\u09c7", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09b6\u09cd\u09b0\u09be\u09ac\u09a8\u09c0 \u09b6\u09be\u09df\u09be\u09b2\u09be\u0995\u09c7 \u099a\u09c1\u09a6\u09ac\u09cb \u0993\u09b0 \u09ae\u09be \u0995\u09c7 \u0995\u09c1\u0995\u09c1\u09b0 \u09a6\u09bf\u09df\u09c7 \u099a\u09c1\u09a6\u09be\u09ac\u09cb ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09b9\u09bf\u09b2\u09be \u098f\u0995\u099f\u09be \u09ae\u09be\u0997\u09bf \u0986\u09b0 \u0985 \u098f\u0995\u099f\u09be \u09b6\u09df\u09a4\u09be\u09a8 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09c1\u09a4 \u09b8\u09be\u0982\u0998\u09be\u09a4\u09bf\u0995 \u09b0\u09be \u0995\u09cb\u09a8\u099f\u09be \u099c\u09bf\u09b9\u09be\u09a6 \u0995\u09cb\u09a8\u099f\u09be \u099c\u0999\u09cd\u0997\u09bf \u09a4\u09cb\u09b0\u09be \u09ac\u09cb\u099d\u09cb\u09b8 \u09ac\u09be\u09a8\u09cd\u09a6\u09bf\u09b0 \u09aa\u09c1\u09a4\u09c7\u09b0\u09be", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0995\u09cb\u09a5\u09be\u09df \u0997\u09c7\u09b2 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09ae\u09c1\u09b0\u0997\u09c0 \u0995\u09ac\u09bf\u09b0 \u09b6\u09c1\u09df\u09cb\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0 \u099a\u09cb\u0996\u09c7 \u098f\u0997\u09c1\u09b2\u09cb \u09aa\u09dc\u09c7\u09a8\u09be \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u0997\u09be\u09df\u09c7 \u09ac\u09be\u09a4\u09be\u09b8 \u09b2\u09be\u0997\u09b2\u09c7\u0993 \u09ae\u09be\u0997\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u09b0 \u099a\u09c7\u09a4\u09a8\u09be\u09df \u0986\u0998\u09be\u09a4 \u09b2\u09be\u0997\u09c7", + "output": [ + "Gender abusive" + ] + }, + { + "input": " \u09ae\u09be\u0997\u09bf \u0995\u09bf \u09b9\u099a\u09c7\u099b \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09a4\u09cb\u09b0 \u0995\u09bf \u099a\u09cb\u0996 \u0985\u09a8\u09a7 \u09b9\u09df\u09c7 \u0997\u09c7\u099b\u09c7 \u09a4\u09c1\u0987 \u09a6\u09c7\u0996\u09a4\u09c7 \u09aa\u09be\u09b8 \u09a8\u09be \u09a4\u09c1\u0987 \u0996\u09be\u09b2\u09bf \u09ac\u09bf \u098f\u09a8 \u09aa\u09bf \u09a8\u09bf\u09df\u09c7 \u0986\u099b\u09bf\u09b8 \u0995\u09be\u09b0\u09a8 \u099f\u09be \u0995\u09bf \u09a4\u09cb\u09b0 \u0986\u0982\u09b2\u09bf\u0997\u09c7\u09b0 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09a6\u09c7\u09b0 \u09a7\u09b0\u09bf\u09b8 \u09a8\u09be \u0995\u09c7\u09a8 \u09a8\u09be\u0994\u0997\u09c1\u09b2\u09cb \u09aa\u09c1\u09b8\u09c7 \u09b0\u09be\u0996\u09a4\u09c7\u099b \u0987\u09b2\u09c7\u0995\u09b8\u09a8\u09c7 \u0995\u09be\u099c \u09a6\u09c7\u09ac\u09c7 \u09a4\u09be\u0987 \u09a8\u09be ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u099f\u09be \u0985\u09a8\u09c7\u0995 \u099c\u099f\u09bf\u09b2 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09ac\u09bf\u09ac\u09bf\u09b8\u09bf \u0993 \u09a4\u09be\u09b0 \u09b8\u09be\u0982\u09ac\u09be\u09a6\u09bf\u0995 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09cb\u0995\u09c7 \u0995\u09c1\u09a4\u09cd\u09a4\u09be \u09a6\u09bf\u09df\u09c7 \u099a\u09c1\u09a6\u09be\u09ac\u09cb \u09ae\u09be\u0997\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u09b0\u09be \u09a6\u09c1\u0987 \u099c\u09a8 \u09b0\u09b9\u09bf\u0982\u0997\u09be \u09ae\u09be\u0997\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ac\u09c7\u0987\u09b6\u09cd\u09af\u09be\u09b0 \u099c\u09a8\u09cd\u09ae\u09c7\u09b0 \u09ab\u09b8\u09b2 \u09ae\u09be\u0997\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09b6\u09be\u0993\u09df\u09be \u09ae\u09a6\u09c7 \u09ac\u09be\u09b6 \u09a6\u09bf\u09ae\u09c1 \u09b2\u099f\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0986\u09b8\u09b2 \u09ae\u09be\u0997\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u09aa\u09bf\u09a8\u09cd\u099f\u09c1 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09a4\u09c1\u0987 \u098f\u0996\u09be\u09a8\u09c7 \u0995\u09bf \u0995\u09b0\u09b8", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u09a4\u09cb\u09ae\u09be\u09a6\u09c7\u09b0 \u09b0\u09c7\u099f \u0995\u09a4 \u09a4\u09cb\u09ae\u09b0\u09be \u0995\u09bf \u09a6\u09c1\u099c\u09a8\u09c7 \u098f\u0995\u09b8\u09be\u09a5\u09c7 \u0986\u09b8\u09ac\u09be ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u09b0\u09be \u09b8\u09ac \u099c\u09be\u09df\u0997\u09be\u09df \u098f\u0995\u0987 \u0995\u09ae\u09c7\u09a8\u09cd\u099f \u0995\u09b0\u099b\u09c7", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09cb\u09b0\u09be\u09a4\u09cb \u09a6\u09be\u09b2\u09be\u09b2 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09b8\u09be\u0982\u09ac\u09be\u09a6\u09bf\u0995", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u09b8\u09ac \u0995\u09be\u09a8\u0995\u09bf\u09b0 \u09ac\u09be\u099a\u099b\u09be \u0986\u09b0 \u0986\u09b0 \u0995\u09be\u09a8\u0995\u09bf\u09b0 \u09ae\u09be\u0997\u09c0 \u0997\u09cb \u09aa\u09be\u099a\u09be\u09df \u09ac\u09be\u09b6 \u09a1\u09c1\u0995\u09be\u09a8\u09cb\u09b0 \u09a6\u09b0\u0995\u09be\u09b0 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u0995\u09be\u0982\u0995\u09bf\u09b0 \u09ae\u09c7\u09df\u09c7 \u09a4\u09b0 \u09ae\u09be\u09b0 \u09ac\u09c1\u09a6\u09be\u09b0 \u09ac\u09bf\u09a4\u09b0\u09c7 \u09b2\u09be\u09b2 \u09ae\u09b0\u09bf\u09b8 \u09a6\u09bf\u09ae\u09c1 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u099a\u09c1\u09a4\u09ae\u09be\u09b0\u09be\u09a8\u09bf \u09a4\u09cb\u09b0\u09c7 \u099a\u09c1\u09a6\u09c0 \u0995\u09c1\u09a4\u09cd\u09a4\u09be \u09a6\u09bf\u09af\u09bc\u09be \u099a\u09cb\u09a6\u09be\u09ae\u09c1 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09c0\u09b0 \u09aa\u09c1\u0995\u099f\u09bf \u09a6\u09bf\u09df\u09be \u09ac\u09bf\u0995\u09be\u09b6 \u09a6\u09bf\u09a4\u09c7 \u09b9\u09ac\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u09a1\u09be\u09a8\u09a1\u09bf \u0996\u09be\u09a8\u0995\u09bf \u09ae\u09be\u0997\u09bf\u09b0\u09c7 \u0993\u09b2\u0982\u0997\u09cb \u0995\u09b0\u09c7 \u09aa\u09bf\u099f\u09be\u09a8\u09c7\u09b0 \u09a6\u09b0\u0995\u09be\u09b0", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u09b0 \u09ad\u09cb\u09a6\u09be \u09b8\u09ac\u09be\u0987 \u09ab\u09be\u099f\u09be\u0993", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09e8\u099f\u09be\u09b0\u09c7\u0987 \u09ab\u09be\u0995\u09bf\u0982 \u09ac\u09bf\u099a \u09b2\u09be\u0997\u09a4\u09be\u09b8\u09c7 \u0986\u09b0 \u098f\u0987 \u099a\u09cb\u09a6\u09a8\u09be\u09b0\u09be \u09a8\u09be\u0995\u09bf \u09a6\u09c7\u09b6\u09b0\u09c7 \u09b0\u09bf\u09aa\u09cd\u09b0\u09c7\u099c\u09c7\u09a8\u09cd\u099f \u0995\u09b0\u099b\u09c7", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09b8\u09be\u09b2\u09bf\u09b0\u09c7 \u0995\u09a0\u09bf\u09a8 \u09b8\u09be\u099c\u09be \u09a6\u09c7\u0993\u09df\u09be \u09b9\u09cb\u0995 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf \u09a4\u09cb\u0995\u09c7 \u09aa\u09c7\u099f\u09c7 \u09a6\u09b0\u099a\u09c7 \u09b8\u09c7 \u09ad\u09dc \u09ae\u09be\u0997\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09aa\u09bf\u09aa\u09dc\u09be \u09ae\u09be\u09b0\u09b2\u09c7\u0993 \u09ad\u09be\u09b2\u09cb \u0995\u09b0\u09c7 \u09aa\u09cd\u09b0\u099a\u09be\u09b0 \u0995\u09b0\u09bf\u09b8 \u0986\u09b0 \u09ae\u09be\u09df\u09be\u09a8\u09ae\u09be\u09b0 \u098f\u09b0 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09b9\u09a4\u09cd\u09af\u09be \u0995\u09b0\u099b\u09c7 \u0986\u09b0 \u09a4\u09b0\u09be \u09ac\u09b2\u09bf\u09b8\u09cd \u098f\u0987 \u0997\u09c1\u09b2\u09cb \u09a8\u09be\u0995\u09bf \u09ae\u09bf\u09a5\u09cd\u09af\u09be \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09a6\u09be\u09b2\u09be\u09b2", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0986\u09b0\u09c7 \u09a8\u09a1\u09bf \u09ae\u09be\u0997\u09bf\u09b0 \u099c\u09be\u09a4 \u09b2\u09be\u0987\u09ad\u09c7 \u098f\u09b8\u09c7 \u099b\u09c7\u09b2\u09c7\u0995\u09c7 \u09ad\u09be\u09b2\u09cb \u0995\u09b0\u09cb \u09ad\u09b0\u09c7 \u09a6\u09bf\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7\u09a8 \u09a8\u09be\u0987 \u09ac\u09b2\u09c7 \u099a\u09b2\u09c7 \u0997\u09c7\u099b\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09c1\u09b0\u09be \u09ac\u09be\u0982\u09b2\u09be \u09a6\u09c7\u09b6\u0995\u09c7 \u09b8\u09c7\u09b8\u0995\u09b0\u09b2\u09bf \u09ac\u09c7\u09b8\u09b8\u09be\u09b0\u09be \u09a4\u09a6\u09c7\u09b0 \u099c\u09a8\u09cb \u09aa\u09c1\u09b2\u09be \u09aa\u09be\u09df\u09a8 \u0996\u09be\u09b0\u09be\u09aa \u09b9\u09df \u0997\u09be\u09b2\u09ae\u09be\u09b0\u09be\u09a8\u09bf\u09b0\u09bf\u09b0\u09be \u099a\u09c1\u09a6\u09be\u09b0 \u0987\u099a\u099a\u09be \u09a5\u09be\u0995\u09b2\u09c7 \u0995\u09c1\u09df\u09c7\u09a4 \u0986\u09df \u09a6\u09bf\u0995\u09bf \u0995\u09a4 \u099a\u09c1\u09a6\u09be \u0996\u09be\u09df\u09a4\u09c7 \u09aa\u09be\u09b0\u09b8 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0993\u09b0\u09c7 \u09b8\u09be\u09b2\u09bf \u0996\u09be\u09a8\u0995\u09bf \u09ae\u09be\u0997\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u099f\u09be\u0995\u09be \u0995\u09bf \u09a4\u09cb\u09b0 \u09ae\u09be\u0995\u09c7 \u09a8\u09be \u09ac\u09be\u09aa \u0995\u09c7 \u09ad\u09be\u0987 \u0995\u09c7 \u09ac\u09cb\u09a8 \u0995\u09c7 \u0996\u09be\u0993\u09df\u09be\u09b8 \u09ae\u09b0\u09ac\u09bf \u09a8\u09be \u09ae\u09be\u0997\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09c1\u09b2\u09be \u09ad\u09bf\u0995\u09cd\u09b7\u09be\u09b0\u09bf\u09b0 \u099c\u09be\u09a4 \u09b9\u09b2\u09bf \u09a4\u09cb\u09b0 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u0995\u09be\u099b \u09a5\u09c7\u0995\u09c7 \u09ac\u09c7\u09b0\u09c1\u09ac\u09be\u09dc\u09bf \u09ad\u09bf\u0995\u09cd\u09b7\u09be \u099a\u09c7\u09df\u09c7 \u09a8\u09bf\u099b\u09b8 \u0986\u09b0 \u09b9\u09c7 \u09ae\u09be\u09a8\u09a8\u09c0\u09df \u09aa\u09cd\u09b0\u09a7\u09be\u09a8\u09ae\u09a8\u09cd\u09a4\u09c0 \u09b6\u09c7\u0996 \u09b9\u09be\u09b8\u09bf\u09a8\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u09a4\u09cb\u09b0\u09be\u0993 \u09ac\u09be\u0987\u099a\u09cd\u099a\u09be \u0997\u09c7\u099b\u09b8 \u0986\u09b0 \u09b9\u09c7 \u09a4\u09b0 \u09a8\u09c7\u09b9\u09c7\u09b0\u09c1 \u09ac\u09be\u09ac\u09be \u09b9\u09b2\u09cb \u09ac\u09dc \u09ad\u09bf\u0995\u09cd\u09b7\u09c1\u0995 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09c1\u09b2\u09be \u09a4\u09be\u09b0 \u09ac\u0989\u09b0\u09c7 \u09b0\u09c7\u09a1\u0995\u09cd\u09b2\u09bf\u09ab \u099a\u09c1\u09a6\u09a4\u09c7 \u09a6\u09bf\u09df\u09be \u0986\u09ae\u0997\u09cb \u0995\u09be\u099b \u09a5\u09be\u0987\u0995\u09be \u09aa\u09b6\u09cd\u099a\u09bf\u09ae\u09ac\u0999\u09cd\u0997 \u0986\u09b2\u09be\u09a6\u09be \u0995\u09b0\u099b\u09cb \u09b8\u09c1\u09a4\u09b0\u09be\u0982 \u0986\u09b8\u09b2 \u09ad\u09bf\u0995\u09cd\u09b7\u09c1\u0995 \u09b9\u09b2\u09bf \u09a4\u09be\u09b0\u09be \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09a8\u09b0", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0990 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09c1\u09b2\u09be \u09a8\u09cb\u0982\u09b0\u09be\u09ae\u09c0\u09b0 \u0986\u09b0 \u099c\u09be\u09df\u0997\u09be\u09aa\u09be\u09b8 \u09a8\u09be\u0987 \u09a4\u09b0\u09be \u0995\u09bf \u09ad\u09be\u09b2\u09cb \u09ac\u09be\u09ac\u09be\u09ae\u09be\u09b0 \u099a\u09c1\u09a6\u09be\u09b0 \u09a8\u09be\u0995\u09bf \u0985\u09a8\u09cd\u09af \u0995\u09cb\u09a8 \u09a7\u09b0\u09cd\u09ae\u09c7\u09b0 \u099a\u09c1\u09a6\u09be\u09b0 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09c1\u09b2\u09be \u09b8\u09ac\u09be\u0987 \u09a6\u09c7\u0996\u09c1\u09a8 \u098f\u0987 \u09b2\u09bf\u0982\u0995 \u098f \u09a8\u09bf\u09df\u09c7 \u09af\u09be\u09ac\u09c7 \u09ad\u09be\u0987\u09df\u09c7\u09b0\u09be \u09ac\u09bf\u09b6\u09cd\u09af\u09be\u09b8 \u0995\u09b0\u09ac\u09c7 \u09a8\u09be \u098f\u0996\u09a8\u0987 \u0986\u09ae\u09bf \u0986\u09aa\u09a8\u09be\u09b0\u09be \u09af\u0996\u09a8 \u09a6\u09c7\u0996\u09a4\u09c7 \u099a\u09be\u0987\u09ac\u09c7\u09a8 \u09a4\u0996\u09a8 \u0986\u09aa\u09a8\u09be\u09a6\u09c7\u09b0 \u098f\u0987 \u09aa\u09c7\u0987\u099c\u099f\u09be\u09a4\u09c7 \u09a8\u09bf\u09df\u09cb \u09af\u09be\u09ac\u09c7 \u09a6\u09c7\u0996\u09c7\u09a8", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0986\u0993\u09ae\u09bf\u09b2\u09bf\u0997 \u099c\u09b0\u09bf\u09df\u09a4 \u09a8\u09be\u0987 \u09a4\u09ac\u09c7 \u0995\u09bf \u09a4\u09cb\u09b0 \u09ac\u09be\u09ac\u09be \u09ae\u09be \u099c\u09b0\u09bf\u09df\u09a4 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09c7\u09df\u09c7\u09b0\u09be \u09ac\u09c7\u0995\u09c1\u09ac\u0987 \u09b9\u09df \u09a8\u09a4\u09c1\u09a8 \u0995\u09bf\u099b\u09c1 \u09a8\u09be \u09b9\u09be \u09b9\u09be \u09b9\u09be", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u099b\u09c7\u09b2\u09c7\u0995\u09c7 \u09b2\u09be\u09a5\u09bf \u09ae\u09c7\u09b0\u09c7 \u09ac\u09c7\u09b0 \u0995\u09b0\u09c7 \u09a6\u09be\u0993 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u09b0\u0995\u09ae \u09ac\u09dc \u09ae\u09c7\u09df\u09c7\u0995\u09c7 \u09ac\u09bf\u09df\u09c7 \u0995\u09b0\u09a4\u09c7 \u09b9\u09ac\u09c7 \u09a6\u09c1\u09a7 \u0996\u09c7\u09df\u09c7 \u09ae\u099c\u09be \u09aa\u09be\u09ac ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u09b8\u09aa \u09ac\u09c7\u09b8\u09b8\u09be \u09aa\u09cb\u09a4\u09bf\u09a4\u09be\u09a6\u09c7\u09b0 \u09ae\u09be \u09ac\u09be\u09aa \u09a8\u09be\u0987 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a2\u09be\u0995\u09be\u09f0 \u09ae\u09be\u09b2 \u099a\u09c1\u09a6\u09be\u099b\u09cb \u09b6\u09c7\u09ae\u099c\u09be ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf \u09ae\u09be \u09a4\u09cb \u09b2\u09be\u0987\u09ab\u09c7 \u0986\u09b8\u09c7\u09a8\u09be \u09ae\u09be\u0997\u09bf \u09a8\u09be \u09b9\u09b2\u09c7 \u09b2\u09be\u0987\u09ab\u09c7 \u0995\u09a8 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u09b2 \u099f\u09be \u099f\u09bf\u0995 \u0986\u099b\u09c7 \u099a\u09c1\u09a6\u09b2\u09c7 \u09ae\u099c\u09be \u0987 \u09ae\u099c\u09be \u09aa\u09be\u0993\u09df\u09be \u09af\u09be\u09ac\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u09b0\u09be \u09ae\u09be\u09a8\u09c1\u09b8 \u09a8\u09be\u09ae\u09c7\u09b0 \u0995\u09b2\u09cd\u09a8\u0995 \u09ae\u09be\u0997\u09bf \u09b8\u09cd\u09ac\u09be\u09ae\u09bf \u09af\u09a4 \u0996\u09be\u09b0\u09be\u09aa \u09b9\u09df \u09a8\u09be \u0995\u09c7\u09a8 \u09a4\u09be\u0981\u09b0 \u09aa\u09be\u09df\u09c7\u09b0 \u09a8\u09bf\u099a\u09c7 \u09a4\u09c1\u09b0 \u09ac\u09c7\u09b9\u09c7\u09b8\u09cd\u09a4 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0986\u09aa\u09a8\u09be\u09a6\u09c7\u09b0 \u09ae\u09a4 \u09ae\u09c7\u09df\u09c7 \u09a6\u09c7\u09b0 \u099c\u09c1\u09a4\u09be \u09ae\u09be\u09b0\u09be \u09a6\u09b0\u0995\u09be\u09b0 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09cb\u09b0 \u09ae\u09be\u09df\u09c7 \u0995\u09bf \u0987\u0982\u09b2\u09bf\u09b6 \u099a\u09cb\u09a6\u09be \u09a8\u09be\u0995\u09bf\u09b0\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09c7\u09af\u09bc\u09c7\u09b0\u09be \u09ac\u09b0\u09cb \u0996\u09be\u09a8\u0995\u09c0 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09aa\u09be\u09aa\u09a8 \u0995\u09c7 \u09aa\u09be\u09aa\u09a8 \u0996\u09c7\u09b2\u09be\u09b0 \u0995\u09bf \u09ac\u09c1\u099d\u09c7 \u09aa\u09be\u09aa\u09a8 \u0995\u09c7 \u098f\u0995\u09a6\u09bf\u09a8 \u099c\u09c1\u09a4\u09be \u09aa\u09c7\u099f\u09be \u0995\u09b0\u09be \u09a6\u09b0\u0995\u09be\u09b0 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09b6\u09be\u09b2\u09be \u09ac\u09be\u09a8\u09a6\u09bf\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09a4\u09c1\u0987 \u0986\u09b0 \u0995\u09a4\u09cb \u09ae\u09be\u09a8\u09c1\u09b7\u09c7\u09b0 \u0997\u09be\u09b2\u09be \u0997\u09be\u09b2 \u09b6\u09c1\u09a8\u09ac\u09bf \u09ae\u09be\u099d\u09c7 \u09ae\u09be\u099d\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7\u09c7\u09b0 \u09ae\u09c1\u0996\u09c7 \u09b9\u09be\u09b8\u09bf \u09aa\u09be\u09df \u09a4\u09cb\u09b0 \u0995\u09b0\u09cd\u09ae \u0995\u09be\u09a8\u09a1\u09cb \u09a6\u09c7\u0996\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7 \u09a4\u09cb\u0995\u09c7 \u098f\u09a4\u09cb \u0997\u09be\u09b2\u09be \u0997\u09be\u09b2 \u09a6\u09c7\u09df \u09a4\u09ac\u09c1\u0993 \u09a4\u09cb\u09b0 \u09b2\u099c\u099c\u09be \u09b9\u09df \u09a8\u09be \u09b6\u09be\u09b2\u09be \u09ac\u09be\u09a8\u09a6\u09bf\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09a4\u09cb\u0995\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09b0 \u099c\u09a8\u0997\u09a3 \u0986\u09ac\u09be\u09b0\u09cb \u09ac\u09b2\u099b\u09c7 \u09b8\u09ae\u09df \u09a5\u09be\u0995\u09a4\u09c7 \u09ad\u09be\u09b2\u09cb \u09b9\u09df\u09c7 \u09af\u09be \u09b8\u09ae\u09df \u09a4\u09cb\u09b0 \u098f\u0996\u09a8 \u09a4\u09be\u0987 \u09af\u09be \u0996\u09c1\u09b6\u09bf \u09a4\u09be\u0987 \u0995\u09b0\u09a4\u09c7\u099b\u09bf\u09b8 \u0995\u09bf\u09a8\u09a4\u09c1 \u098f\u0995\u09a6\u09bf\u09a8 \u099c\u09a8\u0997\u09a3\u09c7\u09b0 \u09b8\u09ae\u09df \u0986\u09b8\u09ac\u09c7 \u09a4\u0996\u09a8 \u09af\u09c7 \u09a4\u09cb\u09b0 \u0995\u09aa\u09be\u09b2\u09c7 \u0995\u09bf \u0986\u099b\u09c7 \u09b6\u09be\u09b2\u09be \u09ac\u09be\u0987\u09a8\u099a\u09cb\u09a6 \u09a4\u09cb\u0995\u09c7 \u0986\u09b0 \u0997\u09be\u09b2\u09be \u0997\u09be\u09b2\u09bf \u0995\u09b0\u09c7 \u0995\u09bf \u09b9\u09ac\u09c7 \u09b6\u09be\u09b2\u09be \u09ac\u09be\u09a8\u09a6\u09bf\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09a4\u09cb\u0995\u09c7 \u09a4\u09cb \u09b2\u099c\u099c\u09be \u09b8\u09b0\u09ae\u09c7\u09b0 \u09aa\u09be\u09a8\u09bf \u09a6\u09bf\u09df\u09c7 \u09a7\u09cb\u09df\u09be\u09df \u09a8\u09bf \u09b6", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09cb\u09b0\u09c7 \u09b9\u09be\u09a4\u09c7\u09b0 \u0995\u09be\u099b\u09c7 \u09aa\u09be\u0987\u09b2\u09c7 \u099c\u09c1\u09a4\u09be \u09a6\u09bf\u09df\u09c7 \u09aa\u09bf\u099f\u09be\u0987\u09a4\u09be\u09ae \u09ac\u09c7\u09df\u09be\u09a6\u09ac \u09ae\u09c7\u09df\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09c1\u09ae\u09bf\u09a8 \u09ae\u09c7\u09df\u09c7 \u09a8\u09ac\u09bf\u09b0 \u09af\u09cc\u09a8\u09a6\u09be\u09b8\u09bf \u09b9\u09b2\u09c7 \u09ad\u09be\u09b2 \u09ae\u09be\u09a8\u09be\u09a4\u09cb \u0986\u09ae\u09bf\u09a8 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0\u09c7 \u099c\u09cb\u09a4\u09be \u09ae\u09be\u09b0 \u09b6\u09c1\u09df\u09be\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09ae\u09c1\u09a6\u09bf \u09a4\u09cb\u09b0 \u09b8\u09be\u09ae\u09bf \u09b2\u09be\u0997\u09c7 \u098f\u099c\u09a8\u09cd\u09af \u09a4\u09c1\u0987 \u09b6\u09cb\u0995 \u09aa\u09be\u09b2\u09a8 \u0995\u09b0\u099b \u0986\u09b0 \u09ae\u09be\u09df\u09be\u09a8\u09ae\u09be\u09b0\u09b0\u09c7\u09b0 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09a4\u09cb\u09b0 \u0995\u09bf\u099b\u09c1\u0987 \u0995\u09b0\u09be\u09b0 \u09a8\u09be\u0987 \u09a4\u09c1\u0987 \u09ac\u09b2\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u0986\u09ae\u09bf \u09ac\u09b2\u09bf \u09a4\u09c1\u0987 \u098f\u0995\u099f\u09be \u09a8\u09be\u09b8\u09cd\u09a4\u09bf\u0995\u09c7 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09ae\u09c1\u09a6\u09bf \u09a4\u09cb\u09b0 \u09ac\u09be\u09aa \u09b2\u09be\u0997\u09c7 \u09a4\u09cb\u09b0\u09c7 \u0986\u09ae\u09b0\u09be \u09ad\u09cb\u099f \u09a6\u09bf\u09df\u09c7 \u09ad\u09c1\u09b2 \u0995\u09b0\u099b\u09bf\u09b2\u09be\u09ae \u098f\u0996\u09a8 \u0986\u09ae\u09b0\u09be \u09b8\u09c7\u0987 \u09ad\u09c1\u09b2\u09c7\u09b0 \u09ae\u09be\u09b8\u09c1\u09b2 \u09a6\u09bf\u099a\u09cd\u099a\u09bf \u09a5\u09be\u09b0 \u09b9\u09be\u09b8\u09bf\u09a8\u09be \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09ac\u09be\u09ac\u09be\u09b0 \u0995\u09cb\u09b2\u09c7 \u0998\u09c1\u09ae\u09bf\u09df\u09c7 \u09a5\u09be\u0995 \u09ac\u09be\u09ac\u09be\u09b0 \u099a\u09c7\u09a8 \u09b2\u09ae\u09cd\u09ad\u09be", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0993\u09b0 \u09a6\u09c1\u09a7 \u0986\u09b0 \u09aa\u09be\u099a\u09be \u09a6\u09c7\u0996\u09c7\u09a4 \u0986\u09ae\u09be\u09b0 \u09b8\u09cb\u09a8\u09be \u0996\u09be\u09b0\u09be \u09b9\u09df\u09c7 \u0997\u09c7\u099b\u09c7 \u0986\u09ae\u09bf \u0993\u09b0\u09c7 \u099a\u09c1\u09a6\u09b2\u09c7 \u0993 \u0985\u09a8\u09c7\u0995 \u0996\u09c1\u09b6\u09bf \u09b9\u09ac\u09c7 \u0995\u09be\u09b0\u09a8 \u0986\u09ae\u09bf \u09e7 \u0998\u09a8\u09cd\u099f\u09be\u09b0 \u09ac\u09c7\u09b6\u09bf \u099a\u09c1\u09a6\u09a4\u09c7 \u09aa\u09be\u09b0\u09bf", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09b8\u09ac \u09b8\u09be\u09b2\u09bf\u09b0 \u09ac\u09cb\u09a6\u09be \u09a6\u09bf\u09df\u09c7 \u09ec \u09b8\u09c1\u09a4\u09be\u09b0 \u09b0\u09a1 \u0997\u09b0\u09ae \u0995\u09b0\u09c7 \u09a6\u09bf\u09a4\u09c7 \u09b9\u09ac\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf\u09b0 \u09aa\u09c1\u099f\u0995\u09bf\u09b0 \u09a8\u09bf\u099b\u09c7 \u0995\u09bf\u09a4\u09be ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u0997\u09cb\u09b0\u09c7 \u099c\u09c1\u09a4\u09be\u09aa\u099f\u09bf \u0995\u09b0\u09be \u09a6\u09b0\u0995\u09be\u09b0", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ad\u09cb\u09a6\u09be\u099f\u09be \u0995\u09bf \u09a0\u09cb\u099f\u09c7\u09b0 \u09ae\u09a4\u09cb \u09b8\u09c1\u09a8\u09cd\u09a6\u09b0 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09ae\u09bf\u09df\u09be\u09a8\u09ae\u09be\u09b0\u09c7\u09b0 \u09a6\u09bf\u0995\u09c7 \u09af\u09be \u09ad\u09be\u09b0\u09a4 \u0995\u09c7 \u09a8\u09bf\u09df\u09c7 \u098f\u09a4 \u099a\u09bf\u09a8\u09a4\u09bf\u09a4 \u0995\u09c7\u09a8 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u09b6\u09c7\u09b7 \u0995\u09b0\u09c7 \u09a6\u09bf\u099a\u099b\u09c7 \u0986\u09b0 \u09ac\u09be\u0987\u09a8\u099a\u09cb\u09a6 \u09ac\u09cd\u09af\u09b8\u09cd\u09a4 \u09ad\u09be\u09b0\u09a4 \u0995\u09c7 \u09a8\u09bf\u09df\u09c7", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0\u09be \u099f\u09be\u0995\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u0995\u09a4 \u099a\u09cb\u09a6\u09be \u09b2\u09df", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09c1\u09b2\u09be \u09ae\u09be\u09b2\u09be\u09df\u09a8\u09a6\u09c7\u09b0 \u09ae\u09c7\u09b0\u09c7 \u09b8\u09be\u09ab\u09be \u0995\u09b0\u09c7 \u09ab\u09c7\u09b2", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a8\u09b7\u09cd\u099f \u09ae\u09c7\u09df\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u09b0 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09a1\u09be\u09a8\u09cd\u09a1\u09bf\u09a6\u09c7\u09b0 \u0993\u09b0\u09be \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09c7\u09b6\u099f\u09be\u0995\u09c7 \u09b6\u09c7\u09b7 \u0995\u09b0\u09c7 \u09a6\u09bf\u099b\u09c7", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0986\u09df \u09a8\u099f\u09bf \u09ae\u09be\u0997\u09bf \u09a4\u09b0 \u09ad\u09c1\u09a6\u09be \u099a\u09c1\u09b7\u09c7 \u09a4\u0995\u09c7 \u09b8\u09c1\u0996 \u09a6\u09bf\u09ac ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf \u09a4\u09cb \u09ac\u09cb\u09a6\u09be\u09df \u09ab\u09b8\u09ae \u0986\u099b\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f \u09b8\u09ac \u099a\u09bf\u099f\u09be\u09b0\u09bf \u0995\u09a5\u09be \u09ac\u09be\u09a6 \u09a6\u09c7\u0993 \u0995\u09cb\u09a8 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09a6\u09be\u09b2\u09be\u09b2\u09c7\u09b0 \u09ac\u09be\u099a\u099a\u09be \u098f\u0987 \u09ae\u09be\u09a8\u09c1\u09c1\u09b7 \u09a0\u0995\u09be\u09a8\u09cb \u09aa\u09cd\u09b0\u099a\u09be\u09b0 \u0995\u09b0\u099b\u09c7", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u0996\u09be\u09a8\u0995\u09bf \u09ae\u09be\u0997\u09bf \u09ac\u09c7\u0997\u09c1\u09a8 \u0986\u099b\u09c7 \u09b2\u09be\u0997\u09ac\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a6\u09be\u09b0\u09c1\u09a8 \u09a6\u09c1\u09a7 \u0997\u09c1\u09b2\u09bf \u0985\u09a8\u09c7\u0995 \u09ac\u09dc\u09cb \u0986\u09b9\u09be \u0996\u09be\u09ac\u09cb \u0995\u09bf \u09ae\u099c\u09be \u09b9\u09ac\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09a1\u09c7\u09b2 \u09a8\u09be \u09ae\u09a8\u09c7 \u09b9\u099a\u09cd\u099b\u09c7 \u09ae\u09be\u0997\u09c0 \u09aa\u09be\u09a1\u09bc\u09be\u09b0 \u09ae\u09be\u0997\u09c0 \u09a6\u09c1\u0987\u099f\u09be \u09aa\u099e\u09cd\u099a\u09be\u09b6 \u098f\u0995\u09b6\u09cb \u099f\u09be\u0995\u09be \u09a6\u09bf\u09b2\u09c7 \u099a\u09cb\u09a6\u09be \u09af\u09be\u09ac\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u098f\u0995\u099f\u09be \u0996\u09be\u09a8\u0995\u09bf\u09ae\u09be\u0997\u09c0 \u09aa\u09a4\u09bf\u09a4\u09be ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u09b6\u09be\u09b2\u09bf\u0995\u09c7 \u098f\u0995\u09a8 \u09ad\u09be\u09b2 \u0995\u09b0\u09c7 \u099a\u09c1\u09a6\u09be\u09a4\u09c7 \u09b9\u09ac\u09c7 \u09aa\u09be \u0995\u09be\u09a6\u09c7 \u09a8\u09bf\u09df\u09c7 \u0996\u09be\u09a8\u0995\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf \u09ac\u09c7\u09b6\u09cd\u09af\u09be \u09ae\u09be\u0997\u09c0 \u09a8\u09b0\u09cd\u09a4\u0995\u09c0 \u09a8\u099f\u09bf\u09a8\u09c0 \u09ac\u09be\u09b0\u09cd\u09ae\u09be\u09b0 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u0997\u09a8\u09b9\u09a4\u09cd\u09af\u09be \u09ac\u09a8\u09cd\u09a7\u09c7\u09b0 \u0986\u09ac\u09c7\u09a6\u09a8 \u09a8\u09be \u0995\u09b0\u09c7 \u0995\u09c1\u0995\u09c1\u09b0\u09c7\u09b0 \u09ae\u09a4 \u09b2\u09c7\u099c \u0997\u09c1\u099f\u09bf\u09df \u0986\u099b\u09bf\u09b8 \u0995\u09be\u09ab\u09c7\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099b\u09be ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u09a4\u09bf\u09a8 \u09b8\u09be\u09b2\u09be\u09b0\u09be \u0996\u09be\u09b0\u09be\u09aa \u09ae\u09be\u09a6\u09be\u09b0\u099a\u09c1\u09a6 \u09a8\u09be \u09b9\u09df \u09ae\u09be\u09df\u09be\u09a8\u09ae\u09be\u09b0 \u098f \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u099c\u09ac\u09be\u0987 \u0995\u09b0\u09c7 \u098f\u0987 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09c1\u09b2\u09be\u09b0\u09be \u0995\u09cb\u09a8\u09cb \u0995\u09a5\u09be \u09ac\u09b2\u09c7\u09a8\u09be \u09b8\u09be\u09b2\u09be\u09b0\u09be \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09b9\u09df \u0995\u09bf\u09ad\u09be\u09ac\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a8\u09cb\u09df\u09be\u0996\u09be\u09b2\u09c0\u09b0 \u09ae\u09be\u0997\u09c0 \u09a4\u09b0\u09be\u09b0 \u09aa\u09b0\u09cb\u09b7\u09b0\u09be \u09b8\u09ac \u0986\u09b0\u09ac \u09a6\u09c7\u09b6 \u0997\u09c1\u09b2\u09cb\u09a4\u09c7 \u09a4\u09be\u0995\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf \u09ae\u09be\u0997\u09bf\u09b0\u09c7 \u09aa\u09c7\u09b2\u09c7 \u0995\u09c1\u099a\u09bf \u0995\u09c1\u099a\u09bf \u0995\u09b0\u09c7 \u0995\u09c7\u099f\u09c7 \u0995\u09c1\u09a4\u09cd\u09a4\u09be \u09a6\u09bf\u09df\u09c7 \u0996\u09be\u0993\u09df\u09be\u09a4\u09be\u09ae", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u099b\u09c7\u09b2\u09c7 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u099f\u09be\u0995\u09be \u0995\u0987 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09cb\u09b0 \u09ae\u09be \u0993 \u098f\u0987 \u09ad\u09be\u09ac\u09c7 \u099b\u09c7\u09b2\u09c7\u09a6\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09a6\u09c1\u09a7 \u0997\u09c1\u09b2\u09be \u09a6\u09c7\u0996\u09be\u0987 \u09a6\u09c7\u0996\u09be\u0987 \u09ac\u09bf\u0995\u09be\u09b6\u09c7\u09b0 \u09ae\u09be\u09a7\u09cd\u09af\u09ae\u09c7 \u099b\u09c7\u09b2\u09c7\u09a6\u09c7\u09b0 \u099f\u09be\u0995\u09be \u0996\u09be\u0987\u09a4 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb \u098f\u09a1\u09ae\u09bf\u09a8 \u09a4\u09c1\u0987 \u0995\u09bf \u09b8\u09ac\u09be\u0987\u09b0\u09c7 \u0996\u09cb\u0995\u09be \u0996\u09c1\u0995\u09c1 \u09ae\u09a8\u09c7 \u0995\u09b0\u09b8 \u09a0\u09be\u0995\u09c1\u09ae\u09be\u09b0 \u099d\u09c1\u09b2\u09bf\u09b0 \u0997\u09b2\u09cd\u09aa \u09b6\u09cb\u09a8\u09be\u0987\u09a4\u09c7 \u0986\u0987\u09b8\u09cb ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09cb\u09b0\u09be \u0993\u09b0\u099c\u09bf\u09a8\u09bf\u09df\u09be\u09b2 \u09ae\u09be\u0997\u09bf\u09b0 \u099a\u09c7\u09df\u09c7 \u0996\u09be\u09b0\u09be\u09aa \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09df\u09be \u09ae\u09a8\u09c7 \u09b9\u09df \u09a4\u09cb\u09b0\u09be \u09a8\u09bf\u099c\u09c7\u09a6\u09c7\u09b0 \u099c\u09be\u09b2\u09be \u09ae\u09bf\u099f\u09be\u09b8 \u09a4\u09be\u0987 \u098f\u09b0\u09cb \u0995\u09ae \u0996\u09be\u09b0\u09be\u09aa \u0995\u09a5\u09be \u09a4\u09cb\u09a6\u09c7\u09b0 \u09ae\u09c1\u0996 \u09a6\u09bf\u09df\u09c7 \u09ac\u09c7\u09b0 \u09b9\u09df \u09ac\u09c7\u09b8\u09b8\u09be \u0997\u09cb\u09b2\u09be ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf\u09b0 \u09a6\u09be\u09b2\u09be\u09b2\u09c7\u09b0 \u09ac\u09be\u099a\u099b\u09be \u09ae\u09be\u0997\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u09a6\u0995 \u0986\u09b0 \u09ae\u09be\u0997\u09bf \u09a6\u09c7\u09b6 \u099f\u09be \u0995\u09c7 \u09a8\u09b7\u09cd\u099f \u0995\u09b0\u09c7 \u09a6\u09bf\u09b2 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09c0\u09b0 \u09aa\u09be\u099a\u09be \u09a6\u09bf\u09df\u09c7 \u09ac\u09bf\u0995\u09be\u09b6 \u09a2\u09c1\u0995\u09be\u0987\u09df\u09be \u09a6\u09bf\u09b2\u09c7 \u09ad\u09be\u09b2\u09cb \u09b9\u09a4 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u099c\u09be\u0989\u09b0\u09be \u098f\u0995\u099f\u09be \u09ae\u09c7\u09df\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09b6\u09be\u09b2\u09bf \u09a4\u09cb\u09a6\u09c7\u09b0 \u09b8\u09ac\u09be\u09ac \u099a\u09b0\u09bf\u09a4\u09cd\u09a4 \u09ad\u09be\u09b2\u09cb \u09ac\u09cb\u099d\u09be\u09af \u09a8\u09be \u09a4\u09cb\u09b0\u09be \u09a6\u09c1\u0987 \u099c\u09a8 \u0986\u09a4\u09cd\u09a4\u09be \u09ae\u09be\u0997\u09c0 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf \u09af\u09be \u09a6\u09c1\u09a7 \u09b0\u09c7 \u09b8\u09ac \u0996\u09c1\u09b2 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0993\u0987 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09c1\u09b2\u09be \u09a4\u09cb\u09b0 \u09ac\u09be\u09aa\u09c7 \u0995\u09bf \u0995\u09b0\u09c7 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09c1\u09b2\u09be \u09a4\u09cb\u09b0\u09be \u09ae\u09be\u09a8\u09c1\u09b7\u09c7\u09b0 \u099a\u09c1\u09b2 \u09ac\u09be\u09b2 \u09a8\u09be \u0995\u09be\u099f\u09b2\u09c7 \u09ad\u09be\u09a4 \u0993 \u09aa\u09be\u09ac\u09bf \u09a8\u09be \u0986\u09ac\u09be\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7\u09c7\u09b0 \u099f\u09be \u09ac\u09dc \u0997\u09b2\u09be\u09df \u09ac\u09b2\u09b8 \u0985\u099f\u09cb \u09b0\u09bf\u0995\u09cd\u09b8\u09be \u099a\u09be\u09b2\u0995 \u09a4\u09cb\u09b0 \u09ae\u09be\u0995\u09c7 \u0986\u09b0 \u099a\u09c1\u09a6\u09b2\u09be\u09ae \u09a8\u09be \u09a4\u09cb\u09b0 \u09b8\u09ac \u099a\u09c7\u09df\u09c7 \u099b\u09cb\u099f \u09ac\u09cb\u09a8 \u0995\u09c7 \u0986\u09ae\u09bf \u099a\u09c1\u09a6\u09ac ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09ab\u09c1\u099f\u09ac\u09b2\u09c7\u09b0 \u0995\u09bf\u099b\u09c1\u0987 \u09ac\u09cb\u099d\u09c7 \u09a8\u09be", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0997\u09be\u0987 \u09ae\u09be\u09b0\u09be\u09a8\u09bf \u09ac\u09be\u099a\u09cd\u099b\u09be \u09a4\u09a6\u09c7\u09b0 \u09b8\u09cb\u09a8\u09be \u09a6\u09bf\u09df\u09be \u09ac\u09be\u09b7 \u09a6\u09c7\u0993 \u09a6\u09b0\u0995\u09be\u09b0 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u09b8\u09c1\u09ae\u09ad\u09be\u0987 \u0990 \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09c1\u09b2\u09be\u0997\u09cb\u09b0 \u09b2\u0997\u09c7 \u0995\u09cb\u09a8 \u09ad\u09be\u09b2 \u09ac\u09cd\u09af\u09ac\u09b9\u09be\u09b0 \u09a8\u09be\u0987 \u09ae\u09be\u0997\u09bf\u09b0 \u09aa\u09c1\u09a4\u09c7\u09b0\u09be \u09ad\u09be\u09b2\u09cb \u09ac\u09cd\u09af\u09ac\u09b9\u09be\u09b0 \u09aa\u09be\u0993\u09df\u09be\u09b0 \u09af\u09cb\u0997\u09cd\u09af \u09a8\u09df", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0986\u09ae\u09be\u09b0 \u09a4\u09cb \u09ae\u09a8\u09c7 \u09b9\u09df \u09a4\u09cb\u09b0 \u09ad\u09cb\u09a6\u09be\u09df \u09aa\u09be\u09a8\u09bf \u0997\u09dc\u0997\u09dc \u0995\u09b0\u09a4\u09c7\u099b\u09c7 \u099b\u09c7\u09b2\u09c7\u09a6\u09c7\u09b0 \u09b8\u09cb\u09a8\u09be \u09a2\u09c1\u0995\u09be\u09a8\u09cb\u09b0 \u099c\u09a8\u09cd\u09af ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09b6\u09be\u09b2\u09be \u09ae\u09be\u09a4\u09be\u09b0\u099a\u09c1\u09a6 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09ab\u09b2\u09cb \u0995\u09b0\u09be\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7 \u09aa\u09be\u0987\u09b2\u09bf\u09a8\u09be", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0997\u09cb\u09a4\u09ae \u09ae\u09be\u09a6\u09be\u09b0\u099a\u09c1\u09a6 \u09ac\u09b2\u09c7\u0995\u09bf \u09b8\u09be\u09b2\u09c7 \u09ac\u09be\u09b2 \u09ab\u09be\u09b2\u09be\u09a4\u09c7 \u098f\u09b8\u09c7\u099b\u09bf\u09b2 \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u09b0\u09be \u0986\u09ae\u0997\u09cb \u09b8\u09ac \u099a\u09c1\u09b0\u09bf\u0995\u09b0\u09c7 \u09ad\u09be\u09b0\u09a4 \u09a8\u09bf\u09df\u09c7 \u0997\u09c7\u099b\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0986\u09b0\u09c7 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09c1\u09b2\u09be \u0996\u09ae\u09a4\u09be \u099b\u09be\u09b0 \u09a4\u09be\u09b0 \u09aa\u09b0\u09c7 \u09ac\u09b0 \u0995\u09a5\u09be \u0995\u0987\u099a", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u099c\u09be\u09a8\u09bf \u09a4\u09cb \u099c\u09be\u09ae\u09be\u09a4 \u09b6\u09bf\u09ac\u09bf\u09b0 \u09a4\u09be\u0987\u09a8\u09be \u09a6\u09be\u09a6\u09be \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09c1\u09b2\u09be", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09ae\u09bf\u09a1\u09bf\u09df\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u0993\u09b0\u09be \u09a2\u09c1\u0995\u09c7 \u09aa\u09dc\u099b\u09c7 \u098f\u0987\u0997\u09cb\u09b2\u09be \u099a\u09cb\u0996\u09c7 \u09aa\u09dc\u09c7 \u0993\u09a6\u09c7\u09b0\u0995\u09c7 \u09ae\u09be\u09dc\u09a4\u09be\u099b\u09c7 \u098f\u0987\u0997\u09cb\u09b2\u09be \u099a\u09cb\u0996\u09c7 \u09aa\u09dc\u09c7 \u09a8\u09be \u0986\u09ae\u09bf \u0998\u09c3\u09a8\u09be \u0995\u09b0\u09bf \u098f\u0987\u09b8\u09ac \u09ae\u09bf\u09dc\u09bf\u09df\u09be\u0995\u09c7 \u09af\u09be\u09b0\u09be \u0985\u09b8\u09b9\u09be\u09df \u09ae\u09be\u09a8\u09c1\u09b7\u09c7\u09b0 \u09aa\u09be\u09b6\u09c7 \u09a6\u09be\u09b0\u09be\u09a4\u09c7 \u09aa\u09be\u09dc\u09c7 \u09a8\u09be ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u09b0 \u099c\u09a8\u09cd\u09ae \u09aa\u09a4\u09bf\u09a4\u09be\u09b2\u09df\u09c7 \u099c\u09be\u09a4 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09a4\u09cb \u09b8\u09be\u09b0\u09be\u09a6\u09bf\u09a8 \u09aa\u09c1\u099f\u0995\u09bf \u09ae\u09be\u09b0\u09be \u0996\u09be\u09df ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u09b2 \u09a0\u09bf\u0995 \u0986\u099b\u09c7 \u0996\u09c7\u09b2\u09c7 \u0986\u09b0\u09be\u09ae \u09aa\u09be\u0993\u09df\u09be \u09af\u09be\u09ac\u09c7 \u09b8\u09c7\u0995\u09cd\u09b8\u09c7 \u09aa\u09c1\u09b0\u09be \u09b6\u09b0\u09c0\u09b0\u099f\u09be \u09ad\u09b0\u09be", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09aa\u09a4\u09bf\u09a4\u09be \u09ac\u09c3\u09a4\u09cd\u09a4\u09bf \u099b\u09c7\u09dc\u09c7 \u09ac\u09bf\u09df\u09be \u0995\u09b0\u09c7 \u09b8\u0982\u09b8\u09be\u09b0\u09c0 \u09b9\u0993 \u09a8\u09df \u09a4\u09cb \u099c\u09be\u09b9\u09be\u09a8\u09cd\u09a8\u09be\u09ae\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09b9\u09cb\u099f\u09c7\u09b2\u09c7\u09b0 \u09ae\u09be\u0997\u09bf\u09a6\u09c7\u09b0 \u099a\u09c7\u09b9\u09be\u09b0\u09be \u09a6\u09c7\u0996\u09b2\u09c7 \u09b8\u09cb\u09a8\u09be \u0996\u09be\u09b0\u09be\u09df ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0986\u09aa\u09c1 \u09a4\u09cb\u09ae\u09be\u0995\u09c7 \u09ac\u09bf\u09a6\u09c7\u09b6\u09bf \u0997\u09b0\u09c1\u09b0 \u09ae\u09a4\u09cb \u09b2\u09be\u0995\u09a4\u09be\u099b\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09b0\u09be \u09b6\u09c1\u09a7\u09c1 \u09ae\u09be\u0997\u09bf \u09a8\u09be \u09a4\u09b0\u09be \u09ac\u09c7\u09b8\u09b8\u09be \u09ae\u09be\u0997\u09bf \u0995\u09be\u099b\u09c7 \u09aa\u09be\u0987\u09b2\u09c7 \u0986\u09ae\u09be\u09b0 \u09b8\u09cb\u09a8\u09be \u09a4\u09b0 \u09ae\u09c1\u0996\u09c7\u09b0 \u09ac\u09bf\u09a4\u09b0 \u09a6\u09bf\u09df\u09c7 \u09a6\u09bf\u09a4\u09be\u09ae ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u099f\u09be \u0995\u09ae\u09bf\u09b6\u09a8\u09be\u09b0 \u098f\u09b0 \u09ae\u09c7\u09df\u09c7 \u0996\u09be\u09a8\u0995\u09bf\u09ae\u09be\u0997\u09bf\u09b0 \u09ae\u09c7\u09df\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u099a\u09c1\u09a4\u09ae\u09be\u09b0\u09be\u09a8\u09bf \u09a4\u09b0 \u099c\u09a8\u09cd\u09ae\u09c7\u09b0 \u09a0\u09bf\u0995 \u0986\u099b\u09c7\u09b0\u09c7 \u0996\u09be\u09a8\u0995\u09bf \u09b8\u09be\u09b2\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09cb\u09b0 \u09ae\u09be\u09b0\u09c7 \u099a\u09c1\u09a6\u09bf \u09ae\u09be\u0997\u09bf \u0997\u09b0\u09c7\u09b0\u09ae\u09be\u0997\u09bf \u09a4\u09cb\u09b0\u09c7\u099a\u09c1\u09a6\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09b9\u09be\u099a\u09bf\u09a8\u09be\u09b0 \u09ae\u09be\u09b0\u09c7 \u0986\u09ae\u09bf \u099a\u09c1\u09a6\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0986\u09b2\u09cd\u09b2\u09be\u09b9 \u0995\u09c7 \u09ad\u09df \u0995\u09b0 \u09ae\u09be\u0997\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09c7\u09df\u09c7\u09b0 \u099c\u09be\u09a4 \u09a8\u09be\u09ae\u09c7\u09b0 \u0995\u09b2\u0982\u0995 \u09a4\u09cb\u09b0\u09be \u09a4\u09cb\u09b0\u09be \u0995\u09cb\u09a8 \u09aa\u09a4\u09bf\u09a4\u09be\u09b2\u09df \u09a5\u09be\u0995\u099b\u0990 \u09ae\u09be\u0997\u09bf \u09a4\u09cb\u09b0\u09c7 \u09aa\u09be\u0987\u09b2\u09c7 \u09a4\u09cb\u09b0 \u09ab\u09bf\u09a4\u09be \u0986\u09ae\u09bf \u0995\u09be\u0987\u099f\u09be \u0996\u09be\u0987\u09a4\u09be\u09ae \u0986\u09b0 \u0995\u09c1\u09a4\u09cd\u09a4\u09be \u09a6\u09bf\u09df\u09be \u099a\u09cb\u09a6\u09be\u0987 \u09a4\u09be\u09ae ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0990 \u09ac\u09c7\u09a1\u09bf \u09a4\u09c1\u09b0 \u09ac\u09c1\u0995\u09c7 \u09aa\u09b6\u09ae \u0986\u099b\u09c7\u09a8\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf\u09b0 \u0998\u09b0\u09c7\u09b0 \u099b\u09bf\u09a8\u09be\u09b2 \u09a4\u09c7\u09be\u09b0 \u09ad\u09c1\u09a6\u09be\u099f\u09be \u0995\u09a4 \u09ac\u09dc\u09b0\u09c7 \u099a\u09c1\u09a6\u09be\u09a8\u09bf \u09b0\u09c7\u09a8\u09a1\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0997\u09c1\u09b2\u09be \u0996\u09be\u09a8\u0995\u09bf \u09ae\u09be\u0997\u09bf \u09ad\u09be\u0987 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a8\u09cb\u09df\u09be\u0996\u09be\u09b2\u09c0\u09b0 \u09ae\u09be\u0997\u09c0 \u09a4\u09b0\u09be\u09b0 \u09aa\u09b0\u09cb\u09b7\u09b0\u09be \u09b8\u09ac \u0986\u09b0\u09ac \u09a6\u09c7\u09b6 \u0997\u09c1\u09b2\u09cb\u09a4\u09c7 \u09a4\u09be\u0995\u09c7 \u0986\u09b0 \u09a4\u09a6\u09c7\u09b0 \u09ac\u09be\u09dc\u09bf \u09a4\u09be\u0995\u09c7 \u09aa\u09be\u0995\u09be \u098f\u0987 \u09b8\u09c1\u09af\u09cb\u0997\u09c7 \u09a4\u09b0\u09be \u09b9\u09df\u09c7 \u0989\u099f\u099b \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09b8\u09ac\u09be\u09b0 \u099b\u09c7\u09df\u09c7 \u09ac\u09dc \u09ae\u09be\u0997\u09c0 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u099c\u09be\u09b0\u09be \u09aa\u09c1\u09b0\u09bf\u09af\u09bc\u09c7 \u09ae\u09c7\u09b0\u09c7\u099b\u09c7 \u0993\u0987 \u09b6\u09bf\u09b6\u09c1 \u0995\u09c7 \u09a4\u09be\u09b0\u09be \u098f\u0995 \u09a8\u09ae\u09cd\u09ac\u09b0 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u099b\u09c7\u09b2\u09c7", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf \u099a\u09c1\u09a6\u09bf \u09a6\u09c7\u09b6\u09c7 \u09af\u09a6\u09bf \u0986\u09ac\u09be\u09b0 \u098f\u0995\u099f\u09be \u098f\u09b0 \u09ae\u09a4\u09cb \u09af\u09c1\u09a6\u09cd\u09a7 \u09b2\u09be\u0997\u09c7 \u09a4\u09be\u09b9\u09b2\u09c7 \u09ad\u09be\u09b2\u09cb \u09b9\u09ac\u09c7 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u0986\u09ac\u09be\u09b0 \u09b2\u09c1\u099f\u09c7\u09aa\u09c1\u099f\u09c7 \u0996\u09be\u09ac\u09c7 \u09ae\u09cb\u09a6\u09c0 \u0986\u09b0 \u099f\u09cd\u09b0\u09be\u09ae\u09cd\u09aa \u099a\u09c7\u09df\u09c7 \u09a6\u09c7\u0996\u09ac\u09c7 \u0986\u09b0 \u099a\u09bf\u09a8 \u0993\u09a6\u09c7\u09b0 \u09a6\u09c7\u09b6\u09c7\u0987 \u09ae\u09c1\u09b8\u09b2 \u09ae\u09be\u09a8 \u09ae\u09be\u09b0\u09be \u09b9\u09df", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09a8 \u09aa\u09c1\u09b0\u09be\u09b0\u09be \u09b8\u09ac \u09ae\u09bf\u09a1\u09bf\u09af\u09bc\u09be \u09a4\u09cb\u09a6\u09c7\u09b0 \u09ae\u09a4 \u09ae\u09bf\u09a5\u09cd\u09af\u09be \u0996\u09ac\u09b0 \u09b2\u09bf\u0996\u09c7 \u09a8\u09be \u0986\u09b0 \u09b8\u09ac\u09be\u0987 \u09b9\u09b2\u09c1\u09a6 \u09ae\u09bf\u09a1\u09bf\u09af\u09bc\u09be\u0993 \u09a8\u09be", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ac\u09bf\u09ad\u09be\u09b8 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09a4\u09cb\u09b0 \u09ae\u09be\u09b0\u09c7 \u0995\u09be\u0989\u09af\u09bc\u09be \u09a6\u09bf\u09af\u09bc\u09be \u0989\u09a1\u09bc\u09be\u0987\u09af\u09bc\u09be \u099a\u09c1\u09a6\u09bf \u09ac\u09c7\u09b6\u09cd\u09af\u09be\u09b0 \u09aa\u09cb\u09b2\u09be \u099a\u09c1\u09aa \u09a5\u09be\u0995", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09bf\u09a1\u09bf\u09df\u09be \u09ae\u09be\u09df\u09be\u09a8\u09ae\u09be\u09b0 \u098f \u0986\u099c \u099c\u09a8 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u0995\u09c7 \u0986\u099c \u09b8\u09c7\u09a8\u09be \u0993 \u09b8\u09c2\u099a\u09bf \u09b8\u09b0\u0995\u09be\u09b0 \u09b9\u09a4\u09cd\u09af\u09be \u0995\u09b0\u09b8\u09c7 \u09a4\u09cb\u09b0\u09be \u09b8\u09be\u0982\u09ac\u09be\u09a6\u09bf\u0995 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09b0\u09be \u098f\u09b0 \u0995\u09cb\u09a8\u09cb \u09aa\u09cd\u09b0\u09a4\u09bf\u09ac\u09be\u09a6 \u0995\u09b0\u09b8 \u09a8\u09be \u0995\u09c7\u09a8 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09ae\u09bf\u09a1\u09bf\u09df\u09be \u099a\u09c1\u09aa \u0995\u09b0\u09c7 \u0986\u09b8\u09c7 \u099c\u09be\u09b0\u099c \u09ae\u09bf\u09a1\u09bf\u09df\u09be \u09af\u09a6\u09bf \u098f\u0995\u099f\u09be \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09ae\u09b0\u09a4 \u09a4\u09be\u09b9\u09b2\u09c7 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09ae\u09bf\u09a1\u09bf\u09df\u09be \u0998\u09c7\u0989 \u0998\u09c7\u0989 \u0995\u09b0\u09c7 \u0995\u09be\u0981\u09a6 \u09a4", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u09ae\u09be\u0997\u09bf \u09aa\u09b0\u09bf\u099a\u09df \u09a6\u09bf\u09b2\u09bf \u09a4\u09c1\u0987 \u0986\u09b8\u09b2\u09c7 \u098f\u0995\u099f\u09be\u09ae\u09be\u0997\u09bf \u09b0\u09c7\u099f \u0995\u09a4 \u0986\u09ae\u09bf\u0993 \u099b\u09c1\u09a6\u09ac\u09cb \u09a4\u09cb\u0995\u09c7 \u0996\u09c1\u09ac \u09ae\u099c\u09be \u09aa\u09be\u09ac\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf \u09ae\u09be\u0997\u09bf \u09a4\u09b0\u09be \u09b8\u09ae\u09be\u099c \u099f\u09be\u0995\u09c7 \u09a8\u09b7\u09cd\u099f \u0995\u09b0\u09c7 \u09ab\u09c7\u09b2\u09a4\u09c7\u099b\u09bf\u09b8 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09b9\u09c7\u09a4\u09bf\u09b0\u09c7 \u09ae\u09a8\u09c7 \u099a\u09be\u0987\u09a4\u09c7\u099b\u09c7 \u099f\u09bf\u09aa\u09c7 \u09a6\u09c7\u0987 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u0986\u09b8\u09b2\u09c7 \u09ae\u09be\u0997\u09bf\u09b0\u09c7 \u099a\u09c1\u09a4\u09ae\u09be\u09b0\u09be\u09a8\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u09a7\u09b0\u09a8\u09c7\u09b0 \u0996\u09be\u09a8\u0995\u09bf\u09a6\u09c7\u09b0 \u0995\u09cb\u09aa\u09be\u09a8\u09cb\u09b0 \u09aa\u09b0 \u099f\u09c1\u0995\u09b0\u09be \u099f\u09c1\u0995\u09b0\u09be \u0995\u09b0\u09c7 \u0995\u09c1\u0995\u09c1\u09b0 \u0995\u09c7 \u09a6\u09bf\u09df\u09c7 \u0996\u09be\u0993\u09df\u09be\u09a8\u09cb \u0989\u099a\u09bf\u09a4", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09b6\u09be\u09b2\u09c0 \u098f\u0995\u099f\u09be \u09ae\u09be\u0997\u09c0 \u0985\u09a4\u09bf\u09ac\u09bf\u09b6\u09bf\u09b7\u09cd\u099f \u09a6\u09c7\u09b0 \u099b\u09c1\u09a6\u09be \u09a6\u09c7\u09df ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u09b8\u09ac \u09ae\u09b9\u09bf\u09b2\u09be \u09a6\u09c7\u09b0 \u0995\u09c7 \u099b\u09ac\u09bf \u09a4\u09c1\u09b2\u09c7 \u0987\u099a\u09cd\u099b\u09c7 \u09ae\u09a4\u09cb \u09ae\u09b0\u09bf\u099a \u09b2\u09be\u0997\u09bf\u09af\u09bc\u09c7 \u09a6\u09c7\u09a8 \u09af\u09be\u0987\u0997\u09be \u09ae\u09a4\u09cb \u09aa\u09c1\u09b2\u09bf\u09b6 \u09ad\u09be\u09df\u09c7\u09b0\u09be ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u09ac\u09be\u09b0 \u09ac\u09b2 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u099b\u09c7\u09b2\u09c7\u09b0\u09be \u0995\u09c7 \u09ad\u09be\u09b2 \u09aa\u09cd\u09b2\u09c7\u09df\u09be\u09b0 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0995\u09c1\u09a4\u09a4\u09bf \u09a4\u09cb \u0995\u09c1\u09a4\u09a4\u09bf\u0987 \u09b9\u09ac\u09c7 \u09ae\u09be\u0997\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u09ae\u09a8 \u098f\u0995\u099f\u09be \u09aa\u09be\u0987\u09b2\u09c7 \u098f\u0995 \u0995\u09ae \u0995\u09b0\u09c7 \u09b9\u09b2\u09c7\u0993 \u098f\u0995 \u09b0\u09be\u09a4\u09c7 \u099a\u09be\u09b0\u099f\u09bf \u09b8\u099f \u09a6\u09bf\u09a4\u09be\u09ae ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf\u09b0 \u09ac\u09c1\u09a6\u09be \u0985\u09a8\u09c7\u0995 \u09ac\u09dc ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ac\u09be\u09ac\u09be\u0996\u09c1\u09b0 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09ae\u09c7\u09df\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09cb\u09ae\u09be\u09b0 \u09ae\u09a4 \u098f\u09a4 \u09b8\u09c1\u09a8\u09cd\u09a6\u09b0 \u09ae\u09c7\u09df\u09c7 \u0995\u09be\u099b\u09c7 \u09aa\u09be\u0987\u09b2\u09c7 \u0995\u09a4 \u09af\u09c7 \u09ae\u099c\u09be \u0995\u09b0\u09a4\u09be\u09ae \u09a6\u09c7\u09b6 \u09a5\u09c7\u0995\u09c7 \u09ac\u09bf\u09a6\u09c7\u09b6\u09c7 \u0998\u09c1\u09b0\u09a4\u09c7 \u09a8\u09bf\u09df\u09be \u09af\u09be\u0987\u09a4\u09be\u09ae \u0985\u09a8\u09c7\u0995 \u0986\u09a8\u09a8\u09cd\u09a6 \u0995\u09b0\u09c7 \u0998\u09a8\u09cd\u099f\u09be\u09b0 \u09aa\u09b0 \u0998\u09a8\u09cd\u099f \u099a\u09c1\u09a6\u09bf\u09a4\u09be\u09ae", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0985\u099f\u09cb \u099a\u09be\u09b2\u09be\u09b2\u09c7\u0993 \u0990 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u09a6\u09c7\u09b0 \u09ae\u09a4 \u0996\u09cb\u09b2\u09be \u099c\u09be\u09df\u0997\u09be\u09df \u09aa\u09be\u09df\u0996\u09be\u09a8\u09be \u0995\u09b0\u09c7 \u09aa\u09b0\u09bf\u09ac\u09c7\u09b6 \u09a8\u09b8\u09cd\u099f \u0995\u09b0\u09a4\u09c7\u099b\u09c7 \u09a8\u09be", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09c1\u09b0 \u09ae\u09c7\u09df\u09c7 \u09ae\u09be\u0997\u09c0 \u099a\u09cb\u09a6\u09be\u09b0 \u0995\u09be\u09ae\u09be\u0987 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0993\u0987 \u0996\u09be\u09a8\u0995\u09bf\u09b0\u09c7 \u09b8\u09ac \u099b\u09be\u098f \u09ad\u09be\u0987\u09df\u09c7\u09b0\u09be \u09ae\u09bf\u09b2\u09be \u099b\u09c1\u09a6\u09c7\u09a8 \u09a4\u09be\u0987 \u09a8\u09be\u0995\u09bf \u0986\u09ac\u09be\u09b0 \u0987\u09df\u09be\u09ac\u09be \u09b8\u09c7\u09ac\u09a8 \u0995\u09b0\u09c7 \u0996\u09be\u09a8\u0995\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be \u099b\u09c7\u09b2\u09c7\u09b0 \u099a\u09c2\u09a6\u09cb \u099a\u09c1\u09a6\u09ac\u09c7 \u09a6\u09bf\u0993 \u09a7\u09cb\u09a8\u099f\u09be \u09a7\u09b0\u09c7 \u0986\u09b8\u09cd\u09a4\u09c7 \u0986\u09b8\u09cd\u09a4\u09c7 \u09ac\u09c7\u09b0 \u0995\u09b0\u09a4\u09c7 \u09b9\u09ac\u09c7 \u09ac\u09c7\u09b0 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09c7\u09df\u09c7\u09b0\u09be \u099a\u09c1\u09a6\u09be\u09b0 \u09aa\u09be\u0997\u09b2 \u09ae\u09be\u0997\u09bf\u09b0 \u09ac\u09be\u099a\u09cd\u099b\u09be \u099a\u09bf\u09a8\u09be\u09b2 \u09ac\u09c7\u09a1\u09bf\u09b0 \u09aa\u09c1\u09b0\u09bf", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0990 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u09b0\u09be \u09ac\u09be\u09b0\u09cd\u09ae\u09be\u0995\u09c7 \u0995\u09bf\u099b\u09c1 \u0995\u0987\u09a4\u09c7 \u09aa\u09be\u09b0\u099a \u09a8\u09be ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09b0 \u09ac\u09c1\u09a6\u09be\u09a6\u09bf\u09df\u09c7 18 \u0987\u09a8\u099a\u09bf \u09a6\u09c1\u09a8 \u09a1\u09c1\u0995\u09be\u09b2\u09c7 \u09ae\u09c1\u0995\u09a6\u09bf\u09df\u09c7 \u0986\u09b0 \u09ac\u0997 \u09ac\u0997 \u09ac\u09c7\u09b0 \u09b9\u09a4 \u09a8\u09be \u09ae\u09be\u0997\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf \u09ac\u09cd\u09af\u09be\u09ac\u09b8\u09be \u09b2\u0987\u09df\u09be \u09ac\u09b8\u099b\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0995\u09cb\u09a5\u09be\u0987 \u0997\u09c7\u09b2\u09cb \u09ae\u09be\u0997\u09bf\u09b0\u09be \u09b8\u09ac\u09be\u0987 \u09ac\u09b2\u09c7 \u0985\u09b8\u09cb\u09b9\u09be\u0987 \u098f\u099f\u09be \u0995\u09bf \u098f\u09a6\u09c7\u09b0 \u09ad\u09cb\u09a6\u09be\u0987 \u0985\u09a8\u09c7\u0995 \u0995\u09be\u09ae\u09b0 \u098f\u09a6\u09c7\u09b0 \u09ad\u09cb\u09a6\u09be\u0987 \u09b0\u09a1 \u09a6\u09bf\u09a4\u09c7 \u09b9\u09ac\u09c7 \u099b\u09bf \u099b\u09bf \u099b\u09bf \u0995\u09bf \u098f\u09b0\u09be ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09cb\u09ae\u09be\u0995\u09c7 \u0995\u09c1\u0995\u09c1\u09b0 \u09a6\u09bf\u09df\u09be \u099a\u09cb\u09a6\u09be\u09a4\u09c7 \u09b9\u09ac\u09c7 \u09ae\u09be\u0997\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf \u09a4\u09cb\u09b0\u09c7 \u099a\u09c1\u09a6\u09ac\u09cb \u0995\u09be\u09ae \u09a6\u09bf\u09ac\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0\u09be \u09af\u09a6\u09bf \u09a6\u09c7\u09b6\u09c7\u09b0 \u09b0\u09be\u099c\u09a8\u09c0\u09a4\u09c0 \u0995\u09b0\u09c7 \u09a4\u09be \u09b9\u09b2\u09c7 \u09a4 \u09a6\u09c7\u09b6 \u0997\u09c7\u099b\u09c7 \u09ac\u09c1\u0997\u09c7", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u0996\u09be\u09a8\u0995\u09bf \u09a4\u09c1\u0987 \u098f\u0995\u099f\u09be \u09ac\u09be\u09b8\u099f\u09c7\u099f ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ac\u09b0\u09c7\u09b0 \u099a\u09c1\u09a6\u09be \u09aa\u09be\u0987 \u09a8\u09be \u09a4\u09be\u0987 \u098f\u09a4 \u09a8\u09be\u099a\u09be \u09a8\u09be\u099a\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09b9\u09bf\u09b0\u09c1 \u0986\u09b2\u09ae\u0993 \u09a4\u09b0\u09c7 \u099a\u09c1\u09a6\u09ac\u09c7\u09a8\u09be \u09a4\u09b0 \u09ae\u09be \u09ac\u09be\u09ac\u09be \u0995\u09bf \u09aa\u09a4\u09bf\u09a4\u09be\u09b0 \u09ac\u09be\u09b8\u09bf\u09a8\u09cd\u09a6\u09be ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09cb\u09b0\u09c7 \u09aa\u09be\u0987\u09b2\u09c7 \u09ae\u09be\u0997\u09bf \u09a4\u09cb\u09b0 \u09aa\u09bf\u09a4\u09be \u09ab\u09be\u099f\u09be\u0987\u09df\u09be \u09aa\u09be\u09b2\u09be\u09ae\u09c1 \u0986\u09ac\u09be\u09b0 \u09aa\u09a6\u09cd\u09a6\u09be \u0995\u09b0\u09a8 \u099a\u09cb\u09a6\u09be\u0987 \u099b\u09a4 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a8\u09be\u099b\u09bf\u09b0\u09c7\u09b0 \u09a7\u09a8 \u0985\u09a8\u09c7\u0995 \u09ac\u09dc \u09a4\u09be\u0987 \u09ae\u09c7\u09df\u09c7\u099f\u09be \u09aa\u09be\u0997\u09b2 \u09b9\u09df\u09c7 \u0997\u09c7\u099b\u09c7", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09ac\u099a\u09cd\u099a\u09be \u0986\u09ae\u09b0\u09be \u09a4\u09cb \u09b8\u09be\u09b0\u09be \u0993\u09df\u09be\u09b0\u09cd\u09b2\u09cd\u09a1 \u099c\u09c1\u09dc\u09c7 \u0986\u099b\u09bf \u09a4\u09be\u0987 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09c7\u0996\u09bf\u09b8 \u0986\u09b0 \u09a4\u09cb\u09b0\u09be \u09a4\u09cb \u09b6\u09c1\u09a7\u09c1 \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09a4\u09c7 \u09aa\u09dc\u09c7 \u0986\u099b\u09bf\u09b8 \u09a4\u09cb\u09b0\u09be \u09b8\u09be\u09b0\u09be \u0993\u09df\u09be\u09b0\u09cd\u09b2\u09cd\u09a1 \u098f \u09a5\u09be\u0995\u09b2\u09c7 \u0986\u09b0\u09cb \u0986\u0997\u09c7 \u09aa\u09c3\u09a5\u09bf\u09ac\u09c0\u099f\u09be \u09a7\u09cd\u09ac\u0982\u09b8 \u09b9\u09a4\u09b0\u09c7 \u09b8\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u099c\u09be\u09a4", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09c1 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u09a6\u09c7\u09b0 \u099c\u09ac\u09be\u0987 \u0995\u09b0\u09be \u0989\u099a\u09bf\u09a4 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09b8\u09cd\u09ac\u09be\u09ae\u09c0 \u09a6\u09c1\u09b0\u09cd\u09ac\u09b2 \u098f\u09ae\u09a8 \u0995\u09c7\u0989 \u09b8\u09cb\u09a8\u09be\u09b2\u09c0 \u09b8\u09ae\u09df \u09a8\u09b7\u09cd\u099f \u09a8\u09be \u0995\u09b0\u09c7 \u0985\u09be\u09ae\u09be\u0995\u09c7 \u0995\u09b2 \u0995\u09b0\u09cb \u09a4\u09cb\u09ae\u09be\u09b0 \u09ad\u09cb\u09a6\u09be \u099a\u09c1\u09b7\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u09b8\u09a6\u09be \u09aa\u09cd\u09b0\u09b8\u09cd\u09a4\u09c1\u09a4 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09b8\u09ac \u09ac\u09c7\u099c\u09a8\u09cd\u09ae\u09be \u0996\u09be\u09a8\u0995\u09bf\u09b0\u09aa\u09cb\u09b2\u09be \u09ab\u09c7\u0995 \u09a8\u09bf\u0989\u099c \u099b\u09b0\u09be\u0987\u09a4\u09be\u099b\u09c7 \u09a4\u09cb\u09a6\u09c7\u09b0 \u099c\u09a8\u09cd\u09ae\u09c7\u09b0 \u09a0\u09bf\u0995 \u09a8\u09be\u0987", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u0986\u09ac\u09be\u09b2 \u09a5\u09c7\u0995\u09c7 \u0989\u09a0\u09c7 \u0986\u09b8\u099b\u09c7 \u09a4\u09cb \u09a4\u09be\u0987 \u098f\u0987 \u09a7\u09b0\u09a8\u09c7\u09b0 \u09ae\u09a8 \u09ae\u09be\u09a8\u09c1\u09b7\u09bf\u0995\u09a4\u09be", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09a4\u09c1\u0987 \u09a6\u09c7\u0996\u099b\u09bf\u09b8 \u09a8\u09be \u09ae\u09be\u09df\u09be\u09a8\u09ae\u09be\u09b0\u09c7 \u09ac\u09cc\u09a6\u09cd\u09a7\u09b0\u09be \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u0989\u09aa\u09b0 \u0995\u09c7\u09ae\u09a8 \u0985\u09a4\u09cd\u09af\u09be\u099a\u09be\u09b0 \u0995\u09b0\u099b\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u099c\u09be\u09a4\u09bf \u0985\u09a8\u09c7\u0995 \u09a7\u09c8\u09b0\u09cd\u09af\u09b6\u09c0\u09b2 \u098f\u099c\u09a8\u09cd\u09af \u098f\u0996\u09a8\u0993 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09ac\u09cc\u09a6\u09cd\u09a7\u09b0\u09be \u098f\u09ac\u0982 \u09a4\u09cb\u09b0 \u09ae\u09a4 \u09ac\u09cd\u09af\u0995\u09cd\u09a4\u09bf\u09b0\u09be \u09ac\u09c7\u099a\u09c7 \u0986\u099b\u09c7 \u09b8\u09ae\u09df \u09a5\u09be\u0995\u09a4\u09c7 \u09a8\u09bf\u099c\u09c7\u0995\u09c7 \u09b6\u09c1\u09a7\u09b0\u09c7 \u09a8\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u0997\u09be\u0987 \u09ae\u09be\u09b0\u09be\u09a8\u09bf \u09a4\u09b0 \u09ac\u09be\u09aa \u09ae\u09be\u09b0 \u0995\u09cb\u09a8 \u09aa\u09b0\u09bf\u099a\u09df \u0986\u099b\u09c7 \u09a8\u09be\u0995\u09bf \u0997\u09be\u0987 \u09ae\u09be\u09b0\u09be\u09a8\u09bf", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09c1\u09b2\u09be \u099c\u09be\u09b0\u099c\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09be \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09a4\u09cb\u09a6\u09c7\u09b0 \u0995\u09bf \u099a\u09c1\u09a6\u09be \u09a6\u09bf\u09a4\u09c7 \u0986\u09b8\u09cb \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09a1\u09c1\u0995\u09b2\u09c7 \u09a4\u09b0 \u09ae\u09be\u09df\u09b0\u09c7 \u099a\u09c1\u09a6\u09ae\u09c1 \u09a4\u09cb\u09b0\u09be \u09b0\u0995\u09cd\u09a4 \u099a\u09c1\u09b7\u09be \u09af\u09c7 \u09a6\u09c7\u09b6\u0995\u09c7 \u09a6\u09b0\u099b \u09a4\u09be\u09a6\u09c7\u09b0 \u09b0\u0995\u09cd\u09a4 \u09b6\u09c7\u09b7 \u09a8\u09be \u09b9\u09df\u09be \u09aa\u09b0\u09cd\u09af\u09a8\u09cd\u09a4 \u099b\u09be\u09dc\u099b \u09a8\u09be ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09b6\u09be\u09a8\u09cd\u09a4 \u09a8\u09bf\u09b2\u09af\u09bc \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09a4\u09cb\u0995\u09c7 \u0995\u09c7 \u09ac\u09b2\u099b\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09b0\u09be \u09a8\u09bf\u099c\u09c7\u09b0\u09be \u09a8\u09bf\u099c\u09c7\u09b0\u09be\u0987 \u098f\u09b8\u09ac \u0985\u09aa\u0995\u09b0\u09cd\u09ae \u0995\u09b0\u09ac\u09c7 \u0995\u0987 \u0986\u09ae\u09bf \u09af\u09c7 \u098f\u09b2\u09be\u0995\u09be\u0987 \u09a5\u09be\u0995\u09bf \u09b8\u09c7 \u098f\u09b2\u09be\u0995\u09be\u09b0 \u09a4\u09cb \u09a6\u09c2\u09b0\u09c7\u09b0 \u0995\u09a5\u09be \u09a6\u09b6 \u09ac\u09be\u09b0\u09cb\u099f\u09be \u0997\u09cd\u09b0\u09be\u09ae \u0996\u09c1\u0987\u099c\u09be\u0993 \u098f\u0995\u099f\u09be \u09ae\u09be\u09b2\u09c1\u09b0 \u09ac\u09be\u0981\u099a\u09cd\u099a\u09be\u0995\u09c7 \u09aa\u09be\u0993\u09df\u09be \u09af\u09be\u09ac\u09c7 \u09a8\u09be \u0995\u0987 \u09b8\u09c7\u0996\u09be\u09a8\u09c7 \u09a4\u09cb \u0995\u09cb\u09a8 \u0985\u09b6\u09be\u09a8\u09cd\u09a4\u09bf \u09a8\u09c7\u0987 \u0986\u09b8\u09b2\u09c7 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09a5\u09c7\u0995\u09c7 \u09a4\u09be\u09dc\u09be\u0987\u09b2\u09c7\u0987 \u09b8\u09ae\u09cd\u09af\u09be\u09b8\u09be \u09b8\u09ae\u09be\u09a7\u09be\u09a8 \u09b9\u09ac\u09c7 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09c7\u09af\u09bc\u09c7 \u09a6\u09c7\u09b0 \u09b2\u099c\u09cd\u099c\u09be \u09a8\u09c7\u0987 \u09b8\u09c7 \u09b8\u09ac\u09be\u0987 \u099c\u09be\u09a8\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0993\u09a6\u09c7\u09b0 \u09ac\u09cd\u09af\u09be\u09ac\u09b9\u09be\u09b0\u0987 \u09aa\u09cd\u09b0\u09ae\u09be\u09a8 \u0995\u09b0\u09c7 \u09af\u09c7 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09a7\u09b0\u09cd\u09ae \u0995\u09a4 \u09ae\u09be\u09a6\u09be\u09b0 \u099a\u09cb\u09a6 \u09a7\u09b0\u09cd\u09ae \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u09b0\u09be \u09a4\u09cb\u09a6\u09c7\u09b0 \u09a4\u09cb \u09ac\u09be\u09aa\u09c7\u09b0 \u09b9\u09bf\u09b8\u09c7\u09ac \u09a8\u09c7\u0987 \u09a4\u09cb\u09a6\u09c7\u09b0 \u099c\u09a8\u09cd\u09ae \u09a4\u09cb \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b0 \u09ae\u09a4 \u09ae\u09be\u09a8\u09c1\u09b7\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09a4\u09cb \u09ae\u09be\u09a8\u09c1\u09b7\u09c7\u09b0 \u0985\u09a8\u09cd\u09a4\u09a4 \u098f\u0995\u099f\u09c1 \u09ae\u09be\u09df\u09be \u09b9\u09df \u0986\u09b0 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09a4\u09cb \u0995\u09cb\u09a8 \u09ae\u09be\u09df\u09be \u09a6\u09df\u09be \u09a8\u09c7\u0987\u09a5\u09be\u0995\u09ac\u09c7 \u0995\u09bf \u0995\u09b0\u09c7 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09a7\u09b0\u09cd\u09ae \u09a4\u09cb\u09a6\u09c7\u09b0 \u09b6\u09bf\u0995\u09cd\u09b7\u09be \u09a6\u09c7\u09df \u09ae\u09be\u09a8\u09c1\u09b7 \u09b9\u09a4\u09cd\u09af\u09be \u0995\u09b0\u09be \u09a4\u09cb\u09a6\u09c7\u09b0 \u09a8\u09bf\u099c\u09c7\u09a6\u09c7\u09b0 \u09ae\u09be \u09ac\u09cb\u09a8 \u0995\u09bf\u09ad\u09be\u09ac\u09c7 \u09a7\u09b0\u09cd\u09b7\u09a8 \u0995\u09b0\u09a4\u09c7 \u09b9\u09df\u099b\u09bf\u0983\u099b\u09bf\u0983\u099b\u09bf\u0983\u09b6\u09a4 \u09a7\u09bf\u0995\u09cd\u0995\u09be\u09b0 \u099c\u09be\u09a8\u09be\u0987 \u09a4\u09cb\u09a6\u09c7\u09b0 \u0993 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09a7\u09b0\u09cd\u09ae\u0995\u09c7", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09ac\u09bf\u09b6\u09cd\u09ac \u098f\u09ac\u0982 \u099c\u09be\u09a4\u09bf\u09b8\u0982\u0998 \u099a\u09bf\u09a8 \u0996\u09be\u09a8\u0995\u09bf \u09ae\u09be\u0997\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u0997\u09cb\u09b0 \u099c\u09a8\u09cd\u09af \u0995\u09bf\u099b\u09c1 \u0995\u09b0\u09a4\u09c7\u099b\u09c7\u09a8\u09be \u09a4\u09ac\u09c7 \u0986\u09b0 \u09ac\u09b8\u09c7 \u09a8\u09be \u09a5\u09c7\u0995\u09c7 \u0989\u09aa\u09af\u09c1\u0995\u09cd\u09a4 \u09b6\u09be\u09b8\u09cd\u09a4\u09bf \u09a6\u09c7\u0993\u09df\u09be \u09a6\u09b0\u0995\u09be\u09b0 \u09ae\u09bf\u09df\u09be\u09a8\u09ae\u09be\u09b0\u0995\u09c7", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u09ae\u09c7\u09af\u09bc\u09c7 \u099f\u09be\u0995\u09c7 \u09aa\u09be\u099b\u09be\u09af\u09bc \u09ac\u09be\u09b0\u09bf \u09a6\u09c7\u09df\u09be \u09a6\u09b0\u0995\u09be\u09b0 \u099b\u09bf\u09b2\u09cb ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0986\u09b9\u09b9 \u0989\u09b9\u09b9 \u0995\u09a4\u09cb \u09ac\u09dc \u09ac\u09dc \u09a6\u09c1\u09a7 \u0996\u09be\u09b2\u09bf \u099d\u09cb\u0995\u09c7 \u09ae\u09a8\u09c7 \u09b9\u09df \u09a7\u09b0\u09bf ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09a4\u09cb\u09b0\u09be \u09ae\u09c7\u09df\u09c7\u09b0 \u09a8\u09be\u09ae\u09c7 \u0995\u09b2\u0982\u0995 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09ad\u09cb\u09a7\u09be \u09ac\u09bf\u09a4\u09b0 \u0995\u09a4\u09cb \u09b0\u09b8 \u09a4\u09cb\u09a6\u09c7\u09b0 \u0995\u09c7 \u099a\u09c1\u09a6\u09c7 \u09aa\u09a4\u09c0 \u09a6\u09bf\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7\u09a8\u09be\u0987 \u09a4\u09cb\u09a6\u09c7\u09b0 \u099c\u09be\u09ae\u09be\u0987 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0986\u09b0\u09c7 \u09ad\u09be\u0987 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u0986\u0987\u099b\u09c7 \u0986\u09ae\u0997\u09cb \u09b8\u09c7\u09a8\u09be\u09ac\u09be\u09b9\u09bf\u09a8\u09c0 \u09a8\u09bf\u09a4\u09c7 \u098f\u099f\u09be \u09a6\u09bf\u09b2\u09c7\u09a4\u09cb \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u0985\u09b8\u09cd\u09a4\u09bf\u09a4\u09cd\u09ac\u0987 \u09ac\u09bf\u09b2\u09bf\u09a8 \u09b9\u09df\u09c7 \u09af\u09be\u09ac\u09c7", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09b6\u09be\u09b2\u09bf\u09b0\u09c7 \u0995\u099a\u09c1\u09a6\u09c7\u0993 \u09ad\u09cb\u09a6\u09be\u09df ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0993\u09b0 \u09ac\u09cb\u09a6\u09be\u09df \u09ac\u09be\u09b2\u09c1 \u09a1\u09be\u09b2\u09cb \u0986\u09b0 \u09b8\u09be\u09ac\u09cb\u09b2 \u09ae\u09be\u09b0\u09cb ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09a4\u09cb \u0998\u09dc \u0995\u09b0\u09be \u09b8\u09ae\u09cd\u09ad\u09ac \u09a8\u09be", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09ae\u09a6 \u0996\u09be\u09ac\u09cb \u0986\u09b0 \u09a4\u09cb\u0995\u09c7 \u099a\u09c1\u09a6\u09ac\u09cb ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0990 \u09b6\u09c1\u09af\u09bc\u09cb\u09b0\u09c7\u09b0 \u09ae\u09c1\u0996\u09c7 \u0995\u09cb\u09b7\u09c7 \u09a6\u09c1\u099f\u09be \u099c\u09c1\u09a4\u09be\u09b0 \u09ac\u09be\u09b0\u09bf \u09ae\u09be\u09b0 \u0990 \u0996\u09be\u09a8\u0995\u09bf \u09ae\u09be\u0997\u09bf\u09b0 \u098f\u09a4 \u09b8\u09be\u09b9\u09b8 \u09aa\u09be\u0987\u09b2\u09cb \u0995\u09a5\u09be \u09a5\u09c7\u0995\u09c7 \u099f\u09cd\u09b0\u09be\u09ae \u099c\u09bf\u09a4\u09be\u09b0 \u09aa\u09b0 \u09a5\u09c7\u0995\u09c7 \u098f\u0987 \u09ae\u09be\u0997\u09bf\u09b0 \u098f\u09a4 \u09b8\u09cd\u09aa\u09b0\u09cd\u09a7\u09be \u09ac\u09c7\u09a1\u09bc\u09c7\u099b\u09c7", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09a4\u09cb\u09b0\u09c7 \u09b8\u09ac\u09be\u0987 \u099c\u09c1\u09a4\u09be \u09aa\u09c7\u099f\u09be \u0995\u09b0\u09ac\u09c7", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u09b0\u09be \u09ae\u09c7\u09df\u09c7 \u09a8\u09be\u09ae\u09c7\u09b0 \u09b0\u0995\u09cd\u09a4 \u09aa\u09bf\u09aa\u09be\u09b8\u09c1 \u09a1\u09be\u0987\u09a8\u09bf \u098f\u09a6\u09b0\u09a8\u09c7\u09b0 \u09ae\u09c7\u09df\u09c7 \u0997\u09c1\u09b2\u09bf\u0995\u09c7 \u0995\u09a0\u09bf\u09a8 \u09ac\u09bf\u099a\u09be\u09b0 \u0995\u09b0\u09be \u09b9\u09df", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u09ae\u09b9\u09bf\u09b2\u09be\u09b0 \u09af\u0989\u09a8\u09be\u0982\u0997\u09c7 \u099b\u09c1\u09b0\u09bf \u09a1\u09c1\u0995\u09bf\u09df\u09c7 \u09ae\u09c7\u09b0\u09c7 \u09ab\u09c7\u09b2\u09be \u0989\u099a\u09bf\u09a4 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0986\u0997\u09c7\u09b0 \u09b8\u09c7\u09a8\u09be \u0986\u099b\u09bf\u09b2\u09cb \u09aa\u09be\u0997\u09b2 \u0986\u09b0 \u098f\u0996\u09a8 \u098f\u099f\u09be \u09aa\u09be\u0997\u09b2 \u09a8\u09bf\u0989\u099c\u09aa\u09c7\u09aa\u09be\u09b0 \u099c\u09c7 \u09b2\u09bf\u0996\u09c7\u099b\u09c7 \u0993\u0987 \u09b8\u09be\u09b2\u09be\u09df \u098f\u0995\u099f\u09bf \u099b\u09be\u0997\u09b2 \u09b6\u09be\u09b2\u09be\u09b0 \u09aa\u09cb \u0993\u0987 \u09b8\u09c7\u09a8\u09be \u09ad\u09be\u09b0\u09a4 \u099a\u09c1\u09a6\u09c7\u09a8\u09be \u09ae\u09be\u09a6\u09be\u09b0 \u099a\u09cb\u09a6 \u098f\u0987 \u09b0\u0995\u09ae \u09b2\u09bf\u0995\u09b2\u09c7 \u09a4\u09cb\u09b0 \u09a8\u09bf\u0989\u099c \u09aa\u09c7\u09aa\u09be\u09b0\u09c7 \u0997\u09be\u09df\u09c7 \u099c\u09c1\u09a4\u09be \u09ae\u09be\u09b0\u09bf \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u099b\u09c7\u09b2\u09c7 \u0993\u09b0\u09be \u09ac\u09df \u09aa\u09be\u09df \u09ac\u09b2\u09c7 \u09b8\u09c7\u09a8\u09be \u09ac\u09be\u09a4\u09bf\u09b2 \u0995\u09b0\u09c7\u099b\u09c7 \u09a4\u09c1\u0987 \u09b6\u09be\u09b2\u09be \u09ac\u09c1\u099d\u09cb\u09b8 \u09a8\u09be\u0987 \u0993\u09b0\u09be \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7\u0987 \u09aa\u09be\u09b0\u09c7\u09a8\u09be\u0987 \u0986\u09b0\u09a4\u09cb \u09ad\u09be\u09b0\u09a4 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u098f\u0995\u099f\u09bf \u09ac\u09be\u09b2 \u0986\u09b0 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09b8\u09ae\u09be\u09a8 \u0995\u09a5\u09be \u09ae\u09be\u09a6\u09be\u09b0 \u099a\u09cb\u09a6", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u09b0 \u09ac\u09cc\u09a6\u09cd\u09a7\u09a6\u09c7\u09b0 \u09ae\u09a4 \u0996\u09be\u09b0\u09be\u09aa \u099c\u09be\u09a4 \u09ae\u09a8\u09c7 \u09b9\u09df \u098f\u0987 \u09aa\u09c3\u09a5\u09bf\u09ac\u09c0\u09a4\u09c7 \u0986\u09b0 \u098f\u0995\u099f\u09be\u0993 \u09a8\u09c7\u0987 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf \u09a4\u09cb\u09a6\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09ac\u09be\u0982\u09b2\u09be\u09b0 \u09af\u09c1\u09ac\u0997\u09df\u09be \u0986\u099c \u0996\u09be\u09df\u09be\u09aa \u09ac\u09a1 \u09ac\u09a1 \u09a6\u09c1\u09a7 \u0986\u09b0 \u09aa\u09be\u099b\u09be \u09a2\u09be\u0995\u09c7\u09b0 \u09b0\u09be\u0996 \u09ae\u09be\u0997\u09bf", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0986\u09b0\u09c7 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09c1\u09b2\u09be \u09a4\u09cb\u09b0 \u09a4 \u09a6\u09c7\u09ac\u09c0 \u09b6\u09c7\u0996 \u09b9\u09be\u09b8\u09bf\u09a8\u09be \u0986\u099b\u09c7", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u098f\u0987 \u09ae\u09be\u0997\u09bf\u09b0 \u09a4\u09cb\u09b0 \u09ad\u09cb\u09a6\u09be\u09df \u098f\u09b8\u09bf\u09a1 \u09a6\u09bf\u09ae\u09c1 \u0986\u09ae\u09bf \u0986\u09ae\u09bf \u099b\u09be\u098f\u09b2\u09c0\u0997 \u09a8\u09c7\u09a4\u09be ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0993\u09dc\u09a8\u09be \u09a4\u09cb \u09b0\u09be\u0996\u09a8\u09be\u0987 \u09a4\u09be\u09b9\u09b2\u09c7 \u0995\u09be\u09aa\u09dc \u09b2\u0997\u09c7 \u09b0\u09be\u0996\u09be\u09b0 \u0995\u09bf \u09a6\u09b0\u0995\u09be\u09b0 \u099b\u09bf\u09b2 \u0993\u099f\u09be\u0993 \u0996\u09c1\u0987\u09b2\u09be\u0987 \u09ab\u09be\u09b2\u09be\u0987\u09a4\u09be ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09e8\u099f\u09be\u09b0 \u099a\u09c7\u09b9\u09be\u09b0\u09be \u09a6\u09c7\u0987\u0996\u09be \u0986\u09ae\u09be\u09b0 \u09ac\u09be\u09b8\u09be\u09b0 \u0995\u09be\u099c\u09c7\u09b0 \u09ac\u09c1\u09df\u09be\u09b0 \u0995\u09a5\u09be \u09ae\u09a8\u09c7 \u09aa\u09dc\u09b2", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0986\u09aa\u09c1 \u09ad\u09c1\u09c2\u09a6\u09be \u099a\u09c1\u0987\u09a4\u09c7 \u0995\u09c0 \u09b9\u09df ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u0986\u09b8\u09cd\u09a4\u09be \u098f\u0995\u099f\u09be \u0996\u09be\u09a8\u09bf\u0995 \u09ae\u09be\u0997\u09c0 ", + "output": [ + "Gender abusive" + ] + }, + { + "input": "\u09b8\u09c1\u099a\u09bf\u0995\u09c7 \u099c\u09c1\u09a4\u09be \u09aa\u09c7\u099f\u09be \u0995\u09b0\u09c7 \u09a8\u09cb\u09ac\u09c7\u09b2 \u0995\u09c7\u09dc\u09c7 \u09a8\u09c7\u0993\u09df\u09be \u0989\u099a\u09bf\u09a4", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7 \u09ae\u09be\u09a4\u09cd\u09b0 \u099c\u09a8 \u09a4\u09be\u0987 \u09b8\u09ae\u09ac\u09c7\u09a6\u09a8\u09be \u099c\u09be\u09a8\u09be\u099a\u09cd\u099b\u09c7 \u0986\u09b0 \u09ae\u09c7\u09df\u09be\u09a8\u09ae\u09be\u09b0\u09c7 \u09a4\u09cb \u0985\u09b8\u0982\u0996\u09cd\u09af \u09ae\u09cb\u09b8\u09b2\u09ae\u09be\u09a8 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09aa\u09cd\u09b0\u09a7\u09be\u09a8\u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09bf\u09b0 \u0995\u09be\u099b\u09c7 \u098f\u09a4 \u09b8\u09ae\u09ac\u09c7\u09a6\u09a8\u09be \u09a8\u09be\u0987", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u098f\u0995\u099f\u09be \u09ae\u09be\u09a6\u09be\u09b0\u099a\u09cb\u09a6 \u09a6\u09c7\u09b6 \u09b6\u09c1\u09df\u09cb\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09b8\u09ac\u0997\u09c1\u09b2\u09cb \u09a4\u09be\u09b0 \u099a\u09c7\u09df\u09c7 \u09ac\u09c7\u09b6\u09bf \u09b6\u09c1\u09df\u09cb\u09b0\u0996\u09cb\u09b0 \u0987\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09a8 \u09b0\u09be ", + "output": [ + "Geopolitical" + ] + }, + { + "input": " \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b8\u09a1\u09bc\u09af\u09a8\u09cd\u09a4\u09cd\u09b0\u09c7 \u09aa\u09c2\u09b0\u09cd\u09ac \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09aa\u09c3\u09a5\u0995 \u09b9\u09af\u09bc\u09c7 \u09af\u09be\u09af\u09bc ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09a4\u09cb\u0997\u09cb \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09a8 \u09aa\u09c7\u099c\u09c7 \u0997\u09bf\u09df\u09c7 \u0997\u09c1\u09df\u09be \u09ae\u09be\u09b0\u09be \u0996\u09be ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u098f\u0987 \u09a8\u09bf\u0989\u099c\u099f\u09be \u09af\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09a6\u09be\u09b2\u09be\u09b2 \u098f\u099f\u09be \u09ac\u09c1\u099c\u09be\u0987 \u09af\u09be\u099a\u09cd\u099b\u09c7", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09b6\u09c7\u0996 \u09b9\u09be\u09b8\u09bf\u09a8\u09be \u09a5\u09be\u0995\u09be\u09df \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09b9\u09df \u09a8\u09bf \u0995\u09c1\u09a8\u09cd\u09a4\u09c1 \u09ad\u09be\u09b0\u09a4 \u09b9\u09ac\u09be\u09b0 \u09b8\u09be\u09ae\u09be\u09a8\u09cd\u09af \u098f\u0995\u099f\u09c1 \u09ac\u09be\u0995\u09bf \u0987\u09a8\u09b6\u09be \u0986\u09b2\u09cd\u09b2\u09be\u09b9 \u0996\u09c1\u09ac \u099c\u09b2\u09a6\u09bf \u0986\u09ae\u09b0\u09be \u09ad\u09be\u09b0\u09a4 \u09b9\u09a4\u09c7 \u09af\u09be\u099a\u09cd\u099b\u09bf \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09b6\u09c7\u0996 \u09b9\u09be\u09b8\u09bf\u09a8\u09be \u0997\u09a6\u09bf\u09b0 \u09b2\u09cb\u09ad\u09c7 \u0989\u09a8\u09be\u09b0 \u09ac\u09be\u09ac\u09be\u09b0 \u09a6\u09c7\u09b6\u099f\u09be\u0995\u09c7 \u09ad\u09be\u09b0\u09a4\u0995\u09c7 \u0989\u09aa\u09b9\u09be\u09b0 \u09a6\u09bf\u099a\u09cd\u099b\u09c7\u09a8 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0997\u09a4 \u09ae\u0999\u09cd\u0997\u09b2\u09ac\u09be\u09b0 \u0987\u0982\u09b0\u09c7\u099c\u09bf \u09a6\u09c8\u09a8\u09bf\u0995 \u09a8\u09bf\u0989 \u098f\u0987\u099c\u09c7\u09b0 \u098f\u0995 \u09aa\u09cd\u09b0\u09a4\u09bf\u09ac\u09c7\u09a6\u09a8 \u098f\u09ae\u09a8 \u09a4\u09a5\u09cd\u09af \u099c\u09be\u09a8\u09be\u09a8\u09c7\u09be \u09b9\u09df\u09c7\u099b\u09c7 \u0997\u09a4 \u09b8\u09c7\u09be\u09ae\u09ac\u09be\u09b0 \u09aa\u09b0\u09cd\u09af\u099f\u09a8 \u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0 \u09b0\u09be\u09b6\u09c7\u09a6 \u0996\u09be\u09a8 \u09ae\u09c7\u09a8\u09a8\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u098f\u0995 \u09ac\u09c8\u09a0\u0995\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u098f\u09ae\u09a8 \u0986\u09ac\u09a6\u09be\u09b0 \u09a4\u09c1\u09b2\u09c7 \u09a7\u09b0\u09c7\u09a8 \u09a6\u09c7\u09b6\u099f\u09bf\u09b0 \u09a2\u09be\u0995\u09be\u09b8\u09cd\u09a5 \u09b9\u09be\u0987\u0995\u09ae\u09bf\u09b6\u09a8\u09be\u09b0 \u09b9\u09b0\u09cd\u09b7\u09ac\u09b0\u09cd\u09a7\u09a8 \u09b6\u09cd\u09b0\u09c0\u0982\u09b2\u09be ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u0987 \u0986\u09aa\u09a8\u09be\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf \u09af\u09a5\u09be\u09af\u09a5 \u09b8\u09ae\u09cd\u09ae\u09be\u09a8 \u09aa\u09cd\u09b0\u09a6\u09b0\u09cd\u09b6\u09a8 \u0995\u09b0\u09c7 \u099f\u09bf \u09aa\u09cd\u09b0\u09b6\u09cd\u09a8\u09c7 \u0989\u09a4\u09cd\u09a4\u09b0 \u099c\u09be\u09a8\u09a4\u09c7 \u099a\u09be\u099a\u09cd\u099b\u09bf \u09ad\u09be\u09b0\u09a4 \u098f\u09a6\u09c7\u09b6\u0995\u09c7 \u09b8\u09cd\u09ac\u09be\u09a7\u09c0\u09a8\u09a4\u09be \u0985\u09b0\u09cd\u099c\u09a8\u09c7 \u09b8\u09b9\u09be\u09af\u09bc\u09a4\u09be\u09b0 \u09ac\u09bf\u09a8\u09bf\u09ae\u09af\u09bc\u09c7 \u0995\u09c0 \u09a8\u09bf\u09af\u09bc\u09c7\u099b\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09b0\u09be \u0995\u09c0\u09ad\u09be\u09ac\u09c7 \u09ac\u09cd\u09b0\u09bf\u099f\u09bf\u09b6 \u09b6\u09be\u09b8\u09a8 \u09b6\u09c3\u0999\u09cd\u0996\u09b2 \u09a5\u09c7\u0995\u09c7 \u09ad\u09be\u09b0\u09a4\u0995\u09c7 \u09ae\u09c1\u0995\u09cd\u09a4 \u0995\u09b0\u09b2 \u0986\u09ae\u09bf \u09a8\u09bf\u099c\u09c7 \u09b8\u09c0\u09ae\u09bf\u09a4 \u099c\u09cd\u099e\u09be\u09a8\u09c7\u09b0 \u0985\u09a7\u09bf\u0995\u09be\u09b0\u09c0 \u09a4\u09ac\u09c7 \u0987\u09a4\u09bf\u09b9\u09be\u09b8 \u09aa\u09a1\u09bc\u09c7 \u09af\u09c7\u099f\u09c1\u0995\u09c1 \u099c\u09be\u09a8\u09bf \u09a4\u09be \u09b9\u09b2\u09cb \u09b8\u09bf\u09aa\u09be\u09b9\u09c0 \u09ac\u09bf\u09a6\u09cd\u09b0\u09cb\u09b9 \u099b\u09bf\u09b2 \u09ac\u09cd\u09b0\u09bf\u099f\u09bf\u09b6\u09a6\u09c7\u09b0 \u09ac\u09bf\u09b0\u09c1\u09a6\u09cd\u09a7\u09c7 \u09aa\u09cd\u09b0\u09a5\u09ae \u09aa\u09cd\u09b0\u09a4\u09cd\u09af\u0995\u09cd\u09b7 \u09b8\u09cd\u09ac\u09be\u09a7\u09c0\u09a8\u09a4\u09be \u09b8\u0982\u0997\u09cd\u09b0\u09be\u09ae \u09b8\u09c7\u0996\u09be\u09a8\u09c7 \u09a4\u09cb \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u0989\u09ad\u09af\u09bc\u09c7\u09b0\u0987 \u0985\u09ac\u09a6\u09be\u09a8 \u099b\u09bf\u09b2 \u0986\u099c\u0995\u09be\u09b2 \u09aa\u09cd\u09b0\u09be\u09af\u09bc\u0987 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09a8\u09bf\u09b0\u09cd\u09af\u09be\u09a4\u09a8 \u09b8\u09ae\u09cd\u09aa\u0995\u09c7 \u09ac\u09b2\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09b0\u09be \u0995\u09c7\u09a8 \u09a8\u09bf\u09b0\u09cd\u09af\u09be\u09a4\u09bf\u09a4 \u09b9\u099a\u09cd\u099b\u09c7 \u0986\u099a\u09cd\u099b\u09be \u09ac\u09b2\u09c7\u09a8", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09a6\u09c7\u0996 \u09a6\u09be\u09a6\u09be\u09b0\u09be \u09a4\u09cb\u09ae\u09b0\u09be \u09ad\u09be\u09b0\u09a4\u09c7 \u09a5\u09be\u0995\u09cc \u0986\u09b0 \u09af\u09c7\u0996\u09be\u09a8\u09c7\u0987 \u09a5\u09be\u0995\u09cc \u09a8\u09be \u0995\u09c7\u09a8 \u09a4\u09be\u09a4\u09c7 \u0995\u09c1\u09a8\u09cb \u0985\u09b6\u09cb\u09ad\u09bf\u09a6\u09be \u09a8\u09c7\u0987 \u09a4\u09ac\u09c7 \u09ac\u09be\u0982\u0999\u09cd\u0997\u09be\u09b2\u09bf \u09a4\u09cc \u09ac\u099f\u09c7 \u09a4\u09cb\u09ae\u09b0\u09be \u0995\u09b2\u0995\u09be\u09a4\u09be\u09b0 \u09ac\u09be\u0982\u0999\u09cd\u0997\u09be\u09b2\u09bf \u0986\u09b0 \u0986\u09ae\u09b0\u09be \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09bf \u09ac\u09be\u0982\u0999\u09cd\u0997\u09be\u09b2\u09bf \u09b6\u09cb\u09a7\u09c1 \u09b6\u09cb\u09a7\u09c1 \u09ac\u09bf\u09a8\u09be \u09a4\u09b0\u0995\u09c7 \u09a8\u09be \u099c\u09c7\u09df\u09c7 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09ad\u09be\u09b7\u09be \u0995\u09c7 \u09b8\u09a0\u09bf\u0995 \u09ad\u09be\u09ac\u09c7 \u09ac\u09cd\u09af\u09be\u09ac\u09b9\u09be\u09b0 \u0995\u09b0\u09bf \u0986\u09ae\u09b0\u09be", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09b8\u09a8\u09cd\u09a4\u09cd\u09b0\u09be\u09b8\u09c0 \u09b9\u09be\u09ae\u09b2\u09be \u09ac\u09b2\u09c7 \u0997\u09c1\u099c\u09ac \u099b\u09dc\u09be\u09a8\u09cb \u09a0\u09bf\u0995 \u09a8\u09df \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c0 \u09b8\u09c7\u09a8\u09be\u09ac\u09be\u09b9\u09bf\u09a8\u09c0 \u09b9\u09be\u09ae\u09b2\u09be \u0995\u09b0\u09c7\u099b\u09c7 \u09b8\u09c7\u0987 \u0995\u09a5\u09be \u09ac\u09b2\u09c7 \u09a6\u09bf\u09a8 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b8\u09c7\u09a8\u09be\u09ac\u09be\u09b9\u09bf\u09a8\u09c0 \u0998\u09c1\u09ae\u09bf\u09df\u09c7 \u09a5\u09be\u0995\u09c7 \u09a8\u09be\u0995\u09bf ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u0986\u09b6\u0982\u0995\u09be \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09ac\u09c1\u099d\u09bf \u09ad\u09be\u09b0\u09a4\u09c7\u09b0", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09a6\u09c7\u09b6\u099f\u09be\u0987 \u09ad\u09be\u09b0\u09a4\u0995\u09c7 \u09a6\u09bf\u09df\u09c7 \u09a6\u09c7 \u09b0\u09c7", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u0986\u09ae\u09be\u09b0 \u09b6\u09a4\u09cd\u09b0\u09c1 \u0995\u09be\u09b0\u09a8 \u09a4\u09be\u09b0\u09be \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09a6\u09c7\u09b0 \u0989\u09aa\u09b0 \u0985\u09a4\u09be\u099a\u09be\u09b0 \u0995\u09b0\u099b\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u099a\u09c0\u09a8\u09be\u09a6\u09c7\u09b0 \u0995\u09be\u099b \u09a5\u09c7\u0995\u09c7 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09b6\u09bf\u0995\u09cd\u09b7\u09be \u09a8\u09c7\u0993\u09df\u09be \u0989\u099a\u09bf\u09ce \u0995\u09be\u09b0\u09a8 \u0989\u09a8\u09be\u09b0\u09be \u09a4\u09be\u09a6\u09c7\u09b0 \u09b8\u09c0\u09ae\u09be\u09a8\u09cd\u09a4\u09c7\u09b0 \u098f\u0995\u09be\u0982\u09b6 \u0996\u09c1\u09b2\u09c7 \u09a6\u09bf\u09df\u09c7\u099b\u09c7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u0986\u09ae\u09b0\u09be \u09a4\u09be \u09aa\u09be\u09b0\u09bf\u09a8\u09bf \u09a4\u09be\u099b\u09be\u09dc\u09be \u09ac\u09dc \u0989\u09a6\u09be\u09b9\u09b0\u09a8 \u09b9\u099a\u09cd\u099b\u09c7 \u09b8\u09be\u09b2\u09c7 \u0986\u09ae\u09b0\u09be\u0993 \u09aa\u09be\u09b2\u09bf\u09df\u09c7 \u0997\u09c7\u099b\u09bf\u09b2\u09be\u09ae \u09ad\u09be\u09b0\u09a4\u09c7 \u0986\u09b0 \u09ad\u09be\u09b0\u09a4 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u0986\u09b6\u09cd\u09b0\u09df \u09a6\u09bf\u09df\u09c7\u099b\u09bf\u09b2 \u09b8\u0982\u0995\u09cb\u099f \u0995\u09c7\u099f\u09c7 \u09af\u09be\u09ac\u09be\u09b0 \u09aa\u09b0 \u0986\u09ae\u09b0\u09be \u09af\u09c7\u09ae\u09a8 \u09ae\u09be\u09a4\u09c3\u09ad\u09c2\u09ae\u09bf\u09a4\u09c7 \u09ac\u09cd\u09af\u09be\u0995 \u0995\u09b0\u099b\u09bf\u09b2\u09be\u09ae \u09a4\u09c7\u09ae\u09a8\u09bf \u0993\u09b0\u09be\u0993 \u099a\u09b2\u09c7 \u09af\u09be\u09ac\u09c7 \u09b8\u09c1\u09a4\u09b0\u09be\u0982 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09b8\u09c0\u09ae\u09be\u09a8\u09cd\u09a4 \u0996\u09c1\u09b2\u09c7 \u09a6\u09c7\u0993\u09df\u09be \u0989\u099a\u09bf\u09ce ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09a4\u09cd\u09b0\u0995\u099f\u09be \u09aa\u09cd\u09b0\u09a6\u09c7\u09b6\u09c7\u09b0 \u09b8\u09ae\u09be\u09a8 \u09aa\u09be\u0995\u09bf\u09b6\u09cd\u09a4\u09be\u09a8 \u09ad\u09be\u0987 \u0995\u09c7 \u0995\u09be\u0995\u09c7 \u09b6\u09be\u09ae\u09b2\u09be\u09df \u09aa\u09be\u0995\u09bf\u09b6\u09cd\u09a4\u09be\u09a8 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7\u0987\u09a4\u09cb \u09aa\u09be\u09dc\u09ac\u09c7\u09a8\u09be ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be \u098f\u0995\u099f\u09be \u099c\u09be\u09a4 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09a6\u09c7\u09b6 \u09af\u09c7\u0996\u09be\u09a8\u09c7 \u09ae\u09be\u0997\u09c0 \u0986\u09b0 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u09a6\u09c7\u09b0 \u0985\u09ad\u09be\u09ac \u09a8\u09be\u0987 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0986\u09aa\u09a8\u09be\u09a6\u09c7\u09b0 \u09ae\u09a8\u09c7 \u0986\u099b\u09c7 \u0997\u09a4 \u0995\u09af\u09bc\u09c7\u0995 \u09ae\u09be\u09b8 \u0986\u0997\u09c7\u09b0 \u0996\u09c7\u09b2\u09be \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u0996\u09c7\u09b2\u09be \u09b6\u09c7\u0996 \u09b9\u09be\u09b8\u09bf\u09a8\u09be \u09b7\u09cd\u099f\u09bf\u09a1\u09bf\u09df\u09be\u09ae\u09c7 \u0997\u09c7\u09b2\u09c7\u09a8 \u0996\u09c7\u09b2\u09be \u09a6\u09c7\u0996\u09a4\u09c7 \u09ac\u09c7\u09b6 \u0995\u09b0\u09a4\u09be\u09b2\u09bf\u0993 \u09a6\u09bf\u09b2\u09c7\u09a8 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09aa\u09b0\u09c7\u09b0 \u09a6\u09bf\u09a8 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u0996\u09c7\u09b2\u09be \u09b8\u09c7\u0987 \u09a6\u09bf\u09a8 \u0997\u09c7\u09b2\u09c7\u09a8 \u09a8\u09be \u0995\u09be\u09b0\u09a8 \u09a6\u09be\u09a6\u09be \u09ac\u09be\u09ac\u09c1\u09b0\u09be \u09a6\u09c7\u0996\u09b2\u09c7 \u09ae\u09be\u0987\u09a8\u09cd\u09a1 \u0995\u09b0\u09ac\u09c7 \u09a4\u0996\u09a8 \u0995\u09cd\u09b7\u09ae\u09a4\u09be \u09a7\u09b0\u09c7 \u09b0\u09be\u0996\u09be \u0995\u09b7\u09cd\u099f \u09b9\u09ac\u09c7 \u0995\u09be\u09b0\u09a8 \u09a6\u09c7\u09b6 \u098f\u09ac\u0982 \u099c\u09a8\u0997\u09a3\u09c7\u09b0 \u099a\u09c7\u09af\u09bc\u09c7 \u0993\u09a8\u09be\u09b0 \u0995\u09cd\u09b7\u09ae\u09a4\u09be \u09ac\u09dc \u09a4\u09bf\u09a8\u09bf \u09ac\u09be\u09b0\u09c7 \u09ac\u09be\u09b0\u09c7 \u09aa\u09cd\u09b0\u09ae\u09be\u09a8 \u0995\u09b0\u09c7\u099b\u09c7\u09a8 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09b9\u09c7\u09b9\u09c7\u09b9\u09c7 \u09af\u09bf\u09a8\u09bf \u0985\u0995\u09cd\u09b7\u09df \u0995\u09c1\u09ae\u09be\u09b0\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09a8\u09be\u099a\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u09aa\u09be\u0997\u09b2 \u09b9\u09df\u09c7 \u0997\u09c7\u099b\u09bf\u09b2\u09cb \u09b8\u09c7\u0987 \u0995\u09bf\u09a8\u09be \u09ae\u09bf\u099b\u09bf\u09b2 \u0995\u09b0\u09c7 \u0989\u09aa\u09b0\u09c7 \u09a6\u09c7\u09b6\u09aa\u09cd\u09b0\u09c7\u09ae \u09ad\u09bf\u09a4\u09b0\u09c7 \u09a6\u09c7\u09b6 \u09ac\u09c7\u099a\u09be\u09b0 \u09aa\u09be\u0981\u09df\u09a4\u09be\u09b0\u09be \u0986\u09ae\u09b0\u09be \u09ae\u09a8\u09c7 \u09aa\u09cd\u09b0\u09be\u09a3\u09c7 \u099a\u09be\u0987 \u09ac\u09bf\u09a6\u09c7\u09b6\u09c0 \u099a\u09cd\u09af\u09be\u09a8\u09c7\u09b2 \u09ac\u09a8\u09cd\u09a7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09a4\u09be\u09b0 \u0986\u0997\u09c7 \u0986\u09aa\u09a8\u09be\u09b0\u09be \u09a8\u09be\u099f\u0995 \u09b8\u09bf\u09a8\u09c7\u09ae\u09be\u09df \u09b9\u09bf\u09a8\u09cd\u09a6\u09bf \u0997\u09be\u09a8 \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09aa\u09cb\u09b6\u09be\u0995 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c0 \u0995\u09a5\u09be \u09ac\u09b2\u09be \u09ac\u09a8\u09cd\u09a7 \u0995\u09b0\u09c1\u09a8 \u09a8\u09bf\u099c \u09a6\u09c7\u09b6\u09c0\u09df \u09b8\u0982\u09b7\u09cd\u0995\u09c3\u09a4\u09bf \u09a0\u09bf\u0995 \u09ad\u09be\u09ac\u09c7 \u09a4\u09c1\u09b2\u09c7 \u09a7\u09b0\u09c1\u09a8", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0989\u09a8\u09bf \u0995\u09bf \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0\u0997\u09a8 \u098f\u0997\u09c1\u09b2\u09cb \u09ac\u09b2\u09c7 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09a4\u09cb \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u0995\u09cb\u09a8 \u09b8\u09ae\u09cd\u09aa\u09b0\u09cd\u0995 \u09a8\u09c7\u0987 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": " \u098f\u09a4\u09c7 \u0995\u09b0\u09c7 \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u099a\u09cd\u09af\u09be\u09a8\u09c7\u09b2\u0997\u09c1\u09b2\u09cb\u09b0 \u09b8\u09c7\u09b0\u09be \u09b8\u09a4\u09cd\u09af \u0998\u099f\u09a8\u09be \u0985\u09ac\u09b2\u09ae\u09cd\u09ac\u09a8\u09c7\u0995\u09cd\u09b0\u09be\u0987\u09ae \u09aa\u09c7\u099f\u09cd\u09b0\u09cb\u09b2\u09b8\u09be\u09ac\u09a7\u09be\u09a8 \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be \u0987\u09a4\u09cd\u09af\u09be\u09a6\u09bf\u09b0 \u09a8\u09a4\u09c1\u09a8 \u09aa\u09b0\u09cd\u09ac \u09a4\u09c8\u09b0\u09bf \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u098f\u0996\u09be\u09a8\u09c7 \u09a8\u09cb\u09ac\u09c7\u09b2\u099c\u09df\u09c0\u09a6\u09c7\u09b0 \u0995\u09ae\u09c7\u09a8\u09cd\u099f \u09a6\u09c7\u0996\u09c7\u09a8 \u098f\u09b0\u09be \u09b6\u09be\u09b2\u09be \u0986\u09ac\u09be\u09b2 \u09b8\u09cc\u09a6\u09bf \u09aa\u09be\u0995\u09bf \u09ae\u09be\u09b2\u09c7 \u0987\u09a8\u09cd\u09a6\u09cb\u09a8\u09c7\u09b6\u09bf\u09df\u09be \u0995\u09bf \u0995\u09b0\u099b\u09c7 \u0986\u09b0 \u0995\u09be\u09ab\u09c7\u09b0 \u09ad\u09be\u09b0\u09a4 \u0986\u09b6\u09cd\u09b0 \u09df \u09a6\u09bf\u099b\u09c7 \u0986\u0997\u09c1\u09a8 \u09b2\u09be\u0997\u099b\u09c7 \u09ad\u09be\u09b0\u09a4 \u09b8\u09b0\u0995\u09be\u09b0 \u099a\u09bf\u0995\u09bf\u09ce\u09b8\u09be \u09a6\u09bf\u09a4\u09c7\u099b\u09c7 \u098f\u09b0\u09be \u0986\u09b8\u09b2\u09c7 \u0995\u09bf\u099a\u09cd\u099b\u09c1\u09b0 \u09af\u09cb\u0997\u09cd\u09af \u09a8\u09be \u0995\u09c7\u0989 \u09b9\u09df\u09a4\u09cb\u09ac\u09be \u0986\u0997\u09c1\u09a8 \u09a6\u09bf\u099b\u09c7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09ac\u09c7\u09b6\u09bf\u09b0\u09ad\u09be\u0997 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09b8\u09be\u09b9\u09be\u09af\u09cd\u09af \u0995\u09b0\u09a4\u09c7\u099b\u09c7 \u0986\u09b0 \u098f\u0996\u09be\u09a8\u09c7 \u0986\u09ac\u09be\u09b2\u09c7\u09b0\u09be \u0997\u09be\u09b2\u09bf \u09a6\u09bf\u09a4\u09c7\u099b\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": " \u098f\u0987 \u09ac\u09be\u09b2\u09c7\u09b0 \u0995\u09a8\u09cd\u09a0 \u09b8\u09be\u09b2\u09be\u09df \u0986\u09b8\u09b2\u09c7\u0987 \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be \u099a\u09be\u09b0\u09be\u09b2\u09c7\u09b0 \u099c\u09a8\u09cd\u09ae\u09c7\u09b0 \u0993\u09b0 \u09a8\u09bf\u0989\u099c \u09ac\u09c7\u09b8\u09bf\u09b0 \u09ac\u09be\u0997\u0987 \u09ac\u0995\u09ac\u09be\u099c ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u09a8\u09be \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u099f\u09be\u0987\u09aa\u09c7 \u09ad\u09c1\u09b2 \u09b9\u0987\u099b\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0986\u09ae\u09b0\u09be \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u099c\u09be\u09a4\u09bf \u09b9\u09ac\u09cb \u0995\u09c7\u09a8\u09cb \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u0985\u09b0\u09cd\u09a5\u09a8\u09c0\u09a4\u09bf \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09a5\u09c7\u0995\u09c7 \u0986\u09b2\u09be\u09a6\u09be \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09c7\u09b6 \u0986\u09b2\u09be\u09a6\u09be \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09ae\u09be\u09a4\u09c3\u09ad\u09be\u09b7\u09be \u09ac\u09be\u0982\u09b2\u09be \u09b0\u09be\u09b7\u09cd\u099f\u09cd\u09b0 \u09ad\u09be\u09b7\u09be \u0993 \u09ac\u09be\u0982\u09b2\u09be \u0986\u09ae\u09b0\u09be \u09b6\u09a4\u0995\u09b0\u09be \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u098f\u09ad\u09be\u09ac\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09b9\u09a4\u09cd\u09af\u09be \u09ac\u09bf\u098f\u09b8\u098f\u09ab \u09a6\u09bf\u09af\u09bc\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c0 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u0997\u09b0\u09c1 \u09ac\u09cd\u09af\u09ac\u09b8\u09be\u09af\u09bc\u09c0 \u09b9\u09a4\u09cd\u09af\u09be \u0997\u09b0\u09c1\u09b0 \u09ae\u09be\u0982\u09b8 \u0996\u09be\u0993\u09af\u09bc\u09be\u09b0 \u09a6\u09be\u09df \u09a6\u09c7\u0996\u09bf\u09af\u09bc\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09b9\u09a4\u09cd\u09af\u09be \u0986\u0987\u09a8 \u0995\u09b0\u09c7 \u0995\u09c1\u09b0\u09ac\u09be\u09a8\u09bf \u09a8\u09bf\u09b7\u09bf\u09a6\u09cd\u09a7 \u0995\u09b0\u09be \u0995\u09be\u09b6\u09cd\u09ae\u09c0\u09b0\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u09a7\u09b0\u09cd\u09b7\u09a3 \u0995\u09b0\u09c7 \u09b9\u09a4\u09cd\u09af\u09be \u0993 \u09ac\u09be\u09a1\u09bc\u09bf\u09b0 \u09ad\u09be\u0982\u099a\u09c1\u09b0 \u0995\u09b0\u09be \u09b8\u09b9 \u09a8\u09be\u09a8\u09be\u09ad\u09be\u09ac\u09c7 \u09b8\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u0989\u09aa\u09b0 \u0985\u09a4\u09cd\u09af\u09be\u099a\u09be\u09b0 \u09a8\u09bf\u09b0\u09cd\u09af\u09be\u09a4\u09a8 \u09af\u09c1\u09b2\u09c1\u09ae \u0995\u09b0\u09c7 \u099a\u09b2\u099b\u09c7 \u09a4\u0996\u09a8 \u09ad\u09be\u09b0\u09a4 \u09b8\u09b0\u0995\u09be\u09b0\u0995\u09c7 \u0995\u09c7 \u09b9\u09c1\u0981\u09b6\u09bf\u09af\u09bc\u09be\u09b0\u09bf \u09a6\u09c7\u09df \u0986\u09b0 \u0995\u09c7 \u099a\u09cb\u0996 \u09b0\u09be\u0999\u09cd\u0997\u09be\u09df\u09c7 \u0995\u09a5\u09be \u09ac\u09b2\u09c7 \u0986\u0997\u09c7 \u09ad\u09be\u09b0\u09a4\u0995\u09c7 \u0989\u0997\u09cd\u09b0\u09ac\u09be\u09a6\u09c0\u0989\u0997\u09cd\u09b0\u09aa\u09a8\u09cd\u09a5\u09c0 \u09a8\u09c0\u09a4\u09bf \u09aa\u09b0\u09bf\u09b9\u09be\u09b0 \u0995\u09b0\u09a4\u09c7 \u09b9\u09ac\u09c7 \u09a4\u09be\u09b0\u09aa\u09b0 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u0989\u09aa\u09b0 \u09a8\u099c\u09b0 \u09b0\u09be\u0996\u09a4\u09c7 \u09b9\u09ac\u09c7 \u0986\u09ae\u09bf \u09b9\u09b2\u09ab \u0995\u09b0\u09c7 \u09ac\u09b2\u09a4\u09c7 \u09aa\u09be\u09b0\u09bf \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09b8\u09ae\u09cd\u09aa\u09cd\u09b0\u09a6\u09be\u09af\u09bc\u09c7\u09b0 \u0985\u09a4\u09bf\u09a4\u0995\u09be\u09b2\u09c7\u09b0 \u09b8\u09ac\u09a5\u09c7\u0995\u09c7 \u09a8\u09bf\u09b0", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u0995\u0996\u09a8\u09cb \u0986\u09ae\u09be\u09b0 \u09ac\u09a8\u09cd\u09a7\u09c1 \u09b9\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7\u09a8\u09be", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09b6\u09be\u09b2\u09be \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u098f\u0995\u099f\u09be \u09ac\u09cb\u0995\u09be\u099a\u09c1\u09a6\u09be \u09a6\u09c7\u09b6 \u0995\u09c7\u09a8\u09cb \u09af\u09c7 \u09a4\u09be\u09b0\u09be \u09ad\u09be\u09b0\u09a4\u09c7 \u0986\u0995\u09cd\u09b0\u09ae\u09a3 \u0995\u09b0\u09a4\u09c7 \u099a\u09be\u09df \u09ad\u09be\u09b0\u09a4\u09c7 \u09ae\u09be\u09a8\u09c1\u09b7\u09c7\u09b0 \u09ac\u09be\u09dc\u09bf\u09a4\u09c7 \u099f\u09df\u09b2\u09c7\u099f \u09a8\u09c7\u0987 \u09a4\u09be\u09b0\u09be \u0996\u09cb\u09b2\u09be \u0986\u0995\u09be\u09b6\u09c7\u09b0 \u09a8\u09bf\u099a\u09c7 \u09b9\u09be\u0997\u09c1 \u0995\u09b0\u09c7 \u09af\u09a6\u09bf \u0990 \u09ad\u09be\u09b0\u09a4\u09c0\u09df\u09b0\u09be \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09b8\u09c0\u09ae\u09be\u09a8\u09cd\u09a4 \u098f\u09b2\u09be\u0995\u09be\u09df \u0997\u09bf\u09df\u09c7 \u09b9\u09be\u0997\u09c1 \u098f\u09ac\u0982 \u09ae\u09c1\u09a4\u09c7 \u09a6\u09c7\u09df \u09a4\u09be\u09b9\u09b2\u09c7 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7 \u09ac\u09a8\u09cd\u09af\u09be \u09b9\u09df\u09c7 \u09af\u09be\u09ac\u09c7", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u0995\u09df\u0995\u09c1\u099f\u09bf \u0986\u099b\u09c7 \u09a6\u09c1\u09b7\u09cd\u099f\u09b0\u09be \u098f\u099f\u09be \u09ac\u09b2\u09a4\u09c7 \u09aa\u09be\u09b0\u099b\u09a8\u09be \u09a7\u09b0\u09be\u0996\u09be\u09ac\u09bf \u09a4\u09be\u0987 \u098f\u0995\u09a5\u09be \u09a8\u09be \u09ac\u09b2\u09c7 \u09af\u09a4 \u09a6\u09c1\u09b7 \u09a8\u09a8\u09cd\u09a6 \u0997\u09c1\u09b7 \u0986\u09b2\u09cd\u09b2\u09be\u09b9 \u098f\u0995\u09a6\u09bf\u09a8 \u09ac\u09bf\u099a\u09be\u09b0 \u09a8\u09bf\u09b6\u09cd\u099a\u09bf\u09a4 \u0995\u09b0\u09ac\u09c7\u09a8 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u098f\u099f\u09be \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b9\u09df\u09c7 \u099c\u09be\u09ac\u09c7 \u0995\u09bf\u099b\u09c1\u09a6\u09bf\u09a8", + "output": [ + "Geopolitical" + ] + }, + { + "input": " \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09b0 \u0995\u09c1\u0993\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099b\u09be\u09b0\u09be\u09a4\u09cb \u0985\u09ac\u09b6\u09cd\u09af\u0987 \u099c\u09be\u0995\u09c0\u09b0 \u09a8\u09be\u09df\u09c7\u0995\u0995\u09c7 \u09a8\u09bf\u09b7\u09bf\u09a6\u09cd\u09a7 \u0995\u09b0\u09ac\u09c7 \u0995\u09be\u09b0\u09a3 \u09a4\u09be\u09a6\u09c7\u09b0 \u09ae\u09a8\u09c7 \u09ad\u09df \u09af\u09a6\u09bf \u09a1 \u099c\u09be\u0995\u09bf\u09b0 \u09a8\u09be\u09df\u09c7\u0995 \u09af\u09ac \u09ac\u09bf\u09a7\u09b0\u09cd\u09ae\u09c0\u0995\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09ac\u09be\u09a8\u09bf\u09df\u09c7 \u09ab\u09cd\u09af\u09be\u09b2\u09c7 \u09a4\u09be\u09b9\u09b2\u09c7 \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09b0 \u0995\u09c0 \u09b9\u09ac\u09c7 \u098f\u0987 \u09ad\u09df\u09c7 \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09b0 \u0995\u09c1\u0993\u09be \u09b8\u09b0\u0995\u09be\u09b0 \u09a1 \u099c\u09be\u0995\u09c0\u09b0 \u09a8\u09be\u09df\u09c7\u0995\u0995\u09c7 \u09a8\u09bf\u09b7\u09bf\u09a6\u09cd\u09a7 \u0995\u09b0\u099b\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09b9\u09be\u09df\u09b0\u09c7 \u0987\u09b8\u09b2\u09be\u09ae\u09c7\u09b0 \u09a6\u09c1\u09b6\u09ae\u09a8 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09a6\u09be\u09b2\u09be\u09b2 \u09a4\u09cb\u09b0\u09be \u0995\u09c7\u09a8 \u09b9\u09df\u09c7 \u0997\u09c7\u09b2\u09bf \u098f\u09a4\u09cb \u09ac\u09c7\u09b6\u09be\u09ae\u09be\u09b2 \u09af\u09c7\u0987 \u09b2\u09cb\u0995\u099f\u09be\u09b0 \u09ac\u09bf\u09b0\u09c1\u09a6\u09cd\u09a7\u09c7 \u09af\u09c1\u09a6\u09cd\u09a7 \u0985\u09aa\u09b0\u09be\u09a7\u09c7\u09b0 \u09af \u099b\u09bf\u09b2\u09a8\u09be \u09a6\u09be\u09df\u09bf\u09a4\u09cd\u09ac \u09a8\u09c7\u0993\u09df\u09be\u09b0 \u09aa\u09b0 \u09b9\u09df\u09c7 \u0997\u09c7\u09b2 \u09af\u09c1\u09a6\u09cd\u09a7 \u0985\u09aa\u09b0\u09be\u09a7\u09c0 \u09a4\u09cb\u09b0\u09be \u09a6\u09be\u09b2\u09be\u09b2\u09bf \u09ac\u09a8\u09cd\u09a7 \u0995\u09b0 \u09a8\u0987\u09b2\u09c7 \u098f\u0995\u09a6\u09bf\u09a8 \u09a4\u09cb\u09a6\u09c7\u09b0\u0995\u09c7 \u098f\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf\u09a6\u09be\u09a8 \u09aa\u09c7\u09a4\u09c7\u0987 \u09b9\u09ac\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09b9\u09be\u09df\u09b0\u09c7 \u0986\u099c\u09ac \u09a6\u09c1\u09a8\u09bf\u09df\u09be \u09ae\u09be\u09df\u09be\u09a8\u09ae\u09be\u09b0\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09ae\u09be\u0987\u09b0\u09be \u09b6\u09c7\u09b7 \u0995\u09bf\u0987\u09b0\u09be \u09ab\u09be\u09b2\u09be\u0987\u09b2\u09cb \u0995\u09cb\u09a8 \u0995\u09a5\u09be \u09a8\u09be\u0987 \u09ad\u09be\u09b0\u09a4\u09c7 \u099f\u09cd\u09b0\u09c7\u09a8 \u09a6\u09c2\u09b0\u09cd\u0998\u099f\u09a8\u09be\u09df \u09a6\u09bf\u09a6\u09bf\u09b0 \u09b6\u09cb\u0995 \u098f\u09a4\u0987 \u09af\u09a6\u09bf \u09a6\u09b0\u09a6 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf \u09a6\u09bf\u09a6\u09bf \u09ad\u09be\u09b0\u09a4\u09c7 \u099a\u0987\u09b2\u09be \u09af\u09be\u09a8 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ac\u09c1\u0995\u09be \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09b6\u09c7\u09b7 \u09ac\u09b2\u09c7 \u098f\u0995\u099f\u09be \u09b0\u09be\u09a8 \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09b2\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0986\u09aa\u09a8\u09be\u09b0 \u09ae\u09a4\u09cb \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ac\u09c7\u099c\u09a8\u09cd\u09ae\u09a6\u09c7\u09b0 \u09a6\u09be\u09b2\u09be\u09b2\u09bf \u0995\u09b0\u09a4\u09c7 \u0995\u09c7 \u09ac\u09b2\u09c7\u099b\u09c7 \u0986\u09ac\u09be\u09b2\u099a\u09cb\u09a6\u09be \u09aa\u09be\u09ac\u09b2\u09bf\u0995 \u0986\u09aa\u09a8\u09be\u09b0 \u09ae\u09a4 \u0986\u099b\u09c7 \u098f\u0987\u09a6\u09c7\u09b6\u09c7 \u0985\u09a8\u09c7\u0995 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ad\u09bf\u0996\u09be\u09b0\u09bf\u09b0\u09be \u0995\u09bf\u09b8\u09c7\u09b0 \u0996\u09cb\u099f\u09be \u09a6\u09bf\u09ac\u09c7 \u0993\u09b0\u09be \u09a4\u09cb \u09ad\u09bf\u0996\u09be\u09b0\u09bf\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09a4\u09be \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ad\u09bf\u0996\u09be\u09b0\u09bf\u09b0\u09be \u098f\u0987\u09a6\u09c7\u09b6\u09c7 \u0995\u09be\u099b\u09c7 \u09ad\u09bf\u0995\u09cd\u09b7\u09be \u099a\u09be\u099a\u09cd\u099b\u09c7 \u09a6\u09c1\u0987 \u09aa\u09df\u09b8\u09be \u09a6\u09bf\u09df\u09c7 \u09a6\u09bf\u09b2\u09c7\u0987 \u09a4\u09cb \u09b9\u09df ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0986\u099c \u09ac\u09c1\u099d\u09b2\u09be\u09ae \u0986\u09aa\u09a8\u09bf \u09af\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09ac\u09b0\u09cd\u09a4\u09ae\u09be\u09a8\u09c7 \u09b2\u09c0\u0997 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09a6\u09be\u09b2\u09be\u09b2", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0986\u09ae\u09be\u09b0 \u0986\u09ad\u09bf\u099c\u09cd\u099e\u09a4\u09be \u09ad\u09be\u09b0\u09a4 \u09af\u09a4\u09ac\u09be\u09b0\u0987 \u098f \u09a7\u09b0\u09a8\u09c7\u09b0 \u09ae\u09bf\u09a5\u09cd\u09af\u09be \u09aa\u09cd\u09b0\u099a\u09be\u09b0\u09a8\u09be \u099a\u09be\u09b2\u09be\u09df \u09a4\u09a5 \u09ac\u09be\u09b0\u0987 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u098f\u0995\u099f\u09be \u0995\u09b0\u09c7 \u09a7\u09cb\u09b2\u09be\u0987 \u09a6\u09c7\u09df \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09b8\u09c7\u09a8\u09be\u09a6\u09c7\u09b0 \u0995\u09c7 \u0995\u09df \u09a6\u09bf\u09a8 \u099a\u09c1\u09aa \u09a5\u09c7\u0995\u09c7 \u0986\u09ac\u09be\u09b0 \u0995\u099a\u09cd\u099a\u09aa\u09c7\u09b0 \u09ae\u09a4 \u0995\u09b2\u09cd\u09b2\u09be \u09ac\u09c7\u09b0\u0995\u09b0\u09c7 \u0986\u09ac\u09be\u09b0 \u09ac\u09b2\u09c7 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7 \u0995\u09af\u09c7\u0995 \u09b8\u09c7\u09a8\u09be \u09a8\u09bf\u09b9\u09a4 \u09b9\u09df\u09c7\u099b\u09c7 \u09aa\u09be\u0995 \u099c\u09c7\u09a8\u09be\u09b0\u09c7\u09b2\u09b0\u09be \u098f\u0987 \u09ae\u09bf\u09a5\u09cd\u09af\u09be \u09b8\u0982\u09ac\u09be\u09a6 \u09b6\u09c1\u09a8\u09be\u09b0 \u09aa\u09b0 \u09a4\u09be\u09a6\u09c7\u09b0 \u09ae\u09be\u09a5\u09be \u09b9\u09df\u09c7 \u09af\u09be\u09b0 \u0997\u09b0\u09ae \u09a4\u09be\u09b0\u09be \u0990 \u0995\u099a\u09cd\u099b\u09aa \u0996\u09be\u0993\u09df\u09be \u099c", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0986\u0997\u09c7\u0993 \u09a6\u09c7\u0996\u09c7\u099b\u09bf \u099f\u09bf \u09ac\u09bf\u09b6\u09cd\u09ac\u0995\u09be\u09aa\u09c7 \u09ad\u09be\u09b0\u09a4 \u09ac\u09a8\u09be\u09ae \u0986\u09ab\u0997\u09be\u09a8\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09ae\u09cd\u09af\u09be\u099a\u09c7 \u0986\u09ab\u0997\u09be\u09a8\u09c7\u09b0 \u0989\u0987\u0995\u09c7\u099f \u0995\u09bf\u09aa\u09be\u09b0\u0995\u09c7 \u09a6\u09c7\u0996\u09be\u09a8\u09cb \u09b9\u09df\u09c7\u099b\u09bf\u09b2\u09cb", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09af\u09c7\u0996\u09be\u09a8\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u0995\u09cb\u099f\u09bf \u099c\u09a8\u0997\u09a3 \u09b0\u09be\u09ae\u09aa\u09be\u09b2 \u09ac\u09bf\u09a6\u09cd\u09af\u09c1\u09ce \u0995\u09c7\u09a8\u09cd\u09a6\u09cd\u09b0 \u099a\u09be\u099a\u09cd\u099b\u09c7 \u09b8\u09c7\u0996\u09be\u09a8\u09c7 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u0995\u09cb\u099f\u09bf \u099c\u09a8\u0997\u09a3\u09c7\u09b0 \u0995\u09a5\u09be \u0995\u09bf \u0989\u09a8\u09bf \u09b0\u09be\u0996\u09ac\u09c7\u09a8", + "output": [ + "Geopolitical" + ] + }, + { + "input": " \u09aa\u09c3\u09a5\u09bf\u09ac\u09c0\u09b0 \u09b8\u09ac\u09a5\u09c7\u0995\u09c7 \u09ac\u09be\u099c\u09c7 \u09ac\u09cd\u09af\u09be\u09ac\u09b9\u09be\u09b0 \u098f\u09ac\u0982 \u09b9\u09c3\u0982\u09b8\u09cd\u09af \u0995\u09c1\u0995\u09c1\u09b0 \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09a8 \u09aa\u09cd\u09b2\u09c7\u09df\u09be\u09b0 \u09b0\u09be ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0986\u09ae\u09b0\u09be \u09ac\u09be\u0999\u09cd\u0997\u09be\u09b2\u09c0\u09b0\u09be \u098f\u0995\u099f\u09be \u09b9\u09be\u09a4\u09bf \u0995\u09c7 \u09ac\u0999\u09cd\u0997\u09ac\u09be\u09b9\u09be\u09a6\u09c1\u09b0 \u09ac\u09be\u09a8\u09be\u09a4\u09c7 \u09aa\u09be\u09b0\u09bf \u0985\u09a5\u099a \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09b9\u09be\u099c\u09be\u09b0 \u09b9\u09be\u099c\u09be\u09b0 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09ad\u09be\u0987 \u0995\u09c7 \u09b9\u09a4\u09cd\u09af\u09be \u0995\u09b0\u09be \u09b9\u099a\u09cd\u099b\u09c7 \u098f\u099f\u09be \u09a8\u09bf\u09df\u09c7 \u0986\u09ae\u09be\u09a6\u09c7\u09a4 \u0995\u09cb\u09a8 \u0989\u09a6\u09cd\u09ac\u09c7\u0997 \u09a8\u09c7\u0987 \u09ad\u09be\u09b0\u09a4\u09c7 \u099f\u09cd\u09b0\u09c7\u09a8 \u09a6\u09c1\u09b0\u09cd\u0998\u099f\u09a8\u09be \u09b9\u09df\u09c7\u099b\u09c7 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09aa\u09cd\u09b0\u09a5\u09be\u09a8 \u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0 \u0986\u09aa\u09a8\u09bf \u09b6\u09c1\u0995\u09be\u09b9\u09be\u09a4 \u0995\u0987 \u09ae\u09be\u09df\u09be\u09a8\u09ae\u09be\u09b0\u09c7\u09b0 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u09a8\u09bf\u09df\u09c7 \u09a4\u09cb \u0995\u09cb\u09a8 \u0995\u09a5\u09be \u09ac\u09b2\u09a4\u09c7 \u09a6\u09c7\u0996\u09b2\u09be\u09ae \u09a8\u09be \u0986\u09aa\u09a8\u09be\u0995\u09c7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u0995\u09c7\u09a8 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ae\u09cb\u09b2\u09cd\u09b2\u09be \u09ae\u09bf\u09b8\u0995\u09bf\u09a8\u09a6\u09c7\u09b0 \u0995\u09a5\u09be \u0997\u09c1\u09b2\u09cb \u09b8\u09a4\u09cd\u09af\u09bf \u09a7\u09b0\u09c7 \u09a8\u09bf\u09df\u09c7 \u09ac\u09b2\u099b\u09bf \u09aa\u09b6\u09cd\u099a\u09bf\u09ae \u0986\u09b0 \u09aa\u09c2\u09b0\u09cd\u09ac \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09b9\u09be\u09a8\u0995\u09c7 \u09ad\u09be\u09b0\u09a4 \u0986\u09b2\u09be\u09a6\u09be \u0995\u09b0\u09c7 \u09a6\u09bf\u09df\u09c7 \u09a0\u09bf\u0995 \u0995\u09b0\u09c7\u099b\u09c7 \u098f\u09a4 \u09a8\u09bf\u09ae\u0995\u09b9\u09be\u09b0\u09be\u09ae \u099c\u09be\u09a4 \u098f\u0995\u09b8\u09be\u09a5\u09c7 \u09a5\u09be\u0995\u09b2\u09c7 \u09ac\u09bf\u09aa\u09a6 \u09ac\u09be\u09dc\u09a4 \u099c\u09df \u09b9\u09bf\u09a8\u09cd\u09a6", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c0\u09af\u09bc \u09ae\u09be\u09a6\u09be\u09b0\u099a\u09c1\u09a6\u09b0\u09be \u09ac\u09a1\u09bc \u09ac\u09c7\u09a1\u09bc\u09c7 \u0997\u09c7\u099b\u09c7", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09a0\u09bf\u0995 \u0986\u099b\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0\u09c7 \u09b9\u09cb\u0997\u09be \u09ae\u09be\u0987\u09b0\u09be \u09aa\u09be\u09a8\u09bf\u09a4\u09c7 \u09ab\u09be\u09b2\u09be\u09df \u09a6\u09c7\u0993\u09df\u09be \u0989\u099a\u09bf\u09ce", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u0995\u09be\u09b6\u09cd\u09ae\u09c0\u09b0\u09c7 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09a6\u09c7\u09b0 \u098f\u0995\u099f\u09bf \u09ac\u09b8\u09cd\u09a4\u09bf\u09a4\u09c7 \u0986\u0997\u09c1\u09a8 \u099c\u09a8 \u09a8\u09bf\u09b9\u09a4", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09b0\u09cb\u09b9\u09bf\u0982\u0997\u09be\u09b0 \u099c\u09be\u09a4 \u09b2\u09be\u09a5\u09bf \u09ae\u09be\u09b0\u09c7\u09a8 \u09a4\u09be\u0987 \u09a8\u09be \u09b8\u09be\u09b2\u09c7 \u09ad\u09be\u09b0\u09a4 \u09af\u09a6\u09bf \u0986\u09aa\u09a8\u09be\u09b0 \u09ac\u09be\u09aa \u09a6\u09be\u09a6\u09be\u0995\u09c7 \u09b2\u09be\u09a5\u09bf \u09ae\u09be\u09b0\u09a4 \u09a4\u09be\u09b9\u09b2\u09c7 \u0986\u099c \u0986\u09aa\u09a8\u09bf \u098f\u0987 \u0995\u09ae\u09c7\u09a8\u09cd\u099f \u099f\u09be \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09a4\u09c7\u09a8 \u09a8\u09be \u09ac\u09c1\u099d\u09b2\u09c7\u09a8 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u098f\u0995\u09ac\u09be\u09b0 \u09b6\u09bf\u0995\u09cd\u09b7\u09be \u09a6\u09c7\u0993\u09af\u09bc\u09be\u09b0 \u09a6\u09b0\u0995\u09be\u09b0 \u09b6\u09be\u09b2\u09be\u09b0\u09be \u09b8\u09ac \u09a6\u09c7\u09b6\u09c7\u09b0 \u09b8\u09bf\u09ae\u09be\u09a8\u09cd\u09a4\u09c7 \u0997\u09c1\u09b2\u09bf \u0995\u09b0\u09c7 \u09ae\u09be\u09a8\u09c1\u09b7 \u09ae\u09be\u09b0\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09a4\u09be\u09b0\u09aa\u09b0\u0993 \u09a8\u09b0\u09c7\u09a8\u09cd\u09a6\u09cd\u09b0 \u09ae\u09cb\u09a6\u09c0 \u09ae\u09b9\u09be\u09ad\u09be\u09b0\u09a4\u09c7 \u09b8\u09bf\u0982\u09b9 \u09aa\u09b0\u09c1\u09b7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": " \u098f\u0987 \u09b8\u09ac \u0995\u09a5\u09be \u09ac\u09b2\u09c7 \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be \u09b0 \u0995\u09bf\u099b\u09c1 \u09ac\u09b2\u09a6 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09c7\u09b6\u09c7 \u09aa\u09c1\u09b6 \u0995\u09b0\u09be\u09b0 \u09aa\u09be\u09df\u09a4\u09be\u09b0\u09be \u0995\u09b0\u099b\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u099f\u09be\u09b0\u09cd\u0997\u09c7\u099f \u0987\u0982\u09b2\u09bf\u09b6\u09a6\u09c7\u09b0 \u099c\u09a8\u09cd\u09af\u09c7 \u098f\u09a4\u09cb \u09b8\u09b9\u099c \u09a8\u09df \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ac\u09cb\u09b2\u09be\u09b0\u09a6\u09c7\u09b0 \u09b8\u09be\u09ae\u09a8\u09c7 \u09a6\u09c7\u0996\u09ac\u09c7\u09a8 \u099b\u09b2\u09c7 \u09ac\u09b2\u09c7 \u0995\u09cc\u09b6\u09b2\u09c7 \u098f\u0987 \u09ae\u09cd\u09af\u09be\u099a \u09ad\u09be\u09b0\u09a4\u09c0\u09df\u09b0\u09be \u09a4\u09be\u09a6\u09c7\u09b0 \u09b9\u09be\u09a4\u09c7\u09b0 \u09ae\u09c1\u09a0\u09cb\u09df \u09a8\u09bf\u09df\u09c7 \u0986\u09b8\u09ac\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09aa\u09be\u0995\u09bf \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ac\u09be\u09b2 \u099b\u09bf\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09c7", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09b8\u09c7\u0987 \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09b9\u09be\u09a4\u09bf\u09b0 \u0996\u09ac\u09b0 \u0995\u09bf \u09ac\u09bf\u09ac\u09bf\u09b8\u09bf \u09ac\u09be\u0982\u09b2\u09be ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09ac\u09b0\u09cd\u09b7\u09c7\u09b0 \u09ac\u09bf\u09b6\u09c7\u09b7 \u0995\u09b0\u09c7 \u0987\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09b0 \u0986\u09a6\u09bf \u09ae\u09be\u09a8\u09c1\u09b7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u0986\u09b0\u09cd\u09af\u09b0\u09be \u0986\u09b0 \u098f\u0987 \u0986\u09b0\u09cd\u09af\u09b0\u09be \u0995\u09cb\u09a5\u09be \u09a5\u09c7\u0995\u09c7 \u0987\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09a4\u09c7 \u098f\u09b8\u09c7\u099b\u09c7 \u0987\u09a4\u09bf\u09b9\u09be\u09b8 \u09a6\u09c7\u0996\u09c1\u09a8 \u099c\u09be\u09a8\u09c1\u09a8 \u09ac\u09c1\u099d\u09c1\u09a8 \u0996\u09c1\u09ac \u0986\u09b6\u09cd\u099a\u09b0\u09cd\u09af \u09b9\u09ac\u09c7\u09a8 \u098f\u09ac\u0982 \u09ae\u099c\u09be \u09aa\u09be\u09ac\u09c7\u09a8 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0993 \u0986\u09ae\u09be\u09b0 \u09ac\u09bf\u09ad\u09c7\u0995\u09ac\u09be\u09a8 \u09b0\u09bf\u09aa\u09cb\u09b0\u09cd\u099f\u09be\u09b0 \u09b8\u09be\u0982\u0997\u09be\u09a4\u09bf\u0995 \u09ac\u09be\u0987 \u09a8\u09bf\u0989\u099c \u099f\u09be \u098f\u09ae\u09a8 \u09b9\u09ac\u09c7 \u09ae\u09a8\u09c7 \u09b9\u09df \u0995\u09be\u09b6\u09cd\u09ae\u09c0\u09b0\u09c7\u09b0 \u09b8\u09be\u09a6\u09bf\u09a8\u09a4\u09be \u0995\u09be\u09ae\u09bf\u09a6\u09c7\u09b0 \u09b9\u09be\u09ae\u09b2\u09be\u09df \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u099c\u0993\u09df\u09be\u09a8 \u09a8\u09bf\u09b9\u09a4 \u0986\u09b2\u09cd\u09b2\u09be\u09b9 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09b8\u099f\u09bf\u0995 \u09ac\u09c1\u099c \u09a6\u09be\u09a8 \u0995\u09b0\u09c1\u09a3 \u0986\u09ae\u09bf\u09a8", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09b8\u09ac\u0997\u09c1\u09b2\u09be \u0987\u09b8\u09b2\u09be\u09ae\u09bf \u09a6\u09b2 \u09aa\u09cd\u09b0\u0995\u09be\u09b6\u09cd\u09af\u09c7 \u09aa\u09cd\u09b0\u09a4\u09bf\u09ac\u09be\u09a6 \u0995\u09b0\u09b8\u09c7 \u09b0\u09b8\u09b0\u09be\u099c \u09a8\u09be\u09ae\u0995 \u09ac\u09b2\u09bf\u09b0 \u09aa\u09be\u0981\u09a0\u09be\u09b0 \u09ab\u09be\u0981\u09b8\u09bf\u09b0 \u09a6\u09be\u09ac\u09c0\u09a4\u09c7 \u0986\u09b0 \u098f\u0995 \u09a6\u09c1\u0987\u099f\u09be \u0987\u09b8\u09b2\u09be\u09ae\u09c0 \u09a6\u09b2 \u09af\u09be\u0993 \u09b8\u09ae\u09ac\u09c7\u09a6\u09a8\u09be \u099c\u09be\u09a8\u09be\u0987\u099b\u09c7 \u098f\u0995\u099f\u09be\u0993 \u09b8\u09cd\u09ac\u09c0\u0995\u09be\u09b0 \u0995\u09b0\u09c7 \u09a8\u09be\u09df \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u0995\u09b0\u09b8\u09c7 \u0995\u09df \u09a6\u09c1\u09b7\u09cd\u0995\u09c3\u09a4\u09bf\u0995\u09be\u09b0\u09c0 \u09a6\u09c1\u09b7\u09cd\u0995\u09c3\u09a4\u09bf\u0995\u09be\u09b0\u09c0 \u098f\u0995\u09a6\u09c1\u0987\u099c\u09a8 \u09b9\u09df \u09b9\u09be\u099c\u09be\u09b0 \u09b9\u09be\u099c\u09be\u09b0 \u09a8\u09be \u09b9\u09be\u09ae\u09b2\u09be\u09b0 \u098f\u0995\u099f\u09be \u09ad\u09bf\u09a1\u09bf\u0993 \u09a6\u09c7\u0996\u09b2\u09c7\u0987 \u09ac\u09cb\u099d\u09be \u09af\u09be\u09df \u09ac\u09be\u099a\u09cd\u099a\u09be \u09a5\u09c7\u0995\u09c7 \u09ae\u09c1\u09b0\u09ac\u09cd\u09ac\u09bf \u098f\u0987 \u09b9\u09be\u09ae\u09b2\u09be\u09df \u099c\u09dc\u09bf\u09a4 \u099b\u09bf\u09b2\u09cb \u0990\u09b0\u0995\u09ae \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u09aa\u0995\u09cd\u09b7\u09c7 \u0986\u09a8\u09cd\u09a6\u09cb\u09b2\u09a8 \u09aa\u09b6\u09cd\u099a\u09bf\u09ae \u09ac\u09be\u0982\u09b2\u09be\u09df \u09ae\u09ae\u09a4\u09be \u09ac\u09cd\u09af\u09be\u09a8\u09be\u09b0\u09cd\u099c\u09c0 \u0986\u09b0\u09cb \u09a8\u09be\u0987\u099a\u09cd\u099a\u09be \u09a8\u09be\u0987\u099a\u09cd\u099a\u09be \u0995\u09b0\u09c7 \u0996\u09ac\u09b0 \u09b2\u0987\u09df\u09be \u09a6\u09c7\u0996\u09cb \u09a4\u09be\u0987 \u09b8\u09ac \u09ac\u09cd\u09af\u09be\u09aa\u09be\u09b0\u09c7 \u09a7\u09b0\u09cd\u09ae \u09a8\u09be \u099f\u09be\u0987\u09a8\u09be \u09ae\u09be\u09a8\u09c1\u09b7\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09ad\u09be\u09ac \u09ad\u09be\u09b0\u09a4\u09c7\u0993 \u098f\u09ae\u09a8 \u09a7\u09b0\u09cd\u09ae\u09c0\u09df \u09b8\u0982\u0997\u09a0\u09a8 \u0986\u099b\u09c7 \u09af\u09be\u09b0\u09be \u09b8\u0982\u0996\u09cd\u09af\u09be\u09b2\u0998\u09c1 \u09a8\u09bf\u09b0\u09cd\u09af\u09be\u09a4\u09a8\u09c7\u09b0", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u098f\u0995\u09be\u09a4\u09cd\u09a4\u09b0\u09c7 \u09ad\u09be\u09b0\u09a4 \u0986\u09b6\u09cd\u09b0\u09df \u09a6\u09bf\u09df\u09c7\u099b\u09bf\u09b2\u09cb \u098f\u0996\u09a8 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09ac\u09dc\u09cb \u0985\u0982\u09b6 \u0997\u09be\u09b2\u09bf \u09a6\u09c7\u09df \u09ad\u09be\u09b0\u09a4\u0995\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0986\u09ae\u09bf \u0995\u09bf\u09a8\u09cd\u09a4\u09c3\u09c1 \u09ac\u09be\u0982\u09b2\u09be\u09b0 \u09b8\u09ac \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u09aa\u09be\u0995\u09bf\u09a6\u09c7\u09b0 \u09ac\u09bf\u099b \u09ae\u09a8\u09c7 \u0995\u09b0\u09bf \u09a4\u09be\u0987 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09b0\u09be \u09ad\u09be\u09b0\u09a4 \u099a\u09b2\u09c7 \u09af\u09be\u0993\u09df\u09be \u09aa\u09be\u0995\u09bf \u09ac\u09bf\u099b\u09a6\u09c7\u09b0 \u09ae\u09a8\u09c7 \u09b9\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09b8\u09ac \u099a\u09c7\u09df\u09c7 \u09a8\u09bf\u0995\u09bf\u09b7\u09cd\u099f \u0996\u09be\u09b0\u09be\u09ac \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09bf\u09b0\u09be", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u099a\u09be\u09af\u09bc\u09a8\u09be \u098f\u09a4\u09a6\u09bf\u09a8 \u09ad\u09be\u09b0\u09a4 \u0995\u09c7 \u0995\u09cb\u099f\u09bf \u0995\u09cb\u099f\u09bf \u0997\u09a1 \u09b8\u09be\u09aa\u09cd\u09b2\u09be\u0987 \u09a6\u09bf\u09af\u09bc\u09c7\u099b\u09c7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u0989\u09b0\u09bf\u09b0 \u0998\u099f\u09a8\u09be\u09b0 \u09aa\u09b0 \u098f\u09b0\u09be \u098f\u0996\u09a8 \u09a6\u09c7\u09b6\u09c0 \u0997\u09a1\u09c7\u09b0 \u09a6\u09bf\u0995\u09c7 \u099d\u09c1\u0995\u099b\u09c7 \u0985\u09ac\u09bf\u0995\u09cd\u09b0\u09c0\u09a4 \u09ac\u09bf\u09a6\u09c7\u09b6\u09c0 \u0997\u09a1 \u0997\u09c1\u09b2\u09cb \u098f\u0996\u09a8 \u099a\u09c0\u09a8\u09c7\u09b0 \u09a8\u09af\u09bc \u09ac\u09b0\u0982 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0\u0987 \u09b2\u09cb\u0995\u09b8\u09be\u09a8\u09c7\u09b0 \u0985\u09ad\u09bf\u09b6\u09be\u09aa \u09b9\u09af\u09bc\u09c7 \u09a6\u09be\u0981\u09a1\u09bc\u09be\u09ac\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09c1\u09a6\u09c7\u09b0 \u09aa\u09be\u099b\u09be\u09df \u09ac\u09be\u0981\u09b6 \u09a6\u09be\u0993 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c0\u09af\u09bc \u09b8\u0995\u09b2 \u099a\u09cd\u09af\u09be\u09a8\u09c7\u09b2 \u09ac\u09a8\u09cd\u09a7 \u0995\u09b0\u09be \u09b9\u0989\u0995 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0995\u09be\u0982\u09b2\u09be\u09b0\u09be \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u099c\u09be\u09a4\u09c0\u09df \u09b8\u0999\u09cd\u0997\u09c0\u09a4 \u09a8\u09bf\u09df\u09c7 \u09ac\u09b2\u09be\u09b0 \u0986\u0997\u09c7 \u09ad\u09c7\u09ac\u09c7 \u09a6\u09c7\u0996 \u09a4\u09cb\u09a6\u09c7\u09b0 \u099c\u09be\u09a4\u09c0\u09df \u09b8\u0999\u09cd\u0997\u09c0\u09a4 \u09b8\u09c7\u0987 \u098f\u0995 \u09ae\u09b9\u09be\u09a8 \u0995\u09ac\u09bf\u09b0 \u09b2\u09c7\u0996\u09be \u09a4\u09cb\u09a6\u09c7\u09b0 \u09ae\u09a4 \u0986\u09ac\u09be\u09b2\u09c7\u09b0\u09be \u09a4 \u09b8\u09be\u09b9\u09bf\u09a4\u09cd\u09af\u09c7 \u09a8\u09cb\u09ac\u09c7\u09b2\u09c7\u09b0 \u0995\u09a5\u09be \u0995\u09b2\u09cd\u09aa\u09a8\u09be \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09bf\u09b8 \u09a8\u09be \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09b8\u09c7\u0987 \u0995\u09ac\u09bf \u0995\u09ac\u09c7 \u09b8\u09c7\u0987 \u09b8\u09be\u09b9\u09bf\u09a4\u09cd\u09af\u09c7 \u09a8\u09cb\u09ac\u09c7\u09b2 \u09aa\u09c7\u09df\u09c7\u099b\u09bf\u09b2 \u098f\u09ac\u09be\u09b0 \u09a4\u09cb\u09b0\u09be \u09ac\u09be\u09b2\u09c7\u09b0 \u09ae\u09a4 \u0995\u09a5\u09be \u099b\u09be\u09dc \u098f\u0995\u099f\u09c1 \u09ad\u09a6\u09cd\u09b0 \u09b9 \u09a4\u09be\u09b9\u09b2\u09c7 \u09b8\u09be\u09b0\u09be\u099c\u09c0\u09ac\u09a8 \u09b6\u09c1\u09df\u09be\u09b0 \u09b9\u09df\u09c7 \u09a5\u09be\u0995\u09ac\u09bf ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0993\u0995 \u09a6\u09c7\u0995\u09c7 \u0986\u09ae\u09be\u09b0\u09bf \u09ad\u09df \u0995\u09b0\u09a4\u09c7\u099b\u09c7 \u09a8\u09be \u0986\u09b0 \u09b8\u09c7\u0996\u09be\u09a8\u09c7 \u09aa\u09c3\u09a5\u09bf\u09ac\u09c0\u09b0 \u09b0\u09cd\u09a5 \u09a4\u09ae \u09b6\u0995\u09cd\u09a4\u09bf\u09b6\u09be\u09b2\u09c0 \u09b0\u09be\u09b7\u09cd\u099f\u09cd\u09b0 \u09ad\u09be\u09b0\u09a4 \u09ad\u09df \u09aa\u09be\u09ac\u09bf ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u099a\u09be\u0987\u09b2\u09c7 \u09b8\u09c7\u099f\u09be \u09ac\u09a8\u09cd\u09a7 \u0995\u09b0\u09be\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09c7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09a8\u09be \u0995\u09b0\u09be\u09df \u0989\u099a\u09bf\u09a4 \u0995\u09c1\u0995\u09c1\u09b0\u09c7\u09b0 \u09ae\u09a4 \u09ae\u09be\u09b0 \u09b6\u09be\u09b2\u09be\u09a6\u09c7\u09b0", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u0995\u09c7 \u0989\u099a\u09bf\u09a4 \u09b6\u09bf\u0995\u09cd\u09b7\u09be \u09a6\u09c7\u09df\u09be \u09aa\u09cd\u09b0\u09df\u09cb\u099c\u09a8 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": " \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09a8 \u09b0\u09be \u09ae\u09be\u0995\u09c7 \u09ae\u09be \u09a8\u09be \u09ac\u09b2\u09c7 \u098f\u0995\u099f\u09be \u099c\u09be\u09a8\u09cb\u09df\u09be\u09b0 \u0995\u09c7 \u09ac\u09b2\u09c7 \u09ae\u09be \u09af\u09be\u09b0 \u0995\u09be\u09b0\u09a3\u09c7 \u09b8\u09ac\u09be\u0987 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u099c\u09be\u09a8\u09cb\u09df\u09be\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09ac\u09b2\u09c7\u0987 \u099b\u09bf\u09a8\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09a6\u09be\u09a6\u09be \u09af\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7 \u09b9\u09df\u09c7 \u0985\u09b8\u0996 \u09ae\u09cd\u09af\u09be\u099b \u0996\u09c7\u09b2\u09c7\u099b\u09c7\u09a8 \u09af\u09c7 \u09ad\u09be\u09b0\u09a4\u0995\u09c7 \u0986\u09aa\u09a8\u09bf \u0985\u09a8\u09c7\u0995 \u0995\u09bf\u099b\u09c1 \u09a6\u09bf\u09df\u09c7\u099b\u09c7\u09a8 \u09b8\u09c7 \u09ad\u09be\u09b0\u09a4 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u0986\u09aa\u09a8\u09be\u0995\u09c7 \u098f\u0995\u099f\u09bf \u09ac\u09bf\u09a6\u09be\u09df\u09bf \u09ae\u09cd\u09af\u09be\u099b \u0996\u09c7\u09b2\u09a4\u09c7 \u09a6\u09c7\u09df\u09a8\u09bf \u0986\u09b0 \u09b8\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7 \u09b9\u09df\u09c7 \u0986\u09aa\u09a8\u09bf \u0995\u09bf \u09a6\u09be\u09b2\u09be\u09b2\u09bf \u0995\u09b0\u09c7\u09a8 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u0986\u09aa\u09a8\u09be \u0985\u09a8\u09c7\u0995 \u09ad\u0995\u09cd\u09a4 \u0986\u099b\u09c7 \u0995\u09be\u09b0\u09a8 \u0986\u09aa\u09a8\u09bf \u098f\u0995 \u099c\u09a8 \u09ac\u09be\u0999\u09cd\u0997\u09be\u09b2\u09bf \u09af\u09c7 \u09a6\u09c7\u09b6\u09c7 \u09b6\u099a\u09bf\u09a8\u09c7\u09b0 \u09ac\u09bf\u09a6\u09be\u09df \u09b9\u09df \u09b8\u09c7 \u09a6\u09c7\u09b6\u09c7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u099c\u09b9\u09bf\u09b0 \u0996\u09be\u09a8\u09c7\u09b0 \u09b0\u09be\u09b9\u09c1\u09b2\u09c7\u09b0 \u09b6\u09c7\u09ac\u09be\u0997\u09c7\u09b0 \u09af\u09c1\u09ac\u09b0\u09be\u099c\u09c7\u09b0 \u09ac\u09bf\u09a6\u09be\u09df\u09bf \u09ae\u09cd\u09af\u09be\u099b \u09b9\u09df\u09a8\u09be \u0986\u09ae\u09be\u09b0 \u09a4\u09cb \u09ae\u09a8\u09c7\u09b9\u09a8\u09be \u09af\u09c7 \u0986\u09aa\u09a8\u09be \u09aa\u09bf\u09a4 \u0986\u099b\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c0\u09af\u09bc \u09ac\u09bf\u098f\u09b8\u098f\u09ab \u09b8\u09be\u09b2\u09c7 \u099c\u09a8 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c0\u0995\u09c7 \u09b9\u09a4\u09cd\u09af\u09be \u0995\u09b0\u09c7 \u09b8\u09be\u09b2\u09c7 \u099c\u09a8 \u09b8\u09be\u09b2\u09c7 \u099c\u09a8 \u09b8\u09be\u09b2\u09c7 \u099c\u09a8 \u09b8\u09be\u09b2\u09c7 \u099c\u09a8 \u09b8\u09be\u09b2\u09c7 \u099c\u09a8 \u09b8\u09be\u09b2\u09c7 \u099c\u09a8 \u09b8\u09be\u09b2\u09c7 \u099c\u09a8 \u09b8\u09be\u09b2\u09c7 \u09aa\u09be\u0993\u09af\u09bc\u09be \u09af\u09be\u09af\u09bc\u09a8\u09bf \u09b8\u09be\u09b2\u09c7 \u099c\u09a8 \u09b8\u09be\u09b2\u09c7 \u099c\u09a8 \u09b8\u09be\u09b2\u09c7 \u099c\u09a8 \u09b8\u09be\u09b2\u09c7 \u099c\u09a8 \u09b8\u09be\u09b2\u09c7 \u099c\u09a8 \u09b8\u09be\u09b2\u09c7 \u099c\u09a8 \u09b8\u09be\u09b2\u09c7 \u099c\u09a8 \u09b8\u09be\u09b2\u09c7 \u099c\u09a8 \u09b8\u09be\u09b2\u09c7 \u099c\u09a8 \u09b8\u09be\u09b2\u09c7 \u099c\u09a8 \u09b8\u09be\u09b2\u09c7 \u099c\u09a8 \u09b8\u09be\u09b2\u09c7 \u099a\u09b2\u09ae\u09be\u09a8 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u098f\u0987 \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09ad\u09bf\u0996\u09c7\u09b0\u09c0 \u09b6\u09be\u09b2\u09be \u0997\u09cb \u0995\u09bf \u09a8\u09bf\u099c\u09c7\u09a6\u09c7\u09b0 \u0995\u09cb\u09a8 \u09aa\u09c7\u0987\u099c \u09a8\u09be\u0987 \u09b6\u09be\u09b2\u09be\u09b0\u09be \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09aa\u09c7\u0987\u099c\u09c7 \u09a2\u09c1\u0995\u09c7 \u0998\u09c7\u0989 \u0998\u09c7\u0989 \u0995\u09b0\u09c7 \u0995\u09c7\u09a8 \u09a4\u09be\u0987\u09b2\u09c7\u0987 \u09ac\u09cb\u099d \u09a4\u09cb\u09a6\u09c7\u09b0 \u09ad\u09be\u09b0\u09a4 \u09ae\u09be\u09a4\u09be \u09a4\u09cb\u09a6\u09c7\u09b0 \u09ac\u09be\u0999\u09be\u09b2\u09c0\u09a6\u09c7\u09b0 \u099c\u09a8\u09cd\u09af\u09c7 \u099f\u09be \u09ab\u09c7\u0987\u09b8\u09ac\u09c1\u0995 \u09aa\u09c7\u0987\u099c \u09aa\u09b0\u09cd\u09af\u09a8\u09cd\u09a4 \u0995\u09b0\u09c7\u09a8\u09bf \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09c7\u09b6\u09c7\u09b0 \u09aa\u09c7\u0987\u099c\u09c7 \u098f\u09b8\u09c7 \u0997\u09b0\u09c1\u09b0 \u09ae\u09c1\u09a4 \u0996\u09c7\u09df\u09c7 \u0997\u09a8\u09cd\u09a7 \u099b\u09dc\u09be\u099a\u09cd\u099b\u09bf\u09b8", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b8\u09c8\u09a8\u09cd\u09af\u0995\u09c7 \u09ae\u09c7\u09b0\u09c7 \u0989\u09aa\u09af\u09c1\u0995\u09cd\u09a4 \u099c\u09ac\u09be\u09ac \u09a6\u09be\u0993 \u098f\u0995\u099f\u09be\u09b0 \u09ac\u09a6\u09b2\u09c7 \u098f\u0995\u09b6\u099f\u09be\u0995\u09c7 \u09ae\u09c7\u09b0\u09c7 \u09ab\u09c7\u09b2\u09c7 \u099a\u09bf\u09a4\u09be\u09df \u099c\u09cd\u09ac\u09b2\u09bf\u09df\u09c7 \u09a6\u09be\u0993 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ac\u09bf\u099a\u09bf\u09a4\u09cd\u09b0 \u098f\u0995 \u09a6\u09c7\u09b6 \u09ad\u09be\u09b0\u09a4 \u0995\u09c7\u0989 \u099a\u09aa\u09cd\u09aa\u09b2 \u09b8\u09c7\u09b2\u09be\u0987 \u0995\u09b0\u09c7 \u09aa\u09b0\u09c7 \u0986\u09ac\u09be\u09b0 \u0995\u09c7\u0989 \u09b8\u09cb\u09a8\u09be\u09b0 \u09aa\u09be\u099e\u09cd\u099c\u09be\u09ac\u09c0 \u0997\u09be\u09df\u09c7 \u09a6\u09c7\u09df ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u09ae\u09c1\u09b2\u09a4 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u0995\u09bf \u09b9\u09b2 \u098f\u099f\u09be \u09a6\u09c7\u0996\u09ac\u09c7\u09a8\u09be \u0993\u09b0\u09be \u09a6\u09c7\u0996\u09ac\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b8\u09cd\u09ac\u09be\u09b0\u09cd\u09a5 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0987\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09a8 \u098f\u0995 \u098f\u0995 \u09b0\u09be\u099c\u09cd\u09af\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09a4\u09c1\u09b2\u09a8\u09be \u0995\u09b0 \u09a6\u09c7\u0996\u09ac\u09bf \u0995\u09c7 \u09ac\u09c7\u09b6\u09bf \u098f\u0997\u09bf\u09df\u09c7 \u09ab\u09be\u09b2\u09a4\u09c1 \u0995\u09cb\u09a5\u09be\u0995\u09be\u09b0", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0997\u09c1\u09ae \u0996\u09c1\u09a8\u09c7\u09b0 \u0997\u09cb\u09aa\u09be\u09b2\u09bf \u09ac\u09be\u09aa\u09c7\u09b0 \u09ac\u09be\u09a1\u09bc\u09c0 \u09ad\u09be\u09b0\u09a4", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be \u0995\u09c7 \u09a8\u09bf\u09b6\u09cd\u099a\u09bf\u09b9\u09cd\u09a8 \u0995\u09b0\u09c7 \u09a6\u09c7", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u09b6\u09be\u09b2\u09be \u098f\u0995\u099f\u09be \u09ac\u09dc \u09ac\u09c7\u09df\u09be\u09a6\u09aa \u09af\u09c7 \u0986\u0999\u09cd\u0997\u09c1\u09b2 \u09a6\u09bf\u09df\u09c7 \u09b2\u09bf\u0996\u09c7\u099b \u09b8\u09c7\u099f\u09be \u0993 \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be \u0993 \u09ae\u09be\u09b2\u09c1\u09b0 \u09ad\u09be\u09b7\u09be \u09a4\u09c1\u0987 \u0995\u09be\u09a1\u09be\u0987\u09b2\u09cd\u09b2\u09be \u09a4\u09cb\u09b0 \u09ac\u09be\u09ac\u09be\u09b0 \u09a6\u09c7\u09b6 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7 \u09af\u09be ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "1971 \u09b0\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u0989\u099a\u0995\u09be\u09a8\u09bf\u09b0 \u09ae\u09a7\u09cd\u09af\u09ae\u09c7 \u0986\u09ae\u09b0\u09be \u09ad\u09be\u0987 \u09ad\u09be\u0987 \u09af\u09c1\u09a6\u09cd\u09a7\u09c7 \u09b2\u09bf\u09aa\u09cd\u09a4 \u09b9\u09b2\u09be\u09ae", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u098f\u0995\u099f\u09bf \u09b8\u09a8\u09cd\u09a4\u09cd\u09b0\u09be\u09b8\u09c0 \u09a4\u09c8\u09df\u09be\u09b0\u09bf \u0995\u09b0\u09be \u098f\u09ac\u0982 \u09b0\u09ab\u09a4\u09be\u09a8\u09bf \u0995\u09b0\u09be \u09a6\u09c7\u09b6 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ae\u09be\u09b0 \u099c\u0988\u09bf\u09a6\u09c7\u09b0 \u09a8\u09bf\u099c\u09c7\u09b0 \u09ac\u09be\u09ac\u09be \u09ae\u09be\u09b0\u09be \u09af\u09be\u0993\u09df\u09be\u09b0 \u09aa\u09b0 \u0986\u09b8\u09c7\u09a8\u09bf \u09ad\u09be\u09b0\u09a4 \u09b8\u09be\u09b2\u09be \u09b8\u09c1\u09df\u09be\u09b0", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09be\u09df\u09be\u0993\u09a8 \u098f\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09be \u09b9\u09b2\u09cb \u09b8\u09c1\u09ac\u09bf\u09a7\u09be-\u09aa\u09be\u099f\u09bf \u09a4\u09be\u09b0\u09be \u09b6\u09c1\u09a7\u09c1\u09ae\u09be\u09a4\u09cd\u09b0 \u09a8\u09bf\u099c\u09c7\u09a6\u09c7\u09b0 \u09b8\u09c1\u09ac\u09bf\u09a7\u09be\u09b0\u09a5\u09c7\u09df \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u0995\u09c7 \u09af\u09c1\u09a6\u09cd\u09a7\u09c7 \u09b8\u09be\u09b9\u09be\u09af\u09cd\u09af \u0995\u09b0\u09c7\u099b\u09c7", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09b8\u09be\u09b2\u09c7\u09b0 \u0987 \u0986\u0997\u09b8\u09cd\u099f\u09c7\u09b0 \u0986\u0997\u09c7 \u0986\u0997\u09c7 \u09ad\u09be\u09b0\u09a4 \u09ac\u09b2\u09c7 \u09a6\u09c7\u09b6 \u0986\u09ac\u09be\u09b0 \u0995\u09cb\u09a4\u09cd\u09a5\u09c7\u0995\u09c7 \u098f\u09b2\u09cb \u09a4\u09be\u09b0 \u0986\u0997\u09c7 \u09a4\u09cb \u099b\u09bf\u09b2\u09cb \u09ac\u09cd\u09b0\u09bf\u099f\u09bf\u09b6 \u0989\u09aa\u09a8\u09bf\u09ac\u09c7\u09b6 \u09b8\u09c7\u0987 \u09ac\u09cd\u09b0\u09bf\u099f\u09bf\u09b6 \u0989\u09aa\u09a8\u09bf\u09ac\u09c7\u09b6\u099f\u09be\u0987 \u09af\u09a6\u09bf \u09ad\u09be\u09b0\u09a4 \u09b9\u09df\u09c7 \u09a5\u09be\u0995\u09c7 \u09a4\u09be\u09b9\u09b2\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u099c\u09be\u09a4\u09bf\u09b0 \u09aa\u09bf\u09a4\u09be \u09b9\u099a\u09cd\u099b\u09c7 \u099a\u09be\u09b0\u09cd\u09b2\u09b8 \u0995\u09cd\u09af\u09be\u09a8\u09bf\u0982 \u09aa\u09cd\u09b0\u09a5\u09ae \u09ad\u09be\u0987\u09b8\u09c7\u09b0\u09df \u0986\u09b0 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u099c\u09be\u09a4\u09bf\u09b0 \u09ae\u09be\u09a4\u09be \u09b9\u099a\u09cd\u099b\u09c7 \u09ae\u09b9\u09be\u09b0\u09be\u09a8\u09c0 \u09ad\u09bf\u0995\u09cd\u099f\u09cb\u09b0\u09bf\u09df\u09be \u09aa\u09cd\u09b0\u09a5\u09ae \u09ae\u09c1\u0995\u09c1\u099f\u09a7\u09be\u09b0\u09c0 \u09b8\u09ae\u09cd\u09b0\u09be\u099c\u09cd\u099e\u09c0 \u0995\u09bf \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09a8\u09a4\u09c1\u09a8 \u099c\u09be\u09a4\u09bf\u09b0 \u09aa\u09bf\u09a4\u09be \u0993 \u09ae\u09be\u09a4\u09be\u0995\u09c7 \u09ae\u09c7\u09a8\u09c7 \u09a8\u09bf\u09a4\u09c7 \u09b0\u09be\u099c\u09bf \u0986\u099b\u09c7 \u09a4\u09cb \u09aa\u09b6\u09cd\u099a\u09bf\u09ae\u09ac\u0999\u09cd\u0997\u09c0\u09df \u09b6\u09b0\u09a3\u09be\u09b0\u09cd\u09a5\u09c0\u09b0\u09be ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09a4\u09c1\u09ae\u09bf \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09a8\u09be\u0995\u09bf \u09ad\u09be\u0987 \u098f\u09a6\u09c7\u09b0 \u09ae\u09a4\u09c1 \u09b2\u09cb\u099a\u09cd\u099a\u09be \u0986\u09b0 \u0995\u09cb\u09a8\u09c1 \u09a6\u09c7\u09b6 \u09a8\u09be\u0987 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b6\u09be\u09b2\u09be\u09b0\u09be\u09b0\u09c7 \u0995\u09c1\u0995\u09c1\u09b0\u09c7 \u09ae\u09a4\u09a8 \u09ae\u09be\u09b0", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09af\u0996\u09a8 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u0998\u09a1\u09bc \u09ac\u09be\u09a1\u09bc\u09bf\u09a4\u09c7 \u09b9\u09be\u09ae\u09b2\u09be \u099a\u09be\u09b2\u09be\u09a8\u09cb\u09a4\u09c7 \u09ad\u09be\u09b0\u09a4 \u09b8\u09b0\u0995\u09be\u09b0 \u09a4\u09c0\u09ac\u09cd\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf\u09ac\u09be\u09a6 \u099c\u09be\u09a8\u09be\u09af\u09bc \u0986\u09b0 \u09ad\u09be\u09b0\u09a4\u09c7 \u099c\u0996\u09a8 \u09ac\u09bf\u09a8\u09be \u0985\u09aa\u09b0\u09be\u09a7\u09c7 \u09aa\u09cd\u09b0\u0995\u09be\u09b6\u09cd\u09af\u09c7 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09a6\u09c7\u09b0 \u09b9\u09a4\u09cd\u09af\u09be \u0995\u09b0\u09c7 \u09a4\u0996\u09a8 \u09ad\u09be\u09b0\u09a4\u09c0\u09af\u09bc \u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0 \u09ae\u09b9\u09be\u09a6\u09af\u09bc \u0997\u09a8 \u09a4\u0996\u09a8 \u0986\u09b0 \u09ae\u09be\u09a8\u09ac\u09a4\u09be\u09b0 \u09ac\u09be\u09a8\u09c0 \u09b8\u09c1\u09a8\u09be\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 \u09a8\u09be", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0986\u09b0\u0993 \u0995\u09a4 \u0995\u09bf\u099b\u09c1 \u0995\u09b0\u09ac\u09c7 \u099c\u09be\u09a4\u09bf \u09a8\u09c0\u09b0\u09ac \u09a6\u09b0\u09cd\u09b6\u0995 \u09b8\u09c0\u09ae\u09be\u09a8\u09cd\u09a4\u09c7 \u09ae\u09c3\u09a4\u09cd\u09af\u09c1\u09a6\u09c2\u09a4 \u0989\u09aa\u09b8\u09cd\u09a5\u09bf\u09a4 \u09b9\u099a\u09cd\u099b\u09c7 \u09aa\u09cd\u09b0\u09a4\u09bf\u09a8\u09bf\u09df\u09a4 \u09a6\u09c7\u09b6\u09c7\u09b0 \u099c\u09a8\u0997\u09a3\u09c7\u09b0 \u0988\u09ae\u09be\u09a8\u09c0 \u099a\u09be\u09b9\u09bf\u09a6\u09be \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09b8\u09ae\u09cd\u09aa\u09b0\u09cd\u0995 \u09ac\u099c\u09be\u09df \u09a5\u09be\u0995\u09c1\u0995 \u0993\u09b8\u09ac\u09c7\u09b0 \u09a7\u09be\u09b0\u09c7 \u0995\u09be\u099b\u09c7\u0993 \u09a8\u09c7\u0987 \u09ac\u09b0\u09cd\u09a4\u09ae\u09be\u09a8 \u09b8\u09b0\u0995\u09be\u09b0 \u09ad\u09be\u09b0\u09a4 \u09aa\u09cd\u09b0\u09c7\u09ae\u09c7 \u09b9\u09be\u09ac\u09c1\u09a1\u09c1\u09ac\u09c1 \u0996\u09c7\u09a4\u09c7 \u0996\u09c7\u09a4\u09c7 \u09ae\u09c7\u09df\u09be\u09a6 \u09b6\u09c7\u09b7 \u09b9\u09df\u09c7 \u09af\u09be\u09ac\u09c7", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09b2\u09bf\u099f\u09a8 \u098f\u09b2\u09b8\u09bf \u09a4\u09cb\u09b0 \u0995\u09be\u099b\u09c7 \u098f\u0995\u099f\u09bf \u09ac\u09bf\u09b7\u09df \u099c\u09be\u09a8\u09be\u09b0 \u099b\u09bf\u09b2\u09cb \u0995\u09c7\u09a8\u09a8\u09be \u09a4\u09c1\u0987 \u09ac\u09bf\u09b6\u09be\u09b2 \u0987\u09a4\u09bf\u09b9\u09be\u09b8\u09ac\u09c0\u09a6 \u09ac\u09b2\u099b\u09bf \u09ad\u09be\u09b0\u09a4 \u09ae\u09b9\u09be\u09a6\u09c7\u09b6 \u0995\u09be\u09a6\u09c7\u09b0 \u0997\u09be\u09a6\u09cd\u09a6\u09be\u09b0\u09c0\u09b0 \u099c\u09a8\u09cd\u09af \u09ac\u09cd\u09b0\u09bf\u099f\u09bf\u09b6\u09a6\u09c7\u09b0 \u09ac\u099b\u09b0\u09c7\u09b0 \u0997\u09cb\u09b2\u09be\u09ae\u09c0\u09b0 \u09b6\u09bf\u0995\u09b2\u09c7 \u09ac\u09be\u09a7\u09be \u09aa\u09dc\u09c7\u099b\u09bf\u09b2\u09cb \u09a6\u09df\u09be\u0995\u09b0\u09c7 \u09ac\u09b2\u09ac\u09c7\u09a8 \u0995\u09bf \u0986\u09aa\u09a8\u09bf \u09ae\u09bf\u09b0 \u099c\u09be\u09ab\u09b0 \u0998\u09b8\u09c7\u099f\u09bf \u09ac\u09c7\u0997\u09ae\u09a6\u09c7\u09b0 \u09a8\u09be\u09ae \u09ac\u09b2\u09b2\u09c7\u09a8\u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u099c\u0997\u09a4\u09b6\u09c7\u09a0 \u098f\u09b0 \u09a8\u09be\u09ae\u099f\u09be \u09ac\u09c7\u09ae\u09be\u09b2\u09c1\u09ae \u09ad\u09c1\u09b2\u09c7 \u0997\u09c7\u09b2\u09c7\u09a8 \u0995\u09c7\u09a8\u09cb \u09b8\u09c7 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u099b\u09bf\u09b2\u09cb \u09ac\u09b2\u09c7 \u09ae\u09c1\u09b8\u09b2\u09c0\u09ae\u09b0\u09be \u09b8\u09a8\u09cd\u09a4\u09cd\u09b0\u09be\u09b8\u09c0 \u0995\u09be\u099c \u0995\u09b0\u09a4\u09c7 \u09ac\u09be\u09a7\u09cd\u09af \u0995\u09b0\u09b2\u09cb \u0995\u09be\u09b0\u09be\u0995\u09be\u09b0\u09a8 \u09a6\u09b6\u0995\u09c7\u09b0 \u0986\u0997\u09c7\u0993 \u0986\u09ae\u09b0\u09be \u098f\u09ae\u09a8 \u09ac\u09bf\u09b6\u09cd\u09ac \u09ac\u09cd\u09af\u09be\u09ac\u09b8\u09cd\u09b9\u09be\u09b0 \u09b8\u09be\u09a5\u09c7 \u09aa\u09b0\u09bf\u099a\u09bf\u09a4 \u099b\u09bf\u09b2\u09be\u09ae \u09a8\u09be \u0987\u09a4\u09bf\u09b9\u09be\u09b8 \u09af\u09a6\u09bf \u09ac\u09b2\u09a4\u09c7\u0987 \u09b9\u09df \u09a4\u09be\u09b9\u09b2\u09c7 \u0986\u0997\u09c7 \u09a4\u09cb\u0995\u09c7 \u09a8\u09bf\u09b0\u09aa\u09c7\u0995\u09cd\u09b7 \u09b9\u09a4\u09c7 \u09b9\u09ac\u09c7\u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u0986\u09ab\u09b8\u09cb\u09b8 \u09a4\u09c1\u0987 \u09ad\u09a6\u09cd\u09b0 \u09ae\u09c1\u0996\u09b6\u09c7\u09b0 \u0986\u09dc\u09be\u09b2\u09c7 \u098f\u0995\u099c\u09a8 \u099c\u0998\u09a8\u09cd\u09af \u09ae\u09cc\u09b2\u09ac\u09be\u09a6\u09c0 \u0986\u09b0\u098f", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u098f \u09af\u0996\u09a8 \u0995\u09cb\u099f\u09bf \u0995\u09cb\u099f\u09bf \u09ac\u09be\u0999\u09be\u09b2\u09bf \u099c\u09c0\u09ac\u09a8 \u09ac\u09be\u0981\u099a\u09be\u09a4\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7 \u0986\u09b6\u09cd\u09b0\u09df \u09a8\u09bf\u099a\u09cd\u099b\u09bf\u09b2 \u09a4\u0996\u09a8 \u09ad\u09be\u09b0\u09a4 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09b8\u09c0\u09ae\u09be\u09a8\u09cd\u09a4 \u0996\u09c1\u09b2\u09c7 \u09a6\u09bf\u09df\u09c7\u099b\u09bf\u09b2 \u09aa\u09c1\u09b6 \u09ac\u09cd\u09af\u09be\u0995 \u09a4\u09a5\u09be \u09b2\u09be\u09a5\u09bf \u09ae\u09c7\u09b0\u09c7 \u09b8\u09c0\u09ae\u09be\u09a8\u09cd\u09a4 \u09a5\u09c7\u0995\u09c7 \u09a4\u09be\u09dc\u09bf\u09df\u09c7 \u09a6\u09c7\u09df \u09a8\u09bf \u09af\u09a6\u09bf\u0993 \u0993\u0987 \u0986\u09b6\u09cd\u09b0\u09df \u09a6\u09c7\u09df\u09be\u09b0 \u09aa\u09c7\u099b\u09a8\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u0995\u09bf\u099b\u09c1\u099f\u09be \u09b0\u09be\u099c\u09a8\u09c8\u09a4\u09bf\u0995 \u09b8\u09cd\u09ac\u09be\u09b0\u09cd\u09a5 \u099b\u09bf\u09b2 \u09a4\u09ac\u09c1 \u0993 \u0995\u09cb\u099f\u09bf \u0995\u09cb\u099f\u09bf \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u09ac\u09be\u0999\u09be\u09b2\u09bf\u09b0 \u099c\u09c0\u09ac\u09a8 \u09b8\u09c7\u09ac\u09be\u09b0 \u09b0\u0995\u09cd\u09b7\u09be \u09aa\u09c7\u09df\u09c7\u099b\u09bf\u09b2 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u0989\u09a6\u09be\u09b0\u09a4\u09be\u09df \u0985\u09a5\u099a \u0986\u099c \u098f\u0995\u0987 \u09aa\u09b0\u09bf\u09b8\u09cd\u09a5\u09bf\u09a4\u09bf\u09a4\u09c7 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09a6\u09c7\u09b0\u0995\u09c7 \u0986\u09b6\u09cd\u09b0\u09df \u09a8\u09be \u09a6\u09bf\u09df\u09c7 \u09ac\u09b0\u0982 \u09b8\u09c0\u09ae\u09be\u09a8\u09cd\u09a4 \u09ac\u09a8\u09cd\u09a7 \u0995\u09b0\u09c7 \u09ac\u09b8\u09c7 \u0986\u099b\u09c7 \u098f\u0987 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u09b9\u09df\u09c7\u0993 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09c7\u09b0 \u09ae\u09c3\u09a4\u09cd\u09af\u09c1 \u09b8\u09ae\u09cd\u09ad\u09cd\u09b0\u09ae \u0986\u09b0 \u09aa\u09b0\u09be\u099c\u09df \u098f\u0987 \u09ac\u09c7\u0988\u09ae\u09be\u09a8 \u099c\u09be\u09a4\u09bf\u09b0 \u0995\u09be\u099b\u09c7 \u09a4\u09c1\u099a\u09cd\u099b \u0986\u099a\u09cd\u099b\u09be \u09a7\u09b0\u09cd\u09ae\u09c0\u09df \u09aa\u09b0\u09bf\u099a\u09df \u09a8\u09be \u09b9\u09df \u0985\u09aa\u09b8\u09c3\u09a4 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09ae\u09be\u09a8\u09c1\u09b7 \u09ad\u09be\u09b2\u09cb \u09a8\u09af\u09bc ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7 \u0997\u09bf\u09df\u09c7\u0993 \u09b6\u09c7\u09b7 \u09b0\u0995\u09cd\u09b7\u09be \u09b9\u09b2\u09a8\u09be \u0995\u09bf \u0986\u09b0 \u0995\u09b0\u09ac\u09c7\u09a8 \u09ad\u09be\u0987", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ae\u09a4 \u098f\u0995\u099f\u09bf \u09a6\u09c7\u09b6\u09c7\u09b0 \u09aa\u09cd\u09b0\u09a7\u09be\u09a8 \u0995\u09bf\u09ad\u09be\u09ac\u09c7 \u098f\u09ae\u09a8 \u09a8\u09be\u099f\u0995 \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u0995\u09df\u099f\u09bf \u099a\u09bf\u09a4\u09be\u09df \u0997\u09c7\u099b\u09c7 \u09b8\u09c7\u0987 \u09a8\u09bf\u0989\u099c \u0995\u09cb\u09a5\u09be\u09df ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u09ac\u09be\u09b2 \u09aa\u09be\u09b2\u09be\u09df\u0997\u09be \u09ae\u09be\u09b0 \u0995\u09be\u09aa\u09c7\u09b0\u0995\u09cb", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u098f\u0995\u099f\u09be \u09ac\u09be\u09b8\u09cd\u099f\u09be\u09b0\u09cd\u09a1 \u098f\u09b0 \u09a6\u09c7\u09b6 \u098f\u0987\u09a1\u09b8 \u09a8\u0982 \u09ac\u09be\u09b8\u09cd\u099f\u09be\u09b0\u09cd\u09a1 \u09af\u09be\u09a6\u09c7\u09b0 \u09b0\u09c7\u09aa \u09b9\u09b2 \u09aa\u09cd\u09b0\u09a7\u09be\u09a8 \u099c\u09be\u09a4\u09bf\u09df \u0995\u09be\u099c \u09a4\u09be\u0987 \u09a4\u09be\u09b0\u09be \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u0987", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u098f\u09b0 \u09b9\u09be\u09a4\u09bf\u09b0 \u0995\u09a4 \u09b8\u09ae\u09cd\u09ae\u09be\u09a8 \u0986\u0997\u09c7\u0987 \u09a4\u09cb \u09a6\u09c7\u0996\u09c7\u099b\u09bf \u098f\u0987 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u098f \u0986\u09b0 \u0986\u099c \u09b8\u09c7\u0987 \u09ad\u09be\u09b0\u09a4 \u099f\u09cd\u09b0\u09c7\u09a8 \u098f\u0995\u09cd\u09b8\u09bf\u09a1\u09c7\u09a8\u09cd\u099f \u0995\u09b0\u099b\u09c7 \u0986 \u09b9\u09be \u09b0\u09c7 \u0986\u099c \u09a5\u09c7\u0995\u09c7 \u09a6\u09b6 \u09a6\u09bf\u09a8 \u09a8\u09be \u0996\u09c7\u09df\u09c7 \u09a5\u09c7\u0995\u09c7 \u09b6\u09cb\u0995 \u09aa\u09cd\u09b0\u09c7\u09b0\u09c7\u0995\u09be\u09b6 \u0995\u09b0\u09a4\u09c7 \u09b9\u09ac\u09c7 \u0986\u09b0 \u09ae\u09be\u09df\u09be\u09a8\u09ae\u09be\u09b0 \u098f \u09a4\u09cb \u098f\u0997\u09c1\u09b2\u09cb \u0995\u09bf \u09ae\u09be\u09a8\u09c1\u09b7 \u0993\u09b0\u09be \u09a4\u09cb \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u0993\u09a6\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09b0\u09be \u09b6\u09cb\u0995 \u09aa\u09cd\u09b0\u0995\u09be\u09b6 \u0995\u09b0\u09ac\u09c7", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u09ae\u09cb\u09a6\u09c7\u09b0 \u09ac\u09be\u0981\u09b6\u09ad\u09be\u0987 \u09a6\u09be\u09a6\u09be\u09b0\u09be \u0986\u09b8\u09be\u09b0\u09a6\u09b0\u0995\u09be\u09b0 \u09a8\u09be\u0987 \u0993 \u0986\u09b6\u09be\u09ae\u09be\u09a8\u09c7 \u09af\u09c7\u0995\u09cb\u09a8\u09ad\u09be\u09ac\u09c7 \u09ac\u09be\u0982\u09a6\u09c7\u09b6\u09c7\u09b0\u0995\u09c7 \u09ac\u09be\u09b6\u09a6\u09bf\u09df\u09c7\u099c\u09be\u09ac\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u0995\u09cb\u09a8\u09cb \u099a\u09c1\u0995\u09cd\u09a4\u09bf \u09a8\u09be \u0995\u09b0\u09be\u0987 \u09ad\u09be\u09b2\u09cb \u09b2\u09b8 \u09b9\u09ac\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09b0\u09be\u099c\u09a8\u09c0\u09a4\u09bf\u09a4\u09c7\u0995\u09c2\u099f\u09a8\u09c0\u09a4\u09bf \u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09c7 \u09a8\u09be ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0986\u09ae\u09bf \u09b6\u09c1\u09a7\u09c1 \u09ac\u09b2\u09ac\u09cb \u0993\u09b0\u09be (\u09ad\u09be\u09b0\u09a4) \u09b9\u09be\u09b0\u09be\u09ae\u09bf\u09b0 \u09a5\u09c7\u0995\u09c7\u0993 \u09b9\u09be\u09b0\u09be\u09ae\u09bf ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0986\u09ae\u09b0\u09be \u099a\u09be\u0987\u09a8\u09be \u09ad\u09be\u09b0\u09a4 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u0995\u09bf\u099a\u09c1\u09a8\u09bf\u09df\u09c7 \u09a8\u09be\u0995\u0997\u09b2\u09be\u0995", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09c7\u09b6\u09c7\u09b0 \u0995\u09bf\u099b\u09c1 \u09a8\u09c7\u09a4\u09be \u0986\u099b\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09a4\u09c1\u09b2\u09a8\u09be \u0995\u09b0\u09c7 \u09af\u09a6\u09bf \u09b8\u09c7\u099f\u09be \u09a4\u09be\u09b0 \u09aa\u0995\u09cd\u09b7\u09c7 \u09b9\u09df \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09ac\u09be\u0982\u09b2\u09be\u09b0 \u0987\u09a4\u09bf\u09b9\u09be\u09b8\u09c7 \u098f\u09ae\u09a8 \u0989\u09a6\u09be\u09b9\u09b0\u09a3 \u0986\u099b\u09c7 \u0995\u09bf \u09a5\u09be\u0995\u09b2\u09c7 \u09a6\u09c7\u0996\u09be\u0993 \u09af\u09be\u09b0\u09be \u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0 \u099b\u09bf\u09b2 \u0985\u09a5\u09ac\u09be \u098f\u09ae \u09aa\u09bf \u099b\u09bf\u09b2", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ae\u09be\u09df\u09a8 \u09ae\u09be\u09b0\u09c7\u09b0 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u0995\u09cb\u09a8 \u0996\u09ac\u09b0 \u09a8\u09be\u0987 \u09ad\u09be\u09b0\u09a4 \u09a8\u09bf\u09df\u09c7 \u09ae\u09c7\u09a4\u09c7 \u0986\u099b \u09a8\u09be \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09a4\u09be\u0995\u09a4\u09c7 \u0993 \u09b9\u09ac\u09c7\u09a8\u09be \u09ae\u09be\u09b2\u09c1\u09a6\u09c7\u09b0 \u099c\u09be\u09df\u0997\u09be \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09df \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09a8\u09be", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0986\u09ae\u09c1 \u09b2\u09c0\u0997 \u09b9\u099a\u09cd\u099b\u09c7 \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09b0 \u09b8\u09a8\u09cd\u09a4\u09be\u09a8", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ae\u09cb\u099f \u09b8\u09ae\u09cd\u09aa\u09a4\u09bf\u09b0 \u09ad\u09be\u0997 \u09a7\u09a8\u09c0\u09a6\u09c7\u09b0 \u09a6\u0996\u09b2\u09c7 \u098f\u099c\u09a8\u09cd\u09af \u09ad\u09be\u09b0\u09a4\u09c7 \u09b6\u09a4\u0995\u09b0\u09be \u09ad\u09be\u0997 \u09ae\u09be\u09a8\u09c1\u09b7\u0995\u09c7 \u09a8\u09be \u0996\u09c7\u09df\u09c7 \u09a5\u09be\u0995\u09a4\u09c7 \u09b9\u09df \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u099a\u09be\u09b2 \u098f\u0996\u09a8 \u099f\u09be\u0995\u09be \u0995\u09c7\u099c\u09bf \u09b9\u09be \u09b9\u09be", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u09a8\u09be \u09ac\u09c7\u09b6\u09bf \u099a\u09bf\u09a8\u09cd\u09a4\u09be \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09b9\u09ac\u09c7 \u0995\u09be\u09b0\u09a8 \u099a\u09be\u09df\u09a8\u09be \u09ae\u09be\u09b2\u09c7\u09b0 \u0995\u09cb\u09a8 \u0997\u09cd\u09af\u09be\u09b0\u09be\u09a8\u09cd\u099f\u09bf \u09a8\u09c7\u0987 \u09ae\u09bf\u09b8\u09be\u0987\u09b2 \u09ad\u09be\u09b0\u09a4\u09c7 \u09ae\u09be\u09b0\u09a4\u09c7 \u0997\u09bf\u09df\u09c7 \u09ac\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u0997\u09bf\u09df\u09c7 \u09aa\u09b0\u09ac\u09c7", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0996\u09ac \u09ad\u09be\u09b2 \u09ad\u09be\u09b0\u09a4 \u0993 \u09a7\u09cd\u09ac\u0982\u09b6 \u09b9\u09df\u09c7 \u09af\u09be\u0995 \u098f\u09b0 \u09b8\u09be\u09a5\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u0989\u099a\u09bf\u09a4 \u098f\u0987\u09b8\u09ac \u0985\u09ac\u09c8\u09a7 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09a6\u09c7\u09b0 \u0996\u09c1\u0981\u099c\u09c7 \u09a6\u09c7\u09b6 \u09a5\u09c7\u0995\u09c7 \u09a6\u09c2\u09b0 \u0995\u09b0\u09c7 \u09a6\u09c7\u0993\u09df\u09be \u09a6\u09c7\u0996\u09be \u09af\u09be\u099a\u09cd\u099b\u09c7 \u098f\u09b0\u09be \u09af\u09c7\u09a6\u09c7\u09b6\u09c7 \u09af\u09be\u099a\u09cd\u099b\u09c7 \u09b8\u09c7\u0996\u09be\u09a8\u0995\u09be\u09b0 \u0986\u0987\u09a8 \u09b6\u09c3\u0999\u09cd\u0996\u09b2\u09be\u09b0 \u0985\u09ac\u09a8\u09a4\u09bf \u09b9\u099a\u09cd\u099b\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09ae\u09be\u09df\u09be\u09ae\u09cd\u09ae\u09be\u09b0 \u0986\u09b0 \u09ad\u09be\u09b0\u09a4 \u098f\u099f\u09be \u09b9\u09be\u09dc\u09c7 \u09b9\u09be\u09dc\u09c7 \u09ac\u09c1\u099d\u099b\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ac\u09a8\u09cd\u09a7 \u09b9\u09b2\u09c7 \u09b8\u09ac \u0995\u09bf\u099b\u09c1 \u09b9\u0989\u09df\u09be \u0989\u099a\u09bf\u09ce \u09af\u09c7\u09ae\u09a8 \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09b8\u09ac \u099a\u09cd\u09af\u09be\u09a8\u09c7\u09b2 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c0 \u09ac\u09be\u0982\u09b2\u09be \u0987\u0982\u09b2\u09bf\u09b6 \u09a8\u09be\u099f\u0995 \u098f\u09ac\u0982 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u0995\u09cb\u09a8 \u09a8\u09be\u09df\u0995 \u09a8\u09be\u09df\u09bf\u0995\u09be\u09b0 \u09ab\u09cd\u09b2\u09bf\u09ae \u099a\u09ac\u09bf \u09a1\u09cd\u09b0\u09be\u09ae\u09be \u099b\u09b2\u09a4\u09c7 \u09a6\u09c7\u0993\u09df\u09be \u09b9\u09ac\u09c7\u09a8\u09be \u09ac\u09a8\u09cd\u09a7 \u09b9\u09b2\u09c7 \u09b8\u09ac \u0995\u09bf\u099b\u09c1 \u09ac\u09a8\u09cd\u09a7 \u09b9\u0989\u09df\u09be \u09a7\u09b0\u0995\u09be\u09b0", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09a6\u09c7\u09b0 \u09a6\u09c7\u09df\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u09b8\u09ac \u0986\u099b\u09c7", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u098f\u0987 \u09b6\u09be\u09b2\u09bf\u09b0\u09c7 \u09ae\u09c1\u09a6\u09bf\u09b0 \u09b8\u09be\u09a5\u09c7 \u09ac\u09bf\u09df\u09c7 \u09a6\u09bf\u09df\u09c7 \u09ad\u09be\u09b0\u09a4 \u09aa\u09be\u09a0\u09bf\u09df\u09c7 \u09a6\u09be\u0993 \u09a4\u09be\u09b9\u09b2\u09c7 \u0986\u09b0 \u0993 \u0995\u09be\u099b \u09a5\u09c7\u0995\u09c7 \u0985\u09a8\u09c7\u0995 \u09ad\u09be\u09b2 \u0995\u09b0\u09c7 \u09b6\u09cb\u0995 \u09a6\u09bf\u09ac\u09b8 \u09aa\u09be\u09b2\u09a8 \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u098f\u0987 \u09a8\u09bf\u09df\u09ae \u099a\u09be\u09b2\u09c1 \u09b9\u09b2\u09c7 \u0985\u09aa\u09b0\u09be\u09a7 \u09ac\u09c8\u09a7\u09a4\u09be \u09aa\u09be\u09ac\u09c7 \u09a4\u09be\u0987 \u098f\u0987 \u09a8\u09bf\u09df\u09ae \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b8\u0999\u09cd\u0997\u09c7 \u099a\u09be\u09b2\u09c1\u09b0 \u0995\u09c7\u09be\u09a8\u09c7\u09be \u09aa\u09cd\u09b0\u09df\u09c7\u09be\u099c\u09a8 \u09a8\u09c7\u0987 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ac\u09be\u09b9\u0983\u0995\u09c0 \u09b8\u09c1\u09a8\u09cd\u09a6\u09b0 \u0995\u09a5\u09be \u099a\u09c0\u09a8\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09b8\u09ae\u09cd\u09aa\u09b0\u09cd\u0995 \u0997\u09dc\u09c7 \u0989\u09a0\u09be\u09df \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0\u09b0 \u09b8\u09ab\u09b0 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u0995\u09c7 \u09a8\u09bf\u09df\u09c7 \u098f\u09a4 \u09b0\u09be\u099c\u09a8\u09c0\u09a4\u09bf \u0995\u09c7\u09a8 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09b9\u09be\u099a\u09bf\u09a8\u09be \u0996\u09be\u09a4\u09c1\u09a8 \u098f\u09a4 \u09ac\u09c7\u09b6\u09c0 \u0986\u09ac\u09c7\u0997 \u09ad\u09be\u09b2 \u09a8\u09be \u0990 \u09b8\u09ae\u09df\u09c7\u09b0 \u0995\u099c\u09a8 \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u099c\u09c0\u09ac\u09bf\u09a4 \u0986\u099b\u09c7 \u09a8\u09bf\u099c\u09c7\u09b0 \u09b2\u09cb\u0995\u09a6\u09c7\u09b0 \u0995\u09c7 \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09ac\u09be\u09a8\u09bf\u09df\u09c7 \u099f\u09be\u0995\u09be \u0996\u09be\u0993\u09df\u09be\u09b0 \u09aa\u09a8\u09cd\u09a6\u09bf ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0995\u09be\u09b6\u09cd\u09ae\u09c0\u09b0\u09c7 \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09b8\u09c7\u09a8\u09be\u09ac\u09be\u09b9\u09bf\u09a8\u09c0 \u09ac\u09bf\u0995\u09cd\u09b7\u09cb\u09ad\u0995\u09be\u09b0\u09c0 \u09a6\u09c7\u09b0 \u0989\u09aa\u09b0 \u0997\u09c1\u09b2\u09bf \u099a\u09be\u09b2\u09be\u09b2\u09c7 \u09b8\u09c7\u099f\u09be \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09b8\u09b9 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09a4\u09c3\u09a4\u09c0\u09df \u09b6\u09cd\u09b0\u09c7\u09a3\u09c0\u09b0 \u0995\u09bf\u099b\u09c1 \u09a8\u09bf\u09b0\u09cd\u09ac\u09cb\u09a7 \u09ae\u09be\u09a8\u09c1\u09b7 \u098f\u09b0 \u09b8\u09ae\u09be\u09b2\u09cb\u099a\u09a8\u09be\u09df \u09a8\u09bf\u0989\u099c\u09ab\u09bf\u09a1 \u09b8\u09df\u09b2\u09be\u09ac \u09b9\u09df\u09c7 \u09af\u09be\u09df \u0986\u09b0 \u098f\u0996\u09a8 \u09b8\u09ac\u09be\u0987 \u09a8\u09bf\u09b6\u09cd\u099a\u09c1\u09aa \u0995\u09c7\u09a8 \u098f\u09ac\u09be\u09b0\u09c7\u09b0 \u09b8\u09cd\u0995\u09cd\u09b0\u09bf\u09aa\u09cd\u099f\u09c7 \u09ae\u09be\u09df\u09be\u09a8\u09ae\u09be\u09b0 \u0986\u099b\u09c7 \u09ac\u09b2\u09c7 \u09b8\u09ac\u09be\u0987 \u09a8\u09bf\u09b6\u09cd\u099a\u09c1\u09aa ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u098f\u0987 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u099b\u09c7\u09b2\u09c7\u09b0\u09be \u0986\u09ac\u09be\u09b0 \u09a4\u09cb \u09b9\u09be\u09b0\u09b2\u09bf \u09ac\u09be\u0998 \u0986\u09ac\u09be\u09b0\u09cb \u09a8\u09c7\u09b0\u09bf \u0995\u09c1\u09a4\u09a4\u09be \u09b9\u09af\u09bc\u09c7 \u0997\u09c7\u09b2\u09cb \u0995\u09c1\u0995\u09c1\u09b0 \u0986\u09ac\u09be\u09b0 \u09ac\u09be\u0998 \u09b8\u09be\u099c\u09a4\u09c7 \u09af\u09be\u09df ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u099f\u09df\u09b2\u09c7\u099f \u09ac\u09be\u09a8\u09bf\u09df\u09c7 \u0986\u0997\u09c7 \u09a8\u09bf\u099c\u09c7\u09a6\u09c7\u09b0 \u09b8\u09ae\u09b8\u09cd\u09af\u09be \u09b8\u09ae\u09be\u09a7\u09be\u09a8 \u0995\u09b0\u09c1\u0995 \u09ad\u09be\u09b0\u09a4 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u098f\u09ac\u09be\u09b0 \u09a5\u09c7\u0995\u09c7 \u09a4\u09cb\u09b0 \u09ac\u09be\u09aa \u0995\u09c7 \u0986\u09ae\u09cd\u09aa\u09be\u09af\u09bc\u09be\u09b0 \u09b9\u09bf\u09b8\u09c7\u09ac\u09c7 \u09aa\u09be\u09a0\u09be\u0987\u09df\u09be \u09a6\u09bf\u09b6 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09aa\u09be\u0995\u09bf\u09b0 \u09a6\u09be\u09b2\u09b2 \u0997\u09c1\u09b2\u09be\u09b0\u09c7 \u099c\u09c1\u09a4\u09be \u09ae\u09be\u09b0\u09be \u0989\u099a\u09bf\u09a4", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u0986\u09ae\u09be\u09b0 \u09ac\u09be\u09ac\u09be\u09b0 \u09b6\u09a4\u09cd\u09b0\u09c1 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0997\u09a3\u09a7\u09b0\u09cd\u09b7\u09a3\u09c7\u09b0 \u09b6\u09bf\u0995\u09be\u09b0 \u09a8\u09be\u09b0\u09c0\u0995\u09c7 \u09aa\u09c1\u09b2\u09bf\u09b6\u09c7\u09b0 \u0986\u09a8\u09a8\u09cd\u09a6 \u09a6\u09c7\u0993\u09df\u09be\u09b0 \u09aa\u09cd\u09b0\u09b6\u09cd\u09a8 \u09a6\u0995\u09cd\u09b7\u09bf\u09a3 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u0995\u09c7\u09b0\u09be\u09b2\u09be \u0985\u0999\u09cd\u0997\u09b0\u09be\u099c\u09cd\u09af\u09c7 \u09a5\u09be\u09a8\u09be\u09df \u0997\u09a3\u09a7\u09b0\u09cd\u09b7\u09a3\u09c7\u09b0 \u0985\u09ad\u09bf\u09af\u09cb\u0997 \u099c\u09be\u09a8\u09be\u09a4\u09c7 \u0997\u09bf\u09df\u09c7 \u098f\u0995 \u09a8\u09be\u09b0\u09c0 \u09aa\u09c1\u09b2\u09bf\u09b6\u09c7\u09b0 \u0986\u09aa\u09a4\u09cd\u09a4\u09bf\u0995\u09b0 \u09aa\u09cd\u09b0\u09b6\u09cd\u09a8\u09c7\u09b0 \u09b6\u09bf\u0995\u09be\u09b0 \u09b9\u09df\u09c7\u099b\u09c7\u09a8 \u09ac\u09b2\u09c7 \u0985\u09ad\u09bf\u09af\u09cb\u0997 \u0989\u09a0\u09c7\u099b\u09c7 \u0993\u0987 \u09a8\u09be\u09b0\u09c0", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09b9\u09bf\u099c\u09b0\u09be \u09a6\u09b2 \u09a8\u09bf\u09df\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09aa\u09be\u09b6\u09c7 \u09a5\u09be\u0995\u09ac\u09c7 \u09ac\u09be\u0982\u09b2\u09a6\u09c7\u09b6", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09a6\u09be\u09b2\u09be\u09b2 \u09b6\u09c1\u09df\u09be\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u0997\u09c1\u09b2\u09c7\u09be\u0995\u09c7 \u09a7\u09b0\u09c7 \u0997\u09c1\u09b2\u09bf \u0995\u09b0\u09c7 \u09ae\u09be\u09b0\u09be \u0989\u099a\u09bf\u09a4 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u0995\u09c7 \u09ac\u09bf\u09b6\u09be\u09b8 \u0995\u09b0\u09be \u09af\u09be\u09df \u09a8\u09be \u0995\u09be\u09b0\u09a3 \u09ad\u09be\u09b0\u09a4 \u09b8\u09c1\u09ac\u09bf\u09a7\u09be \u09ac\u09be\u09a6\u09c0 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u099a\u09be\u09b0 \u09a6\u09bf\u0995\u09c7 \u0998\u09bf\u09b0\u09c7 \u09ab\u09c7\u09b2 \u09ad\u09be\u09b0\u09a4 \u0995\u09c7", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u0987\u09a4\u09bf\u09b9\u09be\u09b8\u09c7\u09b0 \u09b8\u09ac\u099a\u09c7\u09df\u09c7 \u09a8\u09bf\u09b0\u09cd\u09b2\u099c\u09cd\u099c \u09aa\u09cd\u09b2\u09c7\u09df\u09be\u09b0 \u09b8\u09cc\u09b0\u09ad \u09ac\u09be\u09b0\u09ac\u09be\u09b0 \u0985\u09aa\u09ae\u09be\u09a8\u09c7\u09b0 \u09aa\u09b0\u09c7\u0993 \u0996\u09c7\u09b2\u09be\u09b0 \u09b6\u0996 \u09ae\u09c7\u099f\u09c7\u09a8\u09bf ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09a6\u09c7\u09b6\u09c7\u09b0 \u0996\u09ac\u09b0 \u09ac\u09be\u09a6 \u09a6\u09bf\u09df\u09be \u09b6\u09c1\u09a7\u09c1 \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09b0 \u0996\u09ac\u09b0 \u099a\u09cb\u09a6\u09be\u0993 \u0995\u09c7\u09a8 \u09b9\u09be\u09b0\u09be\u09ae\u09c0\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09be", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u0986\u09b0 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09af\u09c1\u09a6\u09cd\u09a7 \u09b2\u09be\u0997\u09c1\u0995 \u0986\u09b0 \u09a8\u09be\u0987\u09ac\u09be \u09b2\u09be\u0997\u09c1\u0995 \u09ab\u09c7\u09b8\u09ac\u09c1\u0995\u09c7 \u09a6\u09c7\u0996\u099b\u09bf \u09ad\u09be\u09b0\u09a4 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09a8\u09bf\u09df\u09c7 \u0985\u09b2\u09b0\u09c7\u09a1\u09bf \u09af\u09c1\u09a6\u09cd\u09a7 \u09b6\u09c1\u09b0\u09c1 \u09b9\u09df\u09c7 \u0997\u09c7\u099b\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u098f\u0996\u09a8 \u09ad\u09be\u09b0\u09a4 \u099a\u09c1\u09aa \u0995\u09c7\u09a8 \u0995\u09cb\u09a5\u09be\u09df \u09ae\u09cb\u09a6\u09bf ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09b0\u09be \u09a8\u09bf\u09b0\u09cd\u09af\u09be\u09a4\u09bf\u09a4 \u09b9\u09b2\u09c7 \u09ad\u09be\u09b0\u09a4 \u0995\u09be\u0981\u09a6\u09c7 \u0996\u09cd\u09b0\u09bf\u09b8\u09cd\u099f\u09be\u09a8\u09b0\u09be \u09a8\u09bf\u09b0\u09cd\u09af\u09be\u09a4\u09bf\u09a4 \u09b9\u09b2\u09c7 \u0986\u09ae\u09c7\u09b0\u09bf\u0995\u09be \u0993 \u0987\u0989\u09b0\u09c7\u09be\u09aa \u0995\u09be\u0981\u09a6\u09c7 \u09ac\u09c7\u09be\u09a6\u09cd\u09a7\u09b0\u09be \u09a8\u09bf\u09b0\u09cd\u09af\u09be\u09a4\u09bf\u09a4 \u09b9\u09b2\u09c7 \u099a\u09bf\u09a8 \u0995\u09be\u0981\u09a6\u09c7 \u0986\u09b0 \u09ae\u09c7\u09be\u09b8\u09b2\u09ae\u09be\u09a8\u09b0\u09be \u09a8\u09bf\u09b0\u09cd\u09af\u09be\u09a4\u09bf\u09a4 \u09b9\u09b2\u09c7 \u0995\u09be\u0981\u09a6\u09be\u09a4\u09c7\u09be \u09a6\u09c1\u09b0\u09c7\u09b0 \u0995\u09a5\u09be \u09a4\u09be\u09a6\u09c7\u09b0 \u09aa\u09be\u09b6\u09c7 \u09a6\u09cd\u09ac\u09be\u09b0\u09be\u09a8\u09c7\u09be\u09b0 \u09ae\u09a4 \u0995\u09be\u0989\u0995\u09c7 \u0996\u09c1\u099c\u09c7 \u09aa\u09be\u0993\u09df\u09be \u09af\u09be\u09df\u09a8\u09be \u09b9\u09c7 \u0986\u09b2\u09cd\u09b2\u09be\u09b9 \u09a4\u09c1\u09ae\u09bf \u09ac\u09bf\u09b6\u09cd\u09ac\u09c7\u09b0 \u09b8\u0995\u09b2 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u0995\u09c7 \u098f\u0995 \u09b9\u0993\u09df\u09be\u09b0 \u09a4\u09c7\u09be\u09ab\u09bf\u0995 \u09a6\u09be\u09a8 \u0995\u09b0 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0987\u09a8\u09cd\u09a1\u09bf\u09df\u09be \u09ac\u09bf\u09ad\u09bf\u09a8\u09cd\u09a8 \u09ad\u09be\u09ac\u09c7 \u0986\u0987\u098f\u09b8\u0995\u09c7 \u0985\u09b0\u09cd\u09a5 \u09af\u09cb\u0997\u09be\u09a8 \u09a6\u09bf\u09df\u09c7 \u0986\u09b8\u099b\u09c7 \u098f\u09b8\u09ac \u09ad\u09c1\u09b2\u09c7 \u0997\u09c7\u09b2\u09c7\u09a4\u09cb \u09b9\u09ac\u09c7\u09a8\u09be \u0985\u09ac\u09b6\u09cd\u09af \u09ad\u09be\u09b0\u09a4 \u098f\u0995\u099f\u09be \u09ad\u09a8\u09cd\u09a1 \u099c\u09be\u09a4\u09bf \u09b8\u09cb \u098f\u09b8\u09ac \u0986\u09b0 \u09a8\u09a4\u09c1\u09a8 \u0995\u09bf ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u0993 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09a4\u09c1\u09b2\u09a8\u09be\u09df \u09b6\u09cd\u09b0\u09c7\u09b7\u09cd\u09a0 \u09a4\u09be\u09b0\u09be \u098f\u0995\u09be\u09a4\u09cd\u09a4\u09b0\u09c7 \u098f\u0995 \u0995\u09cb\u099f\u09bf \u09b2\u09cb\u0995\u0995\u09c7 \u0986\u09b6\u09cd\u09b0\u09df \u09a6\u09bf\u09df\u09c7\u099b\u09bf\u09b2\u09cb ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09a4\u09cb\u09a6\u09c7\u09b0 \u09aa\u09c1\u09b0\u09cb \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09a6\u09c7\u09b6 \u0997\u09c1\u09b2\u09cb\u0995\u09c7 \u09ad\u09be\u09b0\u09a4 \u098f\u0995\u09be\u0987 \u099a\u09c1\u09a6\u09ac\u09c7", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ae\u09be\u09df\u09be\u09a8\u09ae\u09be\u09b0\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09ae\u09c7\u09b0\u09c7 \u09b6\u09c7\u09b8 \u0995\u09b0\u09c7 \u09ab\u09c7\u09b2\u09b2 \u09a4\u09be\u09b0 \u0995\u09cb\u09a8 \u0996\u09ac\u09b0 \u09a8\u09be\u0987 \u09ad\u09be\u09b0\u09a4\u09c7 \u099f\u09cd\u09b0\u09c7\u09a8 \u09a6\u09c1\u09b0\u09cd\u0998\u099f\u09a8\u09be\u09df \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09ae\u09b0\u09c7\u099b\u09c7 \u0995\u09bf\u09a8\u09be \u09a4\u09be \u09a8\u09bf\u09df\u09c7 \u09b8\u09b0\u0995\u09be\u09b0\u09c7\u09b0 \u09ae\u09be\u09a5\u09be \u09ac\u09c7\u09a5\u09be \u09b9\u09be\u09b8\u09be\u0987\u09b2\u09bf \u09ae\u09c1\u09b0\u09c7", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7 \u099a\u09be\u09aa \u09aa\u09dc\u09c7\u09a8\u09be \u09a4\u09be\u09a4\u09c7 \u0995\u09bf \u09b9\u09df\u09c7\u099b\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09a4\u09cb \u09aa\u09dc\u09c7\u099b\u09c7 \u09a4\u09be\u099b\u09be\u09dc\u09be \u09ad\u09be\u09b0\u09a4\u09c0\u09df\u09b0", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09a4\u09cb\u09a6\u09c7\u09b0 \u09ae\u09a4 \u09a4\u0995\u09bf\u0993\u09a8\u09a6\u09c7\u09b0 \u09aa\u09c3\u09a5\u09bf\u09ac\u09c0 \u099b\u09be\u09b0\u09be \u0995\u09b0\u09a4\u09c7 \u0986\u09ae\u09c7\u09b0\u09bf\u0995\u09be \u09ad\u09be\u09b0\u09a4 \u0986\u09b0 \u0987\u099c\u09b0\u09be\u0987\u09b2 \u098f\u0997\u09c1\u09b2\u09bf \u09ac\u09cd\u09af\u09ac\u09b9\u09be\u09b0 \u0995\u09b0\u09ac\u09c7 \u09b6\u09be\u09b2\u09be \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u09af\u09c1\u09a6\u09cd\u09a7 \u0995\u09bf \u09a4\u09be\u09b9\u09b2\u09c7 \u09b6\u09c1\u09b0\u09c1 \u09b9\u09df\u09c7 \u0997\u09c7\u09b2 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0985\u0987 \u098f\u09a4\u09c1 \u099f\u09be\u0995\u09be \u0995\u09c1\u0987 \u09aa\u09c7\u09b2\u09c1 \u099c\u09c7 \u09a8\u09bf\u099c\u09c7\u09a8 \u09b8\u09b0\u09ac\u09cd\u09af \u0987\u09b8\u09cd\u09a5\u09be\u09a8\u09c7 \u09ac\u09cd\u09b0\u09b2\u09c7\u099f\u09aa\u09cd\u09b0\u09ab \u09b8\u09bf\u09b8\u099f\u09c7\u09ae \u0995\u09b0\u099b\u09c7 \u09b9\u09c7 \u09ad\u09be\u0987 \u0986\u09ae\u09bf \u0995\u09be\u099b\u09c1\u099f\u09be \u0985\u09a8\u09c1\u09ae\u09be\u09a8 \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u099b\u09bf \u0993 \u09b8\u09ac\u09be\u0987\u09b0 \u09aa\u0995\u09c7\u099f \u0995\u09c7\u099f\u09c7\u099b\u09c7 \u099c\u09be\u09b0\u09be \u09b9\u09b2\u09c1 \u09b8\u09be\u09a7\u09be\u09b0\u09a8 \u099c\u09a8\u0997\u09a3 \u09a4\u09ac\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7 \u098f\u09ae\u09a8 \u0985\u09a6\u09c7\u09b6 \u09aa\u09cd\u09b0\u09c7\u09ae\u09bf\u0995 \u09a4\u09c7\u09ae\u09a8 \u09a6\u09c7\u0996\u09be \u09ac\u09be \u09b8\u09c1\u09a8\u09be \u09af\u09be\u09df\u09a8\u09be \u09a7\u09a8\u09cd\u09af\u09ac\u09be\u09a6 \u09a4\u0995\u09c7 \u09a8\u09bf\u09af\u09c7\u09b0 \u09a6\u09c7\u09b6\u0995\u09c7 \u09ac\u09be\u0981\u09b6 \u09a6\u09bf\u0993\u09df\u09be\u09b0 \u099c\u09a8\u09cd\u09af\u09c7 \u0985\u09a8\u09cd\u09af \u09a6\u09c7\u09b6\u0995\u09c7 \u09ac\u09be\u0981\u09b6 \u09a6\u09bf\u09a4\u09c7 \u099a\u09be\u09b7 \u098f\u09ac\u09be\u09b0 \u09a8\u09bf\u09af\u09c7\u09b0\u09be \u09a8\u09bf\u09af\u09c7\u09b0\u09be \u09ac\u09be\u0981\u09b6 \u0996\u09be", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u0993 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u09a4\u09a5\u09be\u0995\u09a5\u09bf\u09a4 \u09af\u09c1\u09a6\u09cd\u09a7\u09c7\u09b0 \u098f\u09a4 \u0985\u099c\u09be\u09a8\u09be \u0985\u09b8\u09cd\u09a4\u09cd\u09b0\u09c7\u09b0 \u0995\u09b2\u09cd\u09aa\u0995\u09be\u09b9\u09bf\u09a8\u09c0 \u0993 \u0996\u09ac\u09b0\u09be \u0996\u09ac\u09b0 \u09b8\u09cd\u09ac\u09df\u0982 \u09ad\u09be\u09b0\u09a4\u09c0\u09af\u09bc \u0993 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c0\u09b0\u09be \u099c\u09be\u09a8\u09c7 \u09a8\u09be \u09af\u09a4\u099f\u09c1\u0995\u09c1 \u099c\u09be\u09a8\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c0 \u0995\u09bf\u099b\u09c1 \u09ab\u09c7\u0987\u09b8\u09ac\u09c1\u0995 \u09ac\u09cd\u09af\u09ac\u09b9\u09be\u09b0\u0995\u09be\u09b0\u09c0 \u0993 \u09aa\u09a4\u09cd\u09b0 \u09aa\u09a4\u09cd\u09b0\u09bf\u0995\u09be\u09b0 \u09a4\u09a5\u09be\u0995\u09a5\u09bf\u09a4 \u09b8\u09be\u0982\u0998\u09be\u09a4\u09bf\u0995\u09b0\u09be \u09a5\u09c1\u0995\u09cd\u0995\u09c1 \u09b8\u0982\u09ac\u09be\u09a6\u09bf\u0995\u09b0\u09be \u09af\u09c1\u09a6\u09cd\u09a7 \u09ae\u09be\u09b0\u09be\u09ae\u09be\u09b0\u09bf \u0995\u09bf\u099b\u09c1\u0987 \u09a4\u09cb \u09b9\u09ac\u09c7\u09a8\u09be \u0985\u09b9\u09c7\u09a4\u09c1\u0995 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u0998\u09c1\u09ae \u09b9\u09be\u09b0\u09be\u09ae \u0995\u09b0\u09c7 \u098f\u0987 \u09a4\u09a5\u09be\u0995\u09a5\u09bf\u09a4 \u09b8\u0982\u09ac\u09be\u09a6\u09bf\u0995\u09b0\u09be", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0995\u09bf\u09b0\u09c7 \u09ad\u09be\u09b0\u09a4 \u098f\u09b0 \u09aa\u09be\u09a8\u09a5\u09c7\u0995\u09c7 \u099a\u09c1\u09a8 \u0996\u09b8\u09b2\u09c7 \u0996\u09ac\u09b0 \u09a6\u09bf\u09b8 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ae\u09c7\u09af\u09bc\u09c7 \u099f\u09bf\u09ae \u0995\u09af\u09bc\u09c7\u0995\u09a6\u09bf\u09a8 \u0986\u0997\u09c7 \u0993\u09af\u09bc\u09c7\u09b8\u09cd\u099f\u0987\u09a8\u09cd\u09a1\u09bf\u099c \u0995\u09be\u099b\u09c7 \u09b9\u09c7\u09b0\u09c7\u099b\u09bf\u09b2\u09cb \u09ac\u09b2\u09c7 \u09ac\u09be\u09b0 \u09ac\u09be\u09b0 \u0996\u09ac\u09b0 \u09a6\u09bf\u099a\u09cd\u099b\u09bf\u09b2\u09bf\u09b8 \u098f\u0996\u09a8 \u0995\u09bf \u09b9\u09b2\u09cb\u09b0\u09c7 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09bf \u09ae\u09c7\u09af\u09bc\u09c7 \u0995\u09cd\u09b0\u09bf\u0995\u09c7\u099f \u099f\u09bf\u09ae \u09b0\u09be\u09a8\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u0995\u09be\u099b\u09c7 \u0985\u09b2\u0989\u0987\u0995\u09c7\u099f \u0996\u09ac\u09b0\u099f\u09be \u099a\u09be\u09aa\u09b2\u09bf \u0995\u09c7\u09a8\u09cb\u09b0\u09c7 \u09b2\u099c\u09cd\u09ac\u09be \u09b2\u09be\u0997\u099b\u09c7 \u09ad\u09be\u09b0\u09a4\u0995\u09c7 \u0997\u09be\u09b2\u09a6\u09bf\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09bf\u09a8\u09be \u09ac\u09b2\u09c7 \u09a8\u09be\u0995\u09bf\u09b0\u09c7 \u09aa\u09be\u0995\u09bf\u09a6\u09be\u09b2\u09be\u09b2 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09a4\u09cb\u09b0\u09be \u09ad\u09be\u09b0\u09a4\u09c7 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u09b9\u09a4\u09cd\u09af\u09be \u09b6\u09c1\u09b0\u09c1 \u0995\u09b0\u09ac\u09bf \u0986\u09b0 \u0986\u09ae\u09b0\u09be \u09b8\u09be\u09b0\u09be \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09ac\u09bf\u09b6\u09cd\u09ac \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09b9\u09a4\u09cd\u09af\u09be \u09b6\u09c1\u09b0\u09c1 \u0995\u09b0\u09ac\u09cb \u09b8\u09b0\u09cd\u09ac\u09aa\u09cd\u09b0\u09a5\u09ae \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c0 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u09b9\u09a4\u09cd\u09af\u09be \u09b6\u09c1\u09b0\u09c1 \u0995\u09b0\u09ac\u09cb ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0986\u09ae\u09b0\u09be \u0995\u09cb\u09a8 \u09a6\u09c7\u09b6\u09c7 \u09ac\u09be\u09b8\u0995\u09b0\u09bf \u09b9\u09be\u09b8\u09bf\u09a8\u09be\u09b0 \u0995\u09be\u099b\u09c7 \u0986\u09ae\u09be\u09b0 \u09aa\u09cd\u09b0\u09b6\u09cd\u09a8 \u09af\u09a6\u09bf \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09ac\u09b8\u09ac\u09be\u09b8 \u0995\u09b0\u09c7 \u09a5\u09be\u0995\u09bf \u09a4\u09be\u09b9\u09b2\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09b0\u09be \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09c7\u09b6\u09c7 \u0985\u0997\u09cd\u09b0\u09be\u09a7\u09bf\u0995\u09be\u09b0 \u09ad\u09bf\u09a4\u09cd\u09a4\u09bf\u09a4\u09c7 \u099c\u09be\u09df\u0997\u09be \u09aa\u09be\u099a\u09cd\u099b\u09c7 \u09a8\u09be \u0995\u09c7\u09a8 \u09a8\u09be\u0995\u09bf \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b9\u09c1\u0995\u09c1\u09ae\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u099a\u09c7\u09df\u09c7 \u0986\u099b\u09c7\u09a8 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09c1\u09b2 \u09a8\u09be \u09ad\u09be\u09b0\u09a4 \u09b9\u09c7\u09b0\u09c7 \u0997\u09bf\u09df\u09c7\u099b\u09bf\u09b2 \u0995\u09be\u09b0\u09a8 \u09a4\u0996\u09a8 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u0995\u09be\u099b\u09c7 \u09aa\u09cd\u09b2\u09c7\u099f \u0997\u09be\u09a8 \u099b\u09bf\u09b2 \u09a8\u09be \u098f\u099f\u09be \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09a4\u09a5\u09cd\u09af \u09ae\u09a4\u09c7 \u099c\u09be\u09a8\u09be \u09a4\u09c7 \u0986\u099b\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b6\u09bf\u0995\u09be\u09b0\u0989\u0995\u09a4\u09bf", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09a6\u09be\u09a6\u09be \u09af\u09a4\u0987 \u09b2\u09be\u09ab\u09be\u09b2\u09be\u09ab\u09bf \u0995\u09b0\u09c7\u09a8 \u09aa\u09c3\u09a5\u09bf\u09ac\u09c0\u09b0 \u0995\u09c7\u09be\u09a8 \u09b2\u09be\u09ad \u09a8\u09c7\u0987 \u09ad\u09be\u09b0\u09a4 \u09af\u09a4\u0987 \u098f\u0997\u09bf\u09df\u09c7 \u09af\u09be\u0995 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09b8\u09be\u09a5\u09c7\u09df \u09af\u09be\u09ac\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09aa\u09be\u0981\u099a\u099c\u09a8 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u098f\u0995 \u099c\u09a8 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09af\u09a6\u09bf \u09b8\u09be\u09b9\u09b7 \u09a5\u09be\u0995\u09c7 \u09a4\u09be\u09b9\u09b2\u09c7 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7 \u09b9\u09be\u09ae\u09b2\u09be \u0995\u09b0\u09c7 \u09a6\u09c7\u0996\u09be\u0995 \u09a4\u09be \u0995\u0996\u09c7\u09be\u09a8\u09c7\u09be \u09aa\u09be\u09b0\u09ac\u09c7 \u09a8\u09be \u0995\u09be\u09b0\u09a8 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u0986\u099b\u09c7 \u099a\u09c0\u09a8 \u0987\u09b0\u09be\u09a8 \u09a4\u09c1\u09b0\u09b8\u09cd\u0995 \u09b8\u09cc\u09a6\u09bf \u0986\u09b0\u09ac \u09b0\u09be\u09b6\u09bf\u09df\u09be \u0986\u09b0 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u0986\u099b\u09c7 \u09aa\u09c3\u09a5\u09bf\u09ac\u09c0\u09b0 \u09b8\u09ac \u099a\u09c7\u09df\u09c7 \u09b6\u0995\u09cd\u09a4\u09bf \u09a7\u09b0 \u09b0\u09be\u09b7\u09cd\u099f \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09a4\u09c8\u09b0\u09bf \u09a4\u09c7\u099c\u09cb\u09b8 \u09af\u09c1\u09a6\u09cd\u09a7\u09ac\u09bf\u09ae\u09be\u09a8 \u09ac\u09bf\u09ae\u09be\u09a8 \u0986\u09b0 \u09ac\u09c7\u09b6\u09bf \u09ac\u09c7\u09b6\u09bf \u09af\u09c1\u09a6\u09cd\u09a7\u09ae\u09b9\u09b0\u09be \u0995\u09b0\u09be ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u098f\u09a4\u09cb \u09a8\u09be\u099f\u0995\u09c0\u09df\u09a4\u09be \u09a8\u09be \u0995\u09b0\u09c7 \u09ad\u09be\u09b0\u09a4\u09c0\u09af\u09bc \u099a\u09cd\u09af\u09be\u09a8\u09c7\u09b2 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09ac\u09a8\u09cd\u09a7 \u0995\u09b0\u09c7 \u09a6\u09bf\u09b2\u09c7\u0987 \u09b9\u09df \u09b0\u09be\u09b7\u09cd\u099f\u09cd\u09b0 \u09b8\u09ae\u09be\u099c \u09a6\u09c1\u099f\u09cb\u0987 \u09b2\u09be\u09ad\u09ac\u09be\u09a8 \u09b9\u09ac\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0986\u09ae\u09c7\u09b0\u09bf\u0995\u09be \u09b0\u09be\u09b6\u09bf\u09df\u09be \u099a\u09c0\u09a8 \u098f\u0996\u09a8 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u0995\u09a4 \u09ad\u09be\u09b2 \u09ac\u09a8\u09cd\u09a7\u09c1 \u0994\u0996\u09be\u09a8\u09c7 \u0987\u09a8\u09cd\u09a1\u09bf\u09df\u09be \u0995\u09cb\u09a8 \u099a\u09c7\u099f\u09c7\u09b0 \u09ac\u09be\u09b2", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09a4\u09ac\u09c1\u0993 \u09a4\u09cb \u09ad\u09be\u09b0\u09a4\u09c7 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u0995\u09c1\u0995\u09c1\u09b0\u09c7\u09b0 \u09ae\u09a4\u09cb \u09ac\u09be\u09dc\u099b\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0995\u09c3\u09aa\u09a3 \u098f\u09b0 \u09b6\u09b9\u09b0 \u0995\u09b2\u0995\u09be\u09a4\u09be", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0995\u09bf\u099b\u09c1\u0987 \u09b9\u09ac\u09c7\u09a8\u09be \u09b8\u09ac \u09ae\u09bf\u09a1\u09bf\u09df\u09be\u09b0 \u09ac\u09be\u09dc\u09be\u09ac\u09be\u09dc\u09bf \u09ad\u09be\u09b0\u09a4 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u0995\u09c7 \u09aa\u09be\u0997\u09b2\u09be \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09df \u0995\u09be\u09ae\u09dc\u09be\u09df\u09a8\u09bf \u09af\u09c7 \u098f\u0995\u099c\u09a8 \u0986\u09b0\u09c7\u0995\u099c\u09a8\u0995\u09c7 \u09ad\u09df\u09be\u09ac\u09b9 \u0986\u0995\u09cd\u09b0\u09ae\u09a3 \u0995\u09b0\u09ac\u09c7 \u0993\u0987\u09b0\u0995\u09ae \u09ae\u09be\u099d\u09c7\u09ae\u09be\u099d\u09c7 \u09a6\u09c1\u0987\u099a\u09be\u09b0\u0986\u099f\u09a6\u09b6\u099c\u09a8 \u09ae\u09b0\u09ac\u09c7 \u09a4\u09be\u09b0 \u09ac\u09c7\u09b6\u09bf\u0995\u09bf\u099b\u09c1 \u09b9\u09ac\u09c7\u09a8\u09be", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u098f\u0987\u09ac\u09be\u09b0 \u09b9\u09ac\u09c7 \u09a8\u09cb\u0982\u09b0\u09be\u09ae\u09cb \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u098f\u09ac\u0982 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c0\u09b0\u09be \u09a8\u09cb\u0982\u09b0\u09be \u09ad\u09be\u09b7\u09be\u09df \u09aa\u09b0\u09b8\u09cd\u09aa\u09b0 \u0995\u09c7 \u0997\u09be\u09b2\u09bf \u09a6\u09bf\u09ac\u09c7\u09a8 \u09ae\u09be \u09ac\u09cb\u09a8 \u0995\u09bf\u099b\u09c1\u0987 \u09ac\u09be\u09a6 \u09af\u09be\u09ac\u09c7\u09a8\u09be \u09af\u09a6\u09bf\u0993 \u098f\u0996\u09be\u09a8\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0 \u0995\u09cb\u09a8\u09cb \u09a6\u09cb\u09b7 \u09a8\u09c7\u0987 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0986\u0997\u09c7 \u09a6\u09c7\u09b6\u09c7\u09b0 \u09b8\u09ae\u09b8\u09cd\u09af\u09be \u09b8\u09ae\u09be\u09a7\u09be\u09a8 \u0995\u09b0\u09c7\u09a8 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u0986\u09b0 \u09ad\u09be\u09b0\u09a4 \u0995\u09bf \u0995\u09b0\u09b2 \u098f\u099f\u09be \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09c7\u0996\u09be\u09b0 \u09ac\u09bf\u09b7\u09df \u09a8\u09be ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09a6\u09c7\u09b0 \u0995\u09cd\u09b7\u09ae\u09be \u0995\u09b0\u09be\u09b0 \u0987\u09a4\u09bf\u09b9\u09be\u09b8 \u0985\u09a8\u09c7\u0995 \u09a0\u09bf\u0995 \u09a4\u09be\u09b0\u0987 \u098f\u0995\u099f\u09bf \u09aa\u09cd\u09b0\u09ae\u09be\u09a3 \u098f\u0987 \u09af\u09c7 \u09ad\u09be\u09b0\u09a4 \u09af\u09be\u09a8\u09c7 \u09af\u09c7 \u09aa\u09be\u0995 \u09ad\u09be\u09b0\u09a4 \u09af\u09c1\u09a6\u09cd\u09a7 \u09b2\u09be\u0997\u09b2\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b9\u09be\u09b0 \u09a8\u09bf\u09b6\u09cd\u099a\u09bf\u09a4 \u09a4\u09ac\u09c1\u0993 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09b0\u09be \u09a4\u09be\u09a6\u09c7\u09b0 \u09b6\u09be\u09a8\u09cd\u09a4\u09bf \u09a6\u09bf\u09a4\u09c7 \u099a\u09be\u09af\u09bc \u09a4\u09be\u0987 \u09b6\u09be\u09a8\u09cd\u09a4\u09bf\u09a4\u09c7\u0987 \u09b8\u09ae\u09b8\u09cd\u09af\u09be \u09b8\u09ae\u09be\u09a7\u09be\u09a8\u09c7\u09b0 \u09aa\u09cd\u09b0\u099a\u09c7\u09b7\u09cd\u099f\u09be \u099a\u09be\u09b2\u09bf\u09af\u09bc\u09c7 \u09af\u09be\u099a\u09cd\u099b\u09c7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09ad\u09be\u09b0\u09a4 \u09af\u09a6\u09bf \u0985\u09a4\u09bf\u09b0\u09bf\u0995\u09cd\u09a4 \u0995\u09b0\u09c7 \u09a4\u09be\u09b9\u09b2\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0 \u0985\u09a4\u09bf\u09b0\u09bf\u0995\u09cd\u09a4 \u0995\u09b0\u09be\u09b0 \u099c\u09ac\u09be\u09ac \u09a8\u09bf\u09b6\u09cd\u099a\u09af\u09bc\u0987 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09a6\u09bf\u09ac\u09c7 \u0987\u09a8\u09b6\u09be\u09b2\u09cd\u09b2\u09be\u09b9 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c0\u09df\u09a6\u09c7\u09b0 \u09ae\u09be\u09a5\u09be \u09ae\u09cb\u099f\u09be \u09b9\u09b2\u09c7 \u09a4\u09cb\u09ae\u09be\u09a6\u09c7\u09b0\u0993 \u09ae\u09be\u09a5\u09be \u09ae\u09cb\u099f\u09be \u0995\u09be\u09b0\u09a3 \u09a4\u09cb\u09ae\u09b0\u09be\u0993 \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u099c\u09be\u09a4\u09c0 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u098f\u0995\u099f\u09be \u09ab\u09be\u09b2\u09a4\u09c1 \u09a6\u09c7\u09b6 \u0995\u09be\u09b0\u09a8 \u09a6\u09bf\u09a8 \u0997\u09c1\u09b2\u09be \u09ae\u09a8\u09c7 \u09aa\u09b0\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09aa\u09b6\u09cd\u099a\u09bf\u09ae\u09ac\u0999\u09cd\u0997\u09c7\u09b0 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u09ac\u09be\u0999\u09be\u09b2\u09c0\u09b0\u09be \u09b8\u09be\u09b0\u09be\u0995\u09cd\u09b7\u09a3 \u09aa\u09b6\u09cd\u099a\u09bf\u09ae\u09ac\u0999\u09cd\u0997\u09c7\u09b0 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09ac\u09be\u0999\u09be\u09b2\u09c0\u09a6\u09c7\u09b0 \u09a7\u09b0\u09c7 \u09a7\u09b0\u09c7 \u099a\u09cb\u09a6\u09c7 \u09b8\u09c7\u0987 \u099a\u09cb\u09a6\u09a8 \u0996\u09c7\u09df\u09c7 \u0993\u0987 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09b0\u09be \u0986\u09ac\u09be\u09b0 \u09a8\u09bf\u099c\u09c7\u09a6\u09c7\u09b0 \u09b2\u09be\u09b2 \u09aa\u09c7\u09be\u0981\u09a6 \u09a8\u09bf\u09df\u09c7 \u09ad\u09be\u0981\u09dc\u09c7\u09b0 \u09ae\u09a4\u09cb \u0986\u09ac\u09be\u09b0 \u09ae\u09be\u09df\u09be\u09a8\u09ae\u09be\u09b0\u09c7\u09b0 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be \u09a8\u09bf\u09df\u09c7 \u09ab\u09c1\u09b0\u09cd\u09a4\u09bf \u0995\u09b0\u09c7 \u0993\u09b0\u09c7 \u09ac\u09cd\u09b2\u09cd\u09af\u09be\u0995 \u09ac\u09c7\u0999\u09cd\u0997\u09b2 \u09aa\u09b6\u09cd\u099a\u09bf\u09ae\u09ac\u0999\u09cd\u0997\u09c0\u09df \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u099b\u09be\u0997\u09b2\u09c7\u09b0 \u09a6\u09b2 \u09ae\u09be\u09df\u09be\u09a8\u09ae\u09be\u09b0\u09c7\u09b0 \u09b8\u09c7\u09a8\u09be\u09b9\u09bf\u09a8\u09c0\u09b0 \u0996\u09be\u09aa\u09b2\u09be\u0982 \u099c\u0999\u09cd\u0997\u09c0 \u09b2\u09c7\u09b2\u09bf\u09df\u09c7 \u0986\u099c \u09aa\u09b0\u09cd\u09af\u09a8\u09cd\u09a4 \u09af\u09a4\u09cb\u099c\u09a8 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b8\u09c7\u09a8\u09be \u09b9\u09a4\u09cd\u09af\u09be \u0995\u09b0\u09c7\u099b\u09c7 \u09a4\u09a4\u099c\u09a8 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09b0 \u09ac\u09be\u09b2\u0993 \u099b\u09c1\u0981\u09df\u09c7 \u09a6\u09c7\u0996\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 \u09a8\u09bf \u0986\u099c \u09aa\u09b0\u09cd\u09af\u09a8\u09cd\u09a4 \u09ae\u09be\u09df\u09be\u09a8\u09ae\u09be\u09b0", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b8\u09bf\u09b0\u09bf\u09df\u09be\u09b2 \u09ac\u09a8\u09cd\u09a7 \u0995\u09b0\u09a4\u09c7 \u09b9\u09ac\u09c7", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ae\u09be\u09a6\u09be\u09b0\u099a\u09cb\u09a6 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09bf ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u098f\u099f\u09be \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09aa\u09b0\u09bf\u0995\u09b2\u09cd\u09aa\u09bf\u09a4 \u0998\u099f\u09be\u09a8\u09cb \u0995\u09be\u09b0\u09a8 \u09a4\u09be\u09b0\u09be \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u09b8\u09b9\u09cd\u09af \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 \u09a8\u09be ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b0 \u09b8\u09b0\u0995\u09be\u09b0\u09c7\u09b0 \u0989\u099a\u09bf\u09a4 \u09b0\u09b9\u09bf\u0999\u09be\u09a6\u09c7\u09b0 \u099c\u09bf\u09ac\u09a8 \u09b0\u0995\u09cd\u09b7\u09be \u0995\u09b0\u09be \u09a4\u09ac\u09c7 \u09af\u09a6\u09bf \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09b8\u09b0\u0995\u09be\u09b0 \u09ae\u09a8\u09c7\u0995\u09b0\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u098f\u0995\u099f\u09bf \u099c\u09a8\u09ac\u09b9\u09c1\u09b2 \u09a6\u09c7\u09b6 \u098f\u09a6\u09c7\u09b6\u09c7 \u09b0\u09b9\u09bf\u0999\u09be\u09a6\u09c7\u09b0 \u0986\u09b6\u09cd\u09b0\u09df \u09a6\u09c7\u0993\u09df\u09be \u09b8\u09ae\u09cd\u09ad\u09ac \u09a8\u09df \u09a4\u09ac\u09c7 \u09b8\u09c7\u0996\u09c7\u09a4\u09cd\u09b0\u09c7 \u0986\u09ae\u09be\u09b0 \u09aa\u09b0\u09be\u09ae\u09b0\u09cd\u09b6 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u0985\u09a8\u09c7\u0995 \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u0985\u09ac\u09c8\u09a7 \u09ae\u09be\u09a8\u09c1\u09b7 \u09b0\u09df\u09c7\u099b\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0\u0995\u09c7 \u09ac\u09c7\u09b0\u0995\u09b0\u09c7 \u09a6\u09bf\u09df\u09c7 \u09b9\u09b2\u09c7\u0993 \u09b0\u09b9\u09bf\u0999\u09be\u09a6\u09c7\u09b0 \u099c\u09be\u09df\u0997\u09be \u09a6\u09c7\u0993\u09df\u09be \u0989\u099a\u09bf\u09a4 \u09ac\u09b2\u09c7 \u09ae\u09a8\u09c7\u0995\u09b0\u09bf \u09a4\u09ac\u09c7 \u0985\u09a8\u09c7\u0995\u09c7 \u0986\u09ac\u09be\u09b0 \u09ad\u09be\u09ac\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7\u09a8 \u0986\u09ae\u09bf \u0995\u09c7\u09a8\u09cb \u09ad\u09be\u09b0\u09a4\u09c0\u09df\u09a6\u09c7\u09b0 \u09ac\u09c7\u09b0 \u0995\u09b0\u09c7 \u09a6\u09c7\u0993\u09df\u09be\u09b0 \u0995\u09a5\u09be \u09ac\u09b2\u09b2\u09be\u09ae \u098f\u099f\u09be \u09a8\u09bf\u09df\u09c7 \u0995\u09cb\u09a8 \u09b0\u09be\u099c\u09a8\u09c0\u09a4\u09bf \u0995\u09b0\u09be\u09b0 \u09b8\u09c1\u09af\u09cb\u0997 \u09a8\u09c7\u0987 \u0995\u09be\u09b0\u09a8 \u0986\u09ae\u09bf\u09a4\u09cb \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09ac\u09b8\u09ac\u09be\u09b8\u09b0\u09a4 \u09ac\u09cc\u09a6\u09cd\u09a7\u09a6\u09c7\u09b0 \u09ac\u09c7\u09b0 \u0995\u09b0\u09c7 \u09a6\u09bf\u09a4\u09c7 \u09ac\u09b2\u09bf\u09a8\u09be\u0987 \u0986\u09ae\u09bf \u09ac\u09b2\u09c7\u099b\u09bf \u0985\u09ac\u09c8\u09a7 \u09ad\u09be\u09b0\u09a4\u09c0\u09df\u09a6\u09c7\u09b0 \u09af\u09be\u09a6\u09c7\u09b0 \u09aa\u09b0\u09bf\u09ae\u09be\u09a3 \u09aa\u09cd\u09b0\u09be\u09df \u09a6\u09c1\u09b2\u0995\u09cd\u09b7", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u09b9\u09cb\u0995 \u09ac\u09be \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09b8\u09ac \u09ad\u09be\u09b0\u09a4\u09c0\u09df\u09b0\u09be \u0986\u09ae\u09be\u09b0 \u09ad\u09be\u0987", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0993\u09a8\u09be\u09b0 \u09a8\u09bf\u099c\u09c7\u09b0 \u09a6\u09c7\u09b6\u09c7 \u099f\u09cd\u09b0\u09c7\u09a8 \u09a6\u09c1\u09b0\u09cd\u0998\u099f\u09a8\u09be\u09df \u0986\u099c \u099c\u09a8 \u09ae\u09be\u09b0\u09be \u0997\u09c7\u099b\u09c7 \u0993\u0987\u099f\u09be\u09b0 \u0996\u09ac\u09b0 \u09a8\u09be\u0987 \u0989\u09a8\u09bf \u0986\u099a\u09cd\u099a\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u0996\u09cb\u099c \u09a8\u09bf\u09a4\u09c7 \u09aa\u09be\u09b2\u09a4\u09c1 \u09b8\u09ac", + "output": [ + "Geopolitical" + ] + }, + { + "input": " \u09b6\u09be\u09b2\u09be \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09a8\u09b0\u09be \u09a8\u09bf\u099c\u09c7\u09a6\u09c7\u09b0 \u09ad\u09be\u09b7\u09be\u09df \u0995\u09a5\u09be\u0987 \u09ac\u09b2\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 \u09a8\u09be \u0986\u09ac\u09be\u09b0 \u099b\u09be\u0997\u09b2\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0 \u09ae\u09a4 \u09b2\u09be\u09ab\u09be\u0987 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u098f\u09b8\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u098f\u09b0 \u09b8\u09ac\u09be\u09b0 \u09a7\u09a8 \u09b2\u09be\u09b0\u09a4", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u0995\u09cb\u09a8 \u09a6\u09bf\u09a8 \u09af\u09c1\u09a6\u09cd\u09a7 \u09b2\u09be\u0997\u09ac\u09c7 \u09a8\u09be \u098f\u0987 \u0996\u09ac\u09b0 \u09ac\u09be\u09a6 \u09a6\u09bf\u09df\u09c7 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09a6\u09c7\u09b0 \u0995\u09bf \u0996\u09ac\u09b0 \u09b8\u09c7 \u0996\u09ac\u09b0 \u09a6\u09c7\u09a8 \u0986\u09b6\u09be \u0995\u09b0\u09bf \u0985\u09b2\u09cd\u09aa \u09b8\u09ae\u09df\u09c7\u09b0 \u09ae\u09a7\u09cd\u09af \u09aa\u09be\u09ac\u09cb ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u09a1\u09be\u0995\u09be\u09a4 \u098f\u09b0 \u09ae\u09a4\u09cb \u0995\u09be\u099c \u0995\u09b0\u099b\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09a6\u09b0\u09cd\u09b6\u0995\u09aa\u09cd\u09b0\u09bf\u09df \u09b8\u09bf\u09b0\u09bf\u09df\u09be\u09b2 \u09a4\u09cb\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09cd\u09ac\u09be\u09b0\u09be \u09b9\u09ac\u09c7 \u09a8\u09be \u09b9\u09be\u0989 \u09ae\u09be\u0989 \u0995\u09b0 \u0995\u09c7\u09a8 \u0985\u09a5\u099a \u09af\u0996\u09a8 \u098f\u0995\u09c7\u09b0 \u09aa\u09b0 \u098f\u0995 \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09b8\u09bf\u09b0\u09bf\u09df\u09be\u09b2 \u09a1\u09c1\u09ac\u09c7 \u09af\u09be\u099a\u09cd\u099b\u09bf\u09b2 \u09a4\u0996\u09a8 \u0995\u09ae\u09cd\u09ac\u09b2 \u0997\u09be\u09df\u09c7 \u099b\u09bf\u09b2 \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09b8\u09bf\u09b0\u09bf\u09df\u09be\u09b2 \u09a5\u09c7\u0995\u09c7 \u09ac\u09bf\u09ae\u09c1\u0996\u09c0 \u0995\u09b0\u09c7\u099b\u09c7 \u09b8\u09c1\u09b2\u09a4\u09be\u09a8 \u09b8\u09c1\u09b2\u09c7\u09ae\u09be\u09a8 \u09b8\u09bf\u09b0\u09bf\u09df\u09be\u09b2 \u09a6\u09c0\u09aa\u09cd\u09a4\u09bf \u099f\u09bf\u09ad\u09bf \u099a\u09be\u09b2\u09bf\u09df\u09c7 \u09af\u09be\u0993 \u099a\u09cd\u09af\u09be\u09a8\u09be\u09b2\u09c7\u09b0 \u09b8\u09be\u09ae\u09a8\u09c7 \u09a6\u09be\u0981\u09dc\u09be\u09a4\u09c7 \u0986\u09b8\u09b2\u09c7 \u09aa\u09bf\u09a0\u09c1\u09a8\u09bf \u09a6\u09bf\u09ac\u09be \u09b9\u09c7\u09a4\u09c7 \u0997\u09cb \u099a\u09c7\u09a4\u09a8\u09be \u0995\u09c7\u09a8 \u098f\u09a4 \u09ac\u09c7\u09b6\u09c0", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a5\u09be\u09a8\u09c0\u09a6\u09c7\u09b0 \u09a8\u09be \u09ae\u09c7\u09b0\u09c7 \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09ac\u09be\u09b9\u09bf\u09a8\u09bf\u09b0 \u0989\u099a\u09bf\u09a4 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c0\u09a6\u09c7\u09b0 \u09ae\u09be\u09b0\u09be ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09b8\u09be\u09b2\u09c7 \u09ad\u09be\u09b0\u09a4 \u09af\u09c7\u09ad\u09be\u09ac\u09c7 \u09ac\u09be\u0982\u0999\u09cd\u0997\u09be\u09b2\u09c0\u09a6\u09c7\u09b0 \u0986\u09b6\u09cd\u09b0\u09df \u09a6\u09bf\u09df\u09c7 \u09aa\u09b0\u09ac\u09b0\u09cd\u09a4\u09bf\u09a4\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0 \u09a8\u09cd\u09af\u09be\u09af\u09cd\u09af \u0985\u09a7\u09bf\u0995\u09be\u09b0 \u09ab\u09c7\u09b0\u09a4 \u09aa\u09c7\u09a4\u09c7 \u09aa\u09a6\u0995\u09cd\u09b7\u09c7\u09aa \u09a8\u09bf\u09df\u09c7\u099b\u09bf\u09b2 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09a6\u09c7\u09b0 \u0995\u09cd\u09b7\u09c7\u09a4\u09cd\u09b0\u09c7 \u0993 \u09ae\u09be\u09a8\u09ac\u09a4\u09be\u09b0 \u0996\u09be\u09a4\u09bf\u09b0\u09c7 \u098f\u0987 \u09b8\u09ae\u09be\u09b8\u09cd\u09af\u09be\u09b0 \u09b8\u09cd\u09b9\u09be\u09df\u09c0 \u09b8\u09ae\u09be\u09a7\u09be\u09a8\u09c7 \u098f\u0995\u0987 \u09aa\u09cd\u09b0\u0995\u09cd\u09b0\u09bf\u09df\u09be\u09df \u09ac\u09cd\u09af\u09ac\u09b8\u09cd\u09b9\u09be \u09a8\u09c7\u0993\u09df\u09be \u09b9\u09cb\u0995 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09af\u09c7\u0996\u09be\u09a8\u09c7 \u09ae\u09cb\u09a6\u09bf\u09b0 \u09ae\u09a4\u09cb \u099c\u0999\u09cd\u0997\u09bf \u09b8\u09a8\u09cd\u09a4\u09cd\u09b0\u09be\u09b8\u09c0 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b0\u09be\u09b7\u09cd\u099f\u09cd\u09b0 \u0995\u09cd\u09b7\u09ae\u09a4\u09be\u09df \u09b8\u09c7 \u0995\u09b0\u09ac\u09c7 \u0986\u09ac\u09be\u09b0 \u099c\u0999\u09cd\u0997\u09bf \u09a6\u09ae\u09a8", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0995\u09df\u09c7\u0995 \u09a6\u09bf\u09a8 \u09aa\u09b0 \u09ac\u09be\u09b2\u0995\u09be\u09a4\u09be \u09aa\u09a4\u09cd\u09b0\u09bf\u0995\u09be \u09ac\u09b2\u09ac\u09c7 \u09b8\u09be\u09b0\u09cd\u099c\u09bf\u0995\u09cd\u09af\u09be\u09b2 \u09b8\u09cd\u099f\u09be\u0987\u0995 \u0995\u09b0\u09c7\u099b\u09c7 \u09ad\u09be\u09b0\u09a4\u09bf\u0993 \u09b6\u09c1\u0993\u09b0 \u09a8\u09be\u09ae\u09c7\u09b0 \u099c\u09c1\u0993\u09df\u09be\u09a8", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0995\u09bf\u099b\u09c1 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c0 \u0995\u09cd\u09b0\u09bf\u0995\u09c7\u099f\u09ac\u09cb\u09a6\u09cd\u09a7\u09be\u09a6\u09c7\u09b0 \u09ae\u09a4\u09c7 \u09ad\u09be\u09b0\u09a4 \u09b8\u09be\u09b2\u09c7 \u0996\u09c7\u09b2\u09be \u09a4\u09be\u09a6\u09c7\u09b0 \u09aa\u09cd\u09b0\u09a5\u09ae \u099f\u09c7\u09b8\u09cd\u099f \u09ae\u09cd\u09af\u09be\u099a \u09a5\u09c7\u0995\u09c7 \u09aa\u09cd\u09b0\u09a4\u09bf\u099f\u09bf \u09ae\u09cd\u09af\u09be\u099a\u09c7\u0987 \u099a\u09bf\u099f\u09bf\u0982 \u0995\u09b0\u09c7 \u098f\u09b8\u09c7\u099b\u09c7 \u09af\u09be \u09b8\u09be\u09b0\u09be \u09aa\u09c3\u09a5\u09bf\u09ac\u09c0\u09b0 \u0995\u09c7\u0989 \u0995\u09cb\u09a8\u0993\u09a6\u09bf\u09a8 \u09ac\u09c1\u099d\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 \u09a8\u09bf \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09b8\u09be\u09b2\u09c7\u09b0 \u09ac\u09bf\u09b6\u09cd\u09ac\u0995\u09be\u09aa \u0995\u09cb\u09df\u09be\u09b0\u09cd\u099f\u09be\u09b0 \u09ab\u09be\u0987\u09a8\u09be\u09b2 \u09ae\u09cd\u09af\u09be\u099a\u09c7 \u09b8\u09b0\u09cd\u09ac\u09aa\u09cd\u09b0\u09a5\u09ae \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u098f\u0987 \u099a\u09bf\u099f\u09bf\u0982 \u09a7\u09b0\u09c7 \u09ab\u09c7\u09b2\u09c7 \u098f\u0987\u09b8\u09ac \u0995\u09cd\u09b0\u09bf\u0995\u09c7\u099f\u09ac\u09cb\u09a6\u09cd\u09a7\u09be\u09b0\u09be", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0990 \u09ad\u09be\u09b0\u09a4\u09bf \u09a6\u09c7\u0996\u09bf\u09b8 \u0986\u09ac\u09be\u09b0 \u0987\u09b8\u09b0\u09be\u0987\u09b2\u09c7\u09b0 \u09ae\u09a4 \u0986\u0997\u09c1\u09a8 \u099c\u09b2\u09c7 \u0995\u09bf \u09a8\u09be ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0985\u09be\u09aa\u09a8\u09bf \u0995\u09bf \u0985\u09be\u09aa\u09a8\u09be\u09b0 \u09aa\u09c7\u0987\u099c \u099c\u09a8\u09aa\u09cd\u09b0\u09bf\u09df \u0995\u09b0\u09a4\u09c7 \u099a\u09be\u09a8 \u09a4\u09cb \u09a6\u09c7\u09b0\u09bf \u0995\u09bf\u09b8\u09c7\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf\u09a6\u09bf\u09a8 \u09ad\u09be\u09b0\u09a4 \u09ac\u09bf\u09b0\u09cb\u09a7\u09bf \u09ad\u09c1\u09df\u09be \u0996\u09ac\u09b0 \u09a6\u09bf\u09a4\u09c7 \u09a5\u09be\u0995\u09c1\u09a8 \u098f\u09ac\u0982 \u09a6\u09c7\u0996\u09c1\u09a8 \u0985\u09be\u09aa\u09a8\u09be\u09b0 \u09aa\u09c7\u0987\u099c \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09b8\u09c7\u09b0\u09be \u09aa\u09c7\u0987\u099c \u09b9\u09ac\u09c7 \u09af\u09c7\u09ae\u09a8\u099f\u09be \u0995\u09b0\u09c7 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09bf \u09a6\u09be\u09b2\u09be\u09b2 \u09a8\u09df\u09be \u09a6\u09bf\u0997\u09a8\u09cd\u09a4 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c0\u09af\u09bc \u09b8\u09c7\u09a8\u09be\u099b\u09be\u0989\u09a8\u09c0\u0997\u09c1\u09b2\u09cb \u0995\u09bf \u0996\u09c1\u09ac\u0987 \u0985\u09b0\u0995\u09cd\u09b7\u09bf\u09a4 \u09a8\u09be\u0995\u09bf \u09a4\u09be\u09b0\u09be \u09b8\u09a0\u09bf\u0995 \u09ad\u09be\u09ac\u09c7 \u09a6\u09be\u09df\u09bf\u09a4\u09cd\u09ac \u09aa\u09be\u09b2\u09a8 \u09a8\u09be \u0995\u09b0\u09c7 \u09b8\u09ac\u09be\u0987 \u098f\u09dc\u09bf\u09df\u09c7 \u09af\u09be\u099a\u09cd\u099b\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09af\u09c1\u09a6\u09cd\u09a7 \u098f\u099f\u09be \u0987\u0989\u09b0\u09cb\u09aa \u0986\u09ae\u09c7\u09b0\u09bf\u0995\u09be\u09b0 \u09b7\u09dc\u09af\u09a8\u09cd\u09a4\u09cd\u09b0 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09ad\u09be\u09b2 \u09a5\u09be\u0995\u09a4\u09c7 \u09a6\u09c7\u09ac\u09c7 \u09a8\u09be \u0993\u09b0\u09be ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09a8\u09bf\u0989\u099c \u098f\u099f\u09be \u09a8\u09bf\u09df\u09c7 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09ae\u09be\u09a5\u09be \u09ac\u09cd\u09af\u09a5\u09be \u0995\u09b0\u09c7 \u09b2\u09be\u09ad \u09a8\u09c7\u0987", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0995\u09c7\u0989 \u09ad\u09be\u09b0\u09a4 \u0995\u09c7\u0989 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u0995\u09c7\u0989 \u0995\u09c7\u0989 \u0986\u09ac\u09be\u09b0 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09c7\u09b0 \u09a8\u09be\u09ae \u09a6\u09bf\u09df\u09c7 \u09b9\u09be \u09b9\u09be \u09b9\u09be \u09b9\u09be \u09b9\u09be \u09ae\u099c\u09be\u09df \u0986\u099b\u09c7\u09a8 \u09ae\u09a8\u09c7 \u09b9\u09df \u0986\u09aa\u09a8\u09be\u09b0\u09be ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u0997 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09c7\u09b0 \u09a6\u09c7\u09b6 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u098f\u0996\u09be\u09a8\u09c7\u0987 \u099c\u09be\u0995\u09bf\u09b0 \u09a8\u09be\u09df\u0995\u09c7\u09b0 \u0995\u09be\u09b0\u09cd\u099c\u0995\u09ae \u09ac\u09a8\u09cd\u09a7 \u09b9\u09df\u09c7 \u0997\u09c7\u09b2 \u0986\u09b0 \u09ad\u09be\u09b0\u09a4 \u09a4\u09be\u09b0 \u0995\u09be\u09b0\u09cd\u099c\u0995\u09ae \u09ac\u09a8\u09cd\u09a7 \u0995\u09b0\u09a4\u09c7\u09b0 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u098f\u09a4 \u09a8\u0982\u09b0\u09be \u09b0\u09be\u099c\u09a8\u09c0\u09a4\u09bf \u09a4\u09be \u0986\u09ae\u09b0\u09be \u09ad\u09be\u09b2 \u09ad\u09be\u09ac\u09c7\u0987 \u099c\u09be\u09a8\u09bf ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u09a6\u09b6 \u0995\u09c1\u099f\u09bf \u0995\u09bf\u09a8\u09b2\u09c7 \u09b2\u09be\u09ad \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u0995\u09cb\u09a8 \u0995\u09be\u099c\u09c7 \u0986\u09b8\u09ac\u09c7\u09a8\u09be \u09ac\u09dc \u09ac\u09be\u09aa \u09aa\u09be\u0995 \u0986\u09b0 \u099a\u09c0\u09a8", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09a8\u09be\u0997\u09b0\u09bf\u0995 \u0995\u09bf\u09ad\u09be\u09ac\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u098f\u09b8\u09c7 \u09ac\u09bf\u09a6\u09c7\u09b6 \u09aa\u09be\u09a0\u09be\u09df", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ac\u09bf\u098f\u09b8\u098f\u09ab \u09b9\u099a\u09cd\u099b\u09c7 \u0995\u09cd\u09b0\u09bf\u09ae\u09bf\u09a8\u09be\u09b2 \u099a\u09c0\u09a8-\u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09b8\u09c0\u09ae\u09be\u09a8\u09cd\u09a4\u09c7 \u09ae\u09be\u0987\u09b0 \u0996\u09be\u09df \u0986\u09b0 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09b8\u09c0\u09ae\u09be\u09a8\u09cd\u09a4\u09c7 \u09aa\u09be\u0997\u09b2\u09be \u0995\u09c1\u0995\u09c1\u09b0\u09c7\u09b0 \u09ae\u09a4 \u0997\u09c1\u09b2\u09bf \u099b\u09c1\u09dc\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09a7\u09b0\u09cd\u09b7\u09a8\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09a4\u09be\u09a6\u09c7\u09b0 \u099a\u09b2\u099b\u09bf\u09a4\u09cd\u09b0 \u09a6\u09be\u0987 \u09ae\u09bf\u09a1\u09bf\u09df\u09be\u0987 \u09a4\u09be\u09a6\u09c7\u09b0 \u09b8\u09b0\u09cd\u09ac\u09a8\u09be\u09b8 \u0995\u09b0\u099b\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b8\u09c7\u09a8\u09be\u09b0\u09be \u09b8\u09b0\u0995\u09be\u09b0\u09bf\u09ad\u09be\u09ac\u09c7 \u09b2\u09bf\u099f\u09be\u09b0 \u09ae\u09a6 \u09aa\u09be\u09df \u09ae\u09be\u09b8\u09c7 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09bf \u09b8\u09c7\u09a8\u09be\u09b0\u09be \u09aa\u09be\u09df \u0995\u09c7\u099c\u09bf \u0995\u09b0\u09c7 \u0986\u0999\u09c1\u09b0 \u09ab\u09b2 \u09ad\u09be\u09b0\u09a4\u09c0\u09df\u09b0\u09be \u099c\u09ac\u09be\u09ac \u09a6\u09c7\u09ac\u09c7 \u0995\u09bf\u09ad\u09be\u09ac\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u0986\u0997\u09c7 \u09ad\u09be\u09ac\u09c1\u0995 \u09af\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7 \u0995\u09cb\u099f\u09bf \u099c\u09a8\u0997\u09a8 \u0986\u09b0 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u0995\u09cb\u099f\u09bf \u099c\u09a8\u0997\u09a8 \u0986\u09ae\u09b0\u09be \u099a\u0986\u0987 \u09a8\u09be \u0995\u09cb\u09a8\u09cb \u09b8\u0982\u0998\u09be\u09a4 \u09b9\u09cb\u0995", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u099f\u09cd\u09b0\u09c7\u09a8 \u09a6\u09c1\u09b0\u09cd\u0998\u099f\u09a8\u09be\u09df \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09b0\u09be\u099c\u09a8\u09c0\u09a4\u09bf \u09af\u09a4\u099f\u09be \u09ae\u09b0\u09cd\u09ae\u09be\u09b9\u09a4 \u0993 \u09b6\u09cb\u0995\u09be\u0997\u09cd\u09b0\u09b8\u09cd\u09a4", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09a4\u09cb\u09b0 \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09b0\u09c7 \u099a\u09cb\u09a6\u09ac\u09c7 \u099a\u09bf\u09a8 \u098f\u09ac\u0982 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u0986\u09ae\u09be\u09b0 \u09ac\u09be\u09b2 \u099b\u09bf\u09dc\u09ac\u09c7 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09a7\u09b0\u09cd\u09ae \u09a8\u09be\u09ae\u099f\u09be\u09b0\u09c7 \u09a6\u09c1\u09a8\u09bf\u09df\u09be\u09b0 \u09ae\u09be\u09a8\u099a\u09bf\u09a4\u09cd\u09b0 \u09a5\u09c7\u0995\u09c7 \u09ae\u09c1\u099b\u09c7 \u09a6\u09bf\u09ac\u09c7 \u099a\u09bf\u09a8 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09b9\u09bf\u099c\u09b0\u09be\u09b2 \u09a6\u09b2 \u099a\u09be\u09b0\u09be\u09b2 \u09a8\u09be\u09aa\u09bf\u09a4 \u09ab\u09c7\u09a4\u09b0\u09be \u0988\u09a4\u09cd\u09af\u09be\u09a6\u09bf \u0995\u09bf\u099b\u09c1\u0987 \u09a5\u09be\u0995\u09ac\u09c7 \u09a8\u09be", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09af\u09c1\u09a6\u09cd\u09a7 \u09b9\u09b2\u09c7 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a5\u09be\u09a8 \u0995\u09c7 \u09eb \u09ae\u09bf\u09a8\u09bf\u099f \u098f\u09b0 \u09ae\u09cb\u09a7\u09cd\u09af \u09a6\u09c1\u09a8\u09bf\u09df\u09be\u09b0 \u09ae\u09cd\u09af\u09be\u09aa \u09a5\u09c7\u0995\u09c7 \u09ae\u09c1\u099b\u09c7 \u09ab\u09c7\u09b2\u09ac ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09ac\u09b0\u09cd\u09b7\u09c7 \u09ac\u09b8\u09ac\u09be\u09b8 \u0995\u09b0\u09c7 \u0986\u09b0 \u09ad\u09be\u09b0\u09a4\u09ac\u09b0\u09cd\u09b7\u0995\u09c7\u0987 \u0998\u09c3\u09a8\u09be \u0995\u09b0\u09c7 \u098f\u099f\u09be \u0995\u09bf \u09a0\u09bf\u0995 \u0995\u09be\u099c \u09b8\u09b0\u09cd\u09ac \u09a7\u09b0\u09cd\u09ae \u09b8\u09ae\u09a8\u09cd\u09ac\u09df\u09c7 \u0997\u09a0\u09bf\u09a4 \u09ad\u09be\u09b0\u09a4\u09ac\u09b0\u09cd\u09b7 \u09ad\u09be\u09b2\u09cb\u09ac\u09be\u09b8\u09a4\u09c7 \u09b6\u09bf\u0996 \u09a4\u09be\u09b9\u09b2\u09c7\u0987 \u09ad\u09be\u09b2\u09cb\u09ac\u09be\u09b8\u09be \u09aa\u09be\u09ac\u09c7 \u09b8\u09a8\u09cd\u09ae\u09be\u09a8 \u09aa\u09be\u09ac\u09c7 \u09a4\u09be \u09a8\u09be\u09b9\u09b2\u09c7 \u09af\u09a4\u09cb \u09ac\u09dc\u09cb \u09b6\u09bf\u09b2\u09cd\u09aa\u09c0\u0987 \u09b9\u09cb\u0995 \u0995\u09c7\u09a8\u09cb \u09ae\u09b0\u09cd\u09af\u09be\u09a6\u09be \u09a6\u09bf\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09cb \u09a8\u09be \u0995\u09c7\u09a8\u09cb \u09b8\u09a8\u09cd\u09ae\u09be\u09a8 \u09a6\u09bf\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09cb \u09a8\u09be \u0995\u09c7\u09a8\u09cb \u09ad\u09be\u09b2\u09cb\u09ac\u09be\u09b8\u09be \u09aa\u09be\u09ac\u09c7 \u09a8\u09be \u09b6\u09c1\u09a7\u09c1 \u0998\u09c3\u09a8\u09be \u0998\u09c3\u09a3\u09be \u0998\u09c3\u09a3\u09be \u0998\u09c3\u09a3\u09be", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u098f\u0995\u099f\u09be \u0995\u09a5\u09be\u0987 \u09ac\u09b2\u09cb\u09a8\u09be \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09b9\u09b2 \u098f\u0995\u099f\u09be \u099c\u0999\u09cd\u0997\u09bf \u09ac\u09be\u09a6\u09bf \u09a6\u09c7\u09b6", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u0985\u09a8\u09c7\u0995 \u09b0\u09c1\u099a\u09bf\u09b6\u09c0\u09b2 \u09a8\u09be\u099f\u09cb\u0995 \u099f\u09c7\u09b2\u09bf\u09ab\u09cd\u09b2\u09bf\u09ae \u0986\u099b\u09c7 \u09af\u09c7\u0997\u09c1\u09b2\u09cb \u09b8\u09ac\u09be\u0987 \u09a6\u09c7\u0996\u09c7 \u098f\u0996\u09a8 \u09af\u09c1\u0995\u09cd\u09a4 \u09b9\u0987\u099b\u09c7 \u0995\u09bf\u099b\u09c1 \u09ad\u09be\u09b0\u09a4\u09bf\u0993 \u099a\u09cd\u09af\u09be\u09a8\u09c7\u09b2 \u09af\u09be \u09ac\u09be\u0982\u09b2\u09be\u09b0 \u09ae\u09c7\u09df\u09c7\u09a6\u09c7\u09b0 \u09ae\u09be\u09a5\u09be \u0996\u09be\u09b0\u09be\u09aa \u0995\u09b0\u09c7\u099b\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0986\u099a\u09cd\u099b\u09be \u09b8\u09ac\u09be\u0987 \u09ac\u09bf\u09ac\u09c7\u0995 \u09a5\u09c7\u0995\u09c7 \u0989\u09a4\u09cd\u09a4\u09b0 \u09a6\u09bf\u09a8 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u0995\u09bf \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u099c\u09c0\u09ac\u09a8\u09c7 \u0993 \u09aa\u09be\u09b0\u09ac\u09c7 \u098f\u099f\u09be \u0995\u09bf \u09b8\u09ae\u09cd\u09ad\u09ac \u09a4\u09be\u099b\u09be\u09dc\u09be \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u099c\u09a8\u0997\u09cb\u09b7\u09cd\u09a0\u09c0 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u0986\u099b\u09c7 \u098f\u09ac\u0982 \u09a4\u09be\u09b0\u09be \u09a8\u09bf\u099c\u09c7\u09b0 \u09a6\u09c7\u09b6\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09b8\u09ac \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 \u0986\u09b0 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u0995\u09bf\u099b\u09c1 \u099c\u09a8\u0997\u09cb\u09b7\u09cd\u09a0\u09c0 \u09a8\u09bf\u099c\u09c7\u09b0 \u09a6\u09c7\u09b6\u0995\u09c7 \u09a8\u09be \u0995\u09b0\u09c7 \u0985\u09a8\u09cd\u09af \u09a6\u09c7\u09b6\u09c7\u09b0 \u09b9\u09df\u09c7 \u09a6\u09be\u09b2\u09be\u09b2\u09c0 \u0995\u09b0\u09c7 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": " \u0985\u09a8\u09cd\u09a8\u09a6\u09b2 \u0995\u09cd\u09b7\u09ae\u09a4\u09be\u09df \u0986\u09b8\u09b2\u09c7 \u0997\u09c1\u09ae \u0996\u09c1\u09a8 \u09ac\u09a8\u09cd\u09a6 \u09b9\u09ac\u09c7 \u09b8\u09a8\u09cd\u09a4\u09be\u09a8 \u098f\u09a4\u09bf\u09ae \u09b9\u09ac\u09c7\u09a8\u09be \u0987\u09b8\u09cd\u09a4\u09cd\u09b0\u09bf \u09ac\u09bf\u09a7\u09ac\u09be \u09b9\u09ac\u09c7\u09a8\u09be \u09ae\u09b8\u099c\u09bf\u09a6\u09c7 \u09a4\u09be\u09b2\u09be \u099c\u09c1\u09b2\u09ac\u09c7\u09a8\u09be \u0986\u09b2\u09c7\u09ae \u0987\u09ae\u09be\u09ae \u09ae\u09be\u09a6\u09cd\u09b0\u09be\u09b8\u09be\u09b0\u09b0 \u099b\u09be\u09a4\u09cd\u09b0 \u0987\u09b8\u09b2\u09be\u09ae \u09aa\u09cd\u09b0\u09bf\u09df \u09ae\u09c1\u09b8\u09c1\u09b2\u09cd\u09b2\u09bf \u099c\u09c7\u09b2\u09c7 \u09af\u09be\u09ac\u09c7\u09a8\u09be \u09b6\u09c7 \u0985\u0995\u09cd\u099f\u09cb\u09ac\u09b0 \u09b9\u09ac\u09c7\u09a8\u09be \u09aa\u09c7\u09b2\u09be\u09a8\u09bf\u09b0 \u09b2\u09be\u09b6 \u09b8\u09bf\u09ae\u09be\u09a8\u09cd\u09a4\u09c7\u09b0 \u09a4\u09be\u09b0 \u0995\u09be\u099f\u09be\u09df \u099c\u09c1\u09b2\u09ac\u09c7\u09a8\u09be \u098f\u09ae \u0987\u09b2\u09bf\u09df\u09be\u099a \u0986\u09b2\u09bf\u09b0 \u098f\u09a4\u09bf\u09ae \u09b8\u09a8\u09cd\u09a4\u09be\u09a8 \u09ac\u09be\u09ac\u09be \u0996\u09c1\u099c\u09ac\u09c7\u09a8\u09be \u09b8\u09be\u09b2\u09be\u0989\u09a6\u09cd\u09a6\u09bf\u09a8\u09c7\u09b0 \u09ae\u09a4 \u09b0\u0995\u09cd\u09b7\u09a8 \u09b6\u09bf\u09b2 \u09b0\u09be\u099c\u09a8\u09bf\u09a4\u09bf \u09ac\u09bf\u09a7\u09b0\u09be \u09aa\u09cd\u09b0\u09a4\u09bf \u09b9\u09bf\u0982\u09b8\u09be\u09b0 \u0995\u09be\u09b0\u09a3\u09c7 \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09b0 \u099c\u09c7\u09b2\u09c7 \u09aa\u0981\u099a\u09ac\u09c7\u09a8\u09be ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09ae\u09c1\u0995\u09cd\u09a4\u09bf\u09af\u09cb\u09a6\u09cd\u09a7\u09be\u09b0\u09be \u09a8\u09be \u0996\u09c7\u09df\u09c7 \u09a6\u09bf\u09a8 \u0995\u09be\u099f\u09be\u099a\u09cd\u099b\u09c7 \u0986\u09b0 \u09ad\u09be\u09b0\u09a4\u09c7 \u099a\u09b2\u099b\u09c7 \u09a4\u09c7\u09b2 \u09ae\u09be\u09b2\u09bf\u09b6 ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u098f\u0987 \u09b6\u09be\u09b2\u09be \u09ae\u09be\u09a6\u09be\u09b0\u099a\u09cb\u09a6 \u09a4\u09be\u0995\u09bf\u09af\u09bc\u09c7 \u09a6\u09c7\u0996 \u0990 \u09b2\u09be\u09b2 \u09b8\u09ac\u09c1\u099c\u09c7\u09b0 \u09aa\u09a4\u09be\u0995\u09be\u09b0 \u09a6\u09bf\u0995\u09c7 \u098f\u0996\u09a8\u09cb \u099a\u09bf\u09ce\u0995\u09be\u09b0 \u0995\u09b0\u09c7 \u09ac\u09b2\u09a4\u09c7\u099b\u09c7 \u09b6\u09b9\u09c0\u09a6 \u09ad\u09be\u0987\u09a6\u09c7\u09b0 \u0995\u09a5\u09be ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u0995\u09be\u0989\u0995\u09c7 \u099f\u09be\u0995\u09be\u09b0 \u099c\u09bf\u09a8\u09bf\u09b8 \u09a6\u09bf\u09a4\u09c7 \u09ac\u09be\u09b0 \u09a2\u09c7\u0995\u09c1\u09b0 \u0997\u09bf\u09b2\u09c7 \u09aa\u09be\u09b6\u09be\u09aa\u09be\u09b6\u09bf \u0997\u09c1\u09a8 \u09b2\u09be\u09ad\u09c7\u09b0 \u09b9\u09bf\u09b8\u09c7\u09ac \u0995\u09b6\u09be\u0995\u09b6\u09bf \u09a4\u09cb \u0986\u099b\u09c7\u0987", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09b0\u09c1\u09aa\u09bf\u09b0 \u0989\u09aa\u09b0 \u09aa\u09cd\u09b0\u09b6\u09be\u09ac \u0995\u09b0\u09bf \u0986\u09ae\u09bf \u099a\u09cb\u0996\u09c7\u09b0 \u09b8\u09be\u09ae\u09a8\u09c7 \u0995\u09cb\u09a8\u09cb \u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09b0\u09c7\u09a8\u09a1\u09bf \u09aa\u09dc\u09b2\u09c7 \u09a4\u09be\u0995\u09c7 \u09ac\u09c1\u099d\u09be\u09ac\u09cb \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u0995\u09bf ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u0995\u09c7 \u09ac\u09a8\u09cd\u09a7\u09c1 \u09ad\u09be\u09ac\u09be\u09b0 \u099a\u09c7\u09af\u09bc\u09c7 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u0995\u09c7 \u09ac\u09a8\u09cd\u09a7\u09c1 \u09ad\u09be\u09ac\u09cb ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u099a\u09c0\u09a8 \u09ac\u09be\u09a7 \u09a6\u09bf\u09af\u09bc\u09c7\u099b\u09c7 \u09ac\u09cd\u09b0\u09ae\u09aa\u09c1\u09a4\u09cd\u09b0 \u09a8\u09a6\u09c7 \u09a4\u09cb \u0986\u09aa\u09a8\u09be\u09a6\u09c7\u09b0 \u09ae\u09a4\u09cb \u09ad\u09be\u09b0\u09a4 \u0998\u09c7\u09a8 \u0998\u09c7\u09a8 \u0995\u09b0\u099b\u09c7 \u0995\u09bf \u0995\u09c7\u09a8\u09cb \u0995\u09b0\u09ac\u09c7 \u09ad\u09be\u09b0\u09a4 \u09b8\u09b0\u0995\u09be\u09b0 \u0986\u09b0 \u098f\u0995\u099f\u09be \u09ac\u09be\u0981\u09a7 \u09ac\u09be\u0981\u09a7\u09bf\u09af\u09bc\u09c7 \u09a8\u09c7\u09ac\u09c7 \u0986\u09aa\u09a8\u09be\u09b0\u09be\u0989 \u09a8\u09bf\u09a8 \u0995\u09c7 \u09ac\u09be\u09b0\u09cb\u09a8 \u0995\u09b0\u09c7\u099b\u09c7 \u09a8\u09be \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u098f\u09b0 \u09a1\u09a8 \u098f\u09b0 \u0995\u09be\u099b\u09c7 \u099f\u09be\u0995\u09be \u0996\u09c7\u09af\u09bc\u09c7 \u09ad\u09be\u09b0\u09a4 \u09ac\u09bf\u09b0\u09cb\u09a7\u09bf\u09a4\u09be \u09aa\u09cd\u09b0\u099a\u09be\u09b0 \u0995\u09b0\u09c7\u09a8", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u0985\u09ac\u09c8\u09a7 \u09ad\u09be\u09b0\u09a4\u09c0\u09af\u09bc \u09a7\u09b0\u09c7 \u0997\u09a8 \u09a7\u09cb\u09b2\u09be\u0987 \u09a6\u09c7\u09af\u09bc\u09be \u0989\u099a\u09bf\u09ce ", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u0986\u09b0 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09ae\u09bf\u09b2\u09c7 \u0986\u09ae\u09be\u0995\u09c7 \u09e7 \u09b8\u09be\u09b9\u09aa\u09cd\u09a4\u09be\u09b9\u09b0 \u099c\u09a8\u09cd\u09af \u09b0\u09be\u099c\u09be \u09ac\u09be\u09a8\u09be\u0993 \u0986\u09ae\u09bf \u09b0\u09c7\u09a8\u09cd\u09a1\u09c0\u09df\u09be\u0995\u09c7 \u0989\u09a1\u09be\u0987 \u09a6\u09c0\u09ac\u09cb", + "output": [ + "Geopolitical" + ] + }, + { + "input": "\u099b\u09c7\u09b2\u09c7 \u09a6\u09c1\u0987\u099f\u09be\u0995\u09c7 \u09ad\u09be\u09b2\u09cb \u09b2\u09be\u0997\u099b\u09c7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09ae\u09c7\u09df\u09c7 \u099f\u09be\u0995\u09c7 \u09ad\u09be\u09b2\u09cb \u09b2\u09be\u0997\u09b2 \u09a8\u09be", + "output": [ + "Personal" + ] + }, + { + "input": "\u0986\u099c\u0995\u09c7\u09b0 \u09b8\u09cb \u09ac\u09be\u09b2\u09c7\u09b0 \u09b9\u0987\u099b\u09c7 \u099c\u09ae\u09c7 \u09a8\u09be\u0987 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b8\u09bf\u09df\u09be\u09ae \u09ad\u09be\u09b2\u09cb \u099f\u09be\u09df\u09be \u09ae\u09be\u0997\u09bf \u09ab\u09be\u09b2\u09a4\u09c1 \u09aa\u09be\u09b6\u09c7\u09b0 \u099b\u09c7\u09b2\u09c7\u099f\u09be \u0993 \u09ad\u09be\u09b2\u09cb", + "output": [ + "Personal" + ] + }, + { + "input": " \u09b8\u09c7 \u09ac\u09b2\u09c7\u099b\u09c7 \u09a4\u09be\u09b0 \u09ab\u09be\u09b8\u09bf \u09b9\u0993\u09df\u09be \u0989\u099a\u09bf\u09ce ", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u0987 \u09b8\u09be\u09b2\u09be\u09b0\u09c7 \u09ab\u09be\u09b8\u09bf \u09a6\u09c7\u09df\u09be \u09a6\u09b0\u0995\u09be\u09b0", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u0987 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09a1\u09be\u09b0\u09c7 \u098f\u0987 \u099a\u09cd\u09af\u09be\u09a8\u09c7\u09b2 \u098f \u0995\u09c7 \u0986\u09a8\u099b\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u0987\u09b8\u09ac \u099a\u09cb\u09a6\u09ae\u09be\u09b0\u09be\u09a8\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u09b0\u09be \u098f\u09a4 \u09aa\u099a\u09be\u09a8\u09bf \u0996\u09be\u09df \u09a4\u09be\u0993 \u09b6\u09bf\u0995\u09cd\u09b7\u09be \u09b9\u09df \u09a8\u09be ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09a4\u09cb\u09b0\u09be\u0987 \u09b8\u09ae\u09be\u099c \u09a8\u09b8\u09cd\u099f \u0995\u09b0\u09bf\u09b8 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ae\u09bf\u09df\u09be \u0987\u0989\u099f\u09bf\u0989\u09ac \u098f \u09b8\u09be\u09ac\u09b8\u09cd\u0995\u09cd\u09b0\u09be\u0987\u09ac \u09aa\u09be\u0993 \u09a8\u09be \u09a4\u09be\u0987 \u0993\u09a6\u09c7\u09b0 \u09ae\u09a4\u09cb \u09ae\u09be\u09a8\u09c1\u09b7 \u0995\u09c7 \u09ac\u09cd\u09af\u09ac\u09b9\u09be\u09b0 \u0995\u0987\u09b0\u09be \u09b8\u09be\u09ac\u09b8\u09cd\u0995\u09cd\u09b0\u09be\u0987\u09ac \u09a8\u09be\u0993 \u09a4\u09cb\u09ae\u09b0\u09be", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b0\u09be\u09aa\u09cd\u09aa\u09bf\u09af\u0982 \u098f\u09b0 \u099c\u0997\u09a4\u09c7 \u0986\u09aa\u09a8\u09be\u09b0 \u09b8\u09be\u09b2\u09ae\u09be\u09a8 \u09ae\u09cb\u0995\u09cd\u09a4\u09be\u09a6\u09bf\u09b0 \u09b8\u09ae\u09cd\u09b0\u09be\u099f \u09ad\u09be\u0987 \u098f\u09b0 \u099a\u09c1\u09b2\u09c7\u09b0 \u0995\u09be\u099b\u09c7\u0993 \u09a8\u09be\u0987", + "output": [ + "Personal" + ] + }, + { + "input": "\u09af\u09c7\u09ae\u09a8\u09c7 \u0996\u09be\u09b0\u09be\u09aa \u0995\u09a5\u09be \u0995\u09b8 \u0998\u09b0 \u09a5\u09c7\u0995\u09c7 \u09ac\u09c7\u09b0 \u0995\u09b0\u09c7 \u09a6\u09bf\u09ac\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": " \u09a6\u09c7\u09b6\u09c7\u09a8\u09c7\u098f\u09bf \u09ac\u09c7\u0997\u09ae \u0996\u09be\u09b2\u09c7\u09a6\u09be \u099c\u09bf\u09df\u09be \u0986\u09aa\u09a8\u09be\u0995\u09c7 \u0985\u09a8\u09c7\u0995 \u09a7\u09a8\u09cd\u09af\u09ac\u09be\u09a6 \u0986\u09aa\u09a8\u09bf \u099a\u09be\u09b2\u09bf\u09df\u09c7 \u099c\u09be\u09a8 \u098f\u09ac\u0982 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u0995\u09c7 \u099a\u09be\u09b2\u09bf\u09df\u09c7 \u09af\u09be\u0993\u09df\u09be\u09b0 \u09b8\u09c1\u09af\u09cb\u0997 \u09a6\u09bf\u09a8 \u0986\u09ae\u09b0\u09be \u09a4\u09cb \u0986\u09aa\u09a8\u09be\u09b0 \u0985\u09aa\u09c7\u0996\u09cd\u09af\u09be \u0986\u099b\u09bf ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u09ae\u09be\u0997\u09c0\u09ac\u09be\u099c\u09bf \u09a8\u09be \u0995\u09b0\u09b2\u09c7 \u0986\u09b2\u09cd\u09b2\u09be\u09b9 \u09a4\u09cb\u09b0 \u09a8\u09c1\u09a8\u09c1 \u09ac\u09dc\u0987 \u09b0\u09be\u0996\u09a4\u09cb ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b6\u09be\u09b2\u09be \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u0986\u09b0 \u09ae\u09be\u0997\u09bf", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ab\u0995\u09bf\u09a8\u09cd\u09a8\u09bf \u09af\u09a6\u09bf \u099c\u09be\u099c \u09b9\u09df \u09a4\u09be\u09b9\u09b2 \u098f\u09ae\u09a8\u0987 \u09b9\u0987\u09ac\u09cb ", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u09b8\u09ac \u0986\u09ac\u09be\u09b2 \u0997\u09c1\u09b2\u09be \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09b8\u09c1\u09a8\u09cd\u09a6\u09b0 \u09ac\u09bf\u09a8\u09cb\u09a6\u09a8 \u09a5\u09c7\u0995\u09c7 \u09a6\u09c2\u09b0\u09c7 \u09b0\u09be\u0996\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf \u0986\u0997\u09c7\u09b0 \u09a5\u09c7\u0995\u09c7\u0987 \u09ac\u09be\u09a7\u09be\u0987 \u09b0\u09be\u0996\u099b\u09c7 \u0986\u09b0 \u0995\u0987 \u09aa\u09b0\u09c7\u09b0 \u09ae\u09be\u09b8\u09c7\u0987 \u09ac\u09be\u09a7\u099b\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u099c\u09be\u09a4\u09bf\u09b8\u0982\u0998 \u09a8\u09be \u0995\u09bf \u09b6\u09df\u09a4\u09be\u09a8\u09c7\u09b0 \u09b8\u0982\u0998 \u0990 \u09ac\u09c7\u099f\u09be \u0995\u09c1\u09a4\u09cd\u09a4\u09be \u0986\u0987\u0982 \u09b8\u09be\u0982 \u09b8\u09c1\u099a\u09bf\u0982\u0995\u09c7 \u09ab\u09be\u09b8\u09bf\u09a4\u09c7 \u099d\u09cb\u09b2\u09be\u09a4\u09c7 \u09b9\u09ac\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf\u09b0 \u099a\u09bf\u09b9\u09be\u09b0\u09be \u09a6\u09c7\u0996\u09b2\u09c7 \u09aa\u09bf\u099f\u09be\u09a4\u09c7 \u09ae\u09a8 \u099a\u09be\u09df", + "output": [ + "Personal" + ] + }, + { + "input": "\u0986\u099c\u09be\u0987\u09b0\u09be \u0986\u09b2\u09be\u09aa \u0995\u09ae \u0995\u0987\u09b0\u09be \u09aa\u09be\u09b0\u09b2\u09c7 \u09ad\u09be\u09b2\u09be \u0995\u09bf\u099b\u09c1 \u09a8\u09bf\u09df\u09be \u0995\u09a5\u09be \u0995\u0987\u09df\u09be \u09a6\u09c7\u0996\u09be\u0987\u0993 \u09ab\u09be\u0989\u09b2 \u09ae\u09bf\u09df\u09be", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ae\u09be\u09a6\u09be\u09b0\u099a\u09c1\u09a6 \u09a4\u09b0\u09c7 \u09a6\u09c7\u0996\u09b2\u09c7\u0987 \u09ae\u09c7\u099c\u09be\u099c \u0996\u09be\u09b0\u09be\u09aa \u09b9\u09df\u09c7 \u09af\u09be\u09df", + "output": [ + "Personal" + ] + }, + { + "input": "\u09aa\u09cd\u09b0\u09a5\u09ae \u0986\u09b2\u09cb \u09a4\u09c7 \u09af\u09be\u09b0\u09be \u099a\u09be\u0995\u09b0\u09bf \u0995\u09b0\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0 \u09b8\u09ac\u09be\u09b0 \u09ae\u09be\u09df\u09c7\u09b0 \u0997\u09a8\u09cb\u09b0\u09bf\u09df\u09be \u099b\u09bf\u09b2 \u09af\u0996\u09a8 \u09a4\u09be\u09b0\u09be \u09a4\u09be\u09a6\u09c7\u09b0 \u09ae\u09be\u09df\u09c7\u09b0 \u0997\u09b0\u09cd\u09ad\u09c7 \u099b\u09bf\u09b2 \u09b8\u09c7\u09b2\u09bf\u09ae \u0993\u09b8\u09ae\u09be\u09a8 \u098f\u09b0 \u0995\u09cb\u09a5\u09be\u09df \u09a0\u09bf\u0995 \u098f\u0995 \u09a8\u09ae\u09cd\u09ac\u09b0 \u098f\u09b0 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ab\u09be\u0995 \u0987\u0989 \u09ac\u09cd\u09b2\u09be\u09a1\u09bf \u09b8\u09be\u099c\u09c1 \u0996\u09be\u09a6\u09c7\u09ae ", + "output": [ + "Personal" + ] + }, + { + "input": " \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u0987 \u09b9\u09df\u09a4 \u098f\u0995 \u09ae\u09be\u09a4\u09cd\u09b0 \u09a6\u09c7\u09b6 \u09aa\u09c3\u09a5\u09bf\u09ac\u09c0\u09a4\u09c7 \u09af\u09c7\u0996\u09be\u09a8\u09c7 \u0997\u09a3\u09a4\u09a8\u09cd\u09a4\u09cd\u09b0\u09c7\u09b0 \u09a8\u09be\u09ae\u09c7 \u09aa\u09b0\u09bf\u09ac\u09be\u09b0\u09a4\u09a8\u09cd\u09a4\u09cd\u09b0\u09c7\u09b0 \u09b0\u09be\u099c\u09a4\u09cd\u09ac\u09c7 \u09aa\u09b0\u09bf\u09a3\u09a4 \u09b9\u09df\u09c7\u099b\u09c7 \u098f\u09ac\u0982 \u09b8\u09ae\u09cd\u09ad\u09ac\u09a4 \u09a6\u09c7\u09b6\u09c7\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7\u0993 \u09b8\u09c7\u099f\u09be\u0995\u09c7 \u0997\u09cd\u09b0\u09b9\u09a8 \u0995\u09b0\u09c7 \u09a8\u09bf\u09df\u09c7\u099b\u09c7 \u0985\u09a8\u09c7\u0995\u099f\u09be \u09af\u09c7\u09a8 \u09aa\u09cd\u09b0\u09a4\u09bf\u09b7\u09cd\u09a0\u09be\u09a8\u09bf\u0995 \u09b0\u09c2\u09aa \u09a6\u09bf\u09df\u09c7 \u09a6\u09bf\u09df\u09c7\u099b\u09c7 \u0995\u09c7\u09a8\u09a8\u09be \u09a6\u09c7\u09b6\u09c7 \u09af\u09c7 \u09ac\u09c3\u09b9\u09a4\u09cd\u09a4\u09b0 \u09a6\u09c1\u099f\u09bf \u09a6\u09b2 \u09a6\u09c7\u09b6\u09c7\u09b0 \u09b0\u09be\u099c\u09a8\u09c0\u09a4\u09bf \u09aa\u09b0\u09bf\u099a\u09be\u09b2\u09a8\u09be \u0995\u09b0\u09c7 \u09a4\u09be\u09b0 \u098f\u0995\u099f\u09bf \u099a\u09b2\u09c7 \u09b8\u09cd\u09ac\u09be\u09a7\u09c0\u09a8\u09a4\u09be\u09b0 \u09b8\u09cd\u09a5\u09aa\u09a4\u09bf \u09ac\u0999\u09cd\u0997\u09ac\u09a8\u09cd\u09a7\u09c1 \u09b6\u09c7\u0996 \u09ae\u09c1\u099c\u09bf\u09ac\u09c1\u09b0 \u09b0\u09b9\u09ae\u09be\u09a8\u09c7\u09b0 \u09ae\u09c7\u09df\u09c7 \u09b6\u09c7\u0996 \u09b9\u09be\u099b\u09bf\u09a8\u09be\u09b0 \u09a8\u09c7\u09a4\u09c3\u09a4\u09cd\u09ac\u09c7 \u098f\u09ac\u0982 \u0985\u09a8\u09cd\u09af\u099f\u09bf \u099a\u09b2\u09c7 \u09b8\u09cd\u09ac\u09be\u09a7\u09c0\u09a8\u09a4\u09be\u09b0 \u0998\u09c7\u09be\u09b7\u0995 \u099c\u09c7\u09a8\u09be\u09b0\u09c7\u09b2 \u099c\u09bf\u09df\u09be\u09b0 \u09b8\u09cd\u09a4\u09cd\u09b0\u09c0 \u09ac\u09c7\u0997\u09ae \u0996\u09be\u09b2\u09c7\u09a6\u09be \u099c\u09bf\u09df\u09be\u09b0 \u09a8\u09c7\u09a4\u09c3\u09a4\u09cd\u09ac\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09b0\u09be\u099c\u09a8\u09bf\u09a4\u09c0\u09a4\u09c7 \u098f\u09b0\u09be\u0987 \u09b9\u099a\u09cd\u099b\u09c7\u09a8 \u09aa\u09cd\u09b0\u09a7\u09be\u09a8 \u09ab\u09cd\u09af\u0995\u09cd\u099f\u09b0 \u09a6\u09c7\u0996\u09be \u09af\u09be\u099a\u09cd\u099b\u09c7 \u09ad\u09ac\u09bf\u09b7\u09cd\u09af\u09a4\u09c7 \u098f \u09a7\u09be\u09b0\u09be\u0987 \u099a\u09b2\u09a4\u09c7 \u09a5\u09be\u0995\u09ac\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09a4\u09cb\u09a6\u09c7\u09b0 \u09ad\u09cb\u09a6\u09be\u09b0 \u09b0\u09b8 \u09af\u0996\u09a8 \u09b6\u09c1\u0995\u09bf\u09df\u09c7 \u09af\u09be\u09ac\u09c7 \u09a4\u0996\u09a8 \u09a4\u09cb\u09a6\u09c7\u09b0 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u0993 \u099a\u09c1\u09a6\u09ac\u09c7\u09a8\u09be ", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u0987 \u09ae\u09be\u0998\u09c0\u09b0 \u09ac\u09cb\u09a7\u09be \u09af\u09c7 \u0995\u09a4 \u099a\u09cb\u09a6\u09be \u0996\u09be\u0987\u099b\u09c7 \u09a4\u09be\u0987 \u09a8\u09bf\u099c\u09c7\u0993 \u09ac\u09b2\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09c7 \u09a8\u09be ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09af\u09a4 \u09b8\u09ac \u0986\u09ac\u09be\u09b2 \u09ae\u09be\u09a8\u09c1\u09b7\u09c7\u09b0 \u09ac\u09b8\u09ac\u09be\u09b8 \u0987\u0989\u099f\u09bf\u0989\u09ac \u098f\u09b0 \u09b8\u09c7\u09b2\u09bf\u09ac\u09cd\u09b0\u09bf\u099f\u09bf \u09b9\u0987\u09b2\u09c7\u0987 \u09af\u09be \u09ae\u09a8 \u099a\u09be\u09df \u0995\u09b0\u09be \u09af\u09be\u09df \u09a8\u09be \u09ad\u09be\u0987 \u09b2\u09bf\u09ae\u09bf\u099f \u098f \u09a5\u09be\u0995", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf \u099b\u09be\u0997\u09b2\u09c7\u09b0 \u09a1\u09bf\u09ae \u09a1\u09c1\u0995\u09be\u0987\u09df\u09be \u09a6\u09bf\u09ae\u09c1 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf \u0986\u09b2\u09cd\u09b2\u09be\u09b9 \u0993\u09b0 \u09a8\u09be\u09ae \u09a8\u09bf\u09b8 \u0995\u09c7\u09a8 \u098f\u0987 \u09a8\u09b8\u09cd\u099f\u09be \u09ae\u09c1\u0996\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": " \u0986\u09aa\u09a8\u09be\u09a6\u09c7\u09b0\u0996\u09be\u09b2\u09c7\u09a6\u09be\u0995\u09c7 \u09a8\u09bf\u09df\u09c7 \u098f\u09a4 \u09ad\u09df \u0995\u09c7\u09a8 \u0996\u09be\u09b2\u09c7\u09a6\u09be \u099c\u09bf\u09df\u09be \u09a8\u09be\u09b2\u09bf\u09b6 \u0995\u09b0\u09be\u09b0 \u09a6\u09b0\u0995\u09be\u09b0 \u0995\u09bf \u0986\u099b\u09c7 \u0986\u09aa\u09a8\u09be\u09b0\u09be \u0995\u09bf \u09ad\u09be\u09ac\u09c7 \u0996\u09ae\u09a4\u09be\u09df \u098f\u09b8\u09c7\u099b\u09c7\u09a8 \u0995\u09bf \u09ad\u09be\u09ac\u09c7 \u0996\u09ae\u09a4\u09be \u09aa\u09be\u0995\u09be \u09aa\u09cb\u0995\u09cd\u09a4 \u0995\u09b0\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u099a\u09c7\u09b7\u09cd\u099f\u09be \u0995\u09b0\u099b\u09c7\u09a8 \u0995\u09bf\u09ad\u09be\u09ac\u09c7 \u09ac\u09bf\u09b0\u09cb\u09a7\u09c0 \u09a6\u09b2 \u09a6\u09ae\u09a8\u09c7 \u09ac\u09cd\u09af\u09be\u09b8\u09cd\u09a4 \u09a4\u09be \u0995\u09bf \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09c7\u09b6\u09c7\u09b0 \u09ac\u09bf\u09ad\u09bf\u09a8\u09cd\u09a8 \u09a6\u09c2\u09a4\u09be\u09ac\u09be\u09b8 \u0997\u09c1\u09b2\u09cb \u09a6\u09c7\u0996\u099b\u09c7 \u09a8\u09be \u0986\u09aa\u09a8\u09be\u09b0\u09be \u0995\u09bf\u099b\u09c1 \u09b9\u09b2\u09c7\u0987 \u09ac\u09bf\u098f\u09a8\u09aa\u09bf \u09ae\u09c7\u09a1\u09be\u09ae \u099c\u09bf\u09df\u09be\u0995\u09c7 \u09a8\u09bf\u09df\u09c7 \u0985\u09b8\u09cd\u09b9\u09bf\u09b0 \u09b9\u09df\u09c7 \u09af\u09be\u09a8 \u098f\u0987 \u09b8\u09ae\u09b8\u09cd\u09a4 \u09ad\u09be\u0982\u0997\u09be \u09b0\u09c7\u0995\u09b0\u09cd\u09a1 \u0986\u09b0 \u09ac\u09be\u099c\u09bf\u09df\u09c7 \u09b2\u09be\u09ad \u09a8\u09c7\u0987 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c0\u09b0\u09be \u098f\u09a4 \u09ac\u09cb\u0995\u09be \u09a8\u09df \u09a4\u09be\u09b0\u09be \u09b8\u09ac \u0995\u09bf\u099b\u09c1 \u09ac\u09c1\u099d\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": " \u0996\u09be\u09b2\u09c7\u09a6\u09be \u099c\u09bf\u09df\u09be \u0995\u09bf \u09ab\u09c7\u09b0\u09c7\u09b6\u09a4\u09be \u09a8\u09be \u0995\u09bf ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u09b0\u09be \u099c\u0997\u09b0\u09be \u09b2\u09be\u0997\u09be\u0987\u09df\u09be \u098f\u0996\u09a8 \u099a\u09be\u09b8 \u09b6\u09be\u09a8\u09cd\u09a4\u09bf ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0986\u09b0 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u098f\u0987 \u0996\u09be\u0987\u09b8\u09cd\u099f\u09be \u099c\u09be\u09a4\u09c7\u09b0 \u09ae\u09a7\u09cd\u09af\u09c7 \u09a4\u09c1\u09ae\u09bf\u0993 \u09aa\u09dc \u09b8\u09cb \u09b0\u0995\u09cd\u09a4 \u09a4 \u09ae\u09bf\u09b6\u09b6\u09be \u0986\u09b8\u09c7\u0987 \u099c\u09bf\u09a8\u09bf\u09b8 \u099f\u09be", + "output": [ + "Personal" + ] + }, + { + "input": "\u09aa\u09cb\u09b2\u09be \u0997\u09c1\u09b2\u09bf \u0995\u09bf\u099a\u09cd\u099b\u09c1 \u09ac\u09c1\u099d\u09c7 \u09a8\u09be \u09a7\u09c1\u0995\u09be\u0987\u09ac\u09be\u09b0 \u0986\u0997\u09c7\u0987 \u0995\u09be\u09ae \u09b6\u09c7\u09b7 \u09ab\u09be\u09b2\u09a4\u09c1 \u0995\u09a5\u09be\u0995\u09be\u09b0 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0993\u09b0 \u09ae\u09a4 \u099c\u09be\u09a8\u09cb\u09df\u09be\u09b0\u09c7\u09b0 \u09ac\u09c7\u099a\u09c7 \u09a5\u09be\u0995\u09be\u09b0 \u0995\u09cb\u09a8\u09cb \u0985\u09a7\u09bf\u0995\u09be\u09b0\u0987 \u09a8\u09be\u0987 \u0993\u0995\u09c7 \u09ab\u09be\u09b8\u09bf\u09b0 \u09a6\u09dc\u09bf\u09a4\u09c7 \u0998\u09a8\u099f\u09be \u099d\u09c1\u09b2\u09bf\u09df\u09c7 \u09b0\u09be\u0996\u09b2\u09c7 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09b6\u09be\u09a8\u09a4\u09bf \u09b9\u09ac\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b8\u09ac \u0997\u09c1\u09b2\u09be \u09ae\u09be\u09a6\u09be\u09b0 \u099a\u09c1\u09a6 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0997\u09b0\u09c1\u09b0 \u09b9\u09be\u099f\u09c7\u09b0 \u09a7\u09cb\u09b2\u09be\u0987 \u0993 \u09ae\u09be\u09ab \u099a\u09be\u0993\u09df\u09be\u099f\u09be \u0995\u09c7\u09ae\u09a8 \u099b\u09bf\u09b2\u09cb \u0986\u09ac\u09be\u09b2 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u099f\u09df\u09be \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b6\u09be\u0995\u099f\u09be \u0996\u09c1\u09b2\u09c7 \u09ab\u09c7\u09b2\u09b2\u09c7 \u09ad\u09be\u09b2\u09cb \u09b9\u09a4\u09cb", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u0987 \u09ae\u09cd\u09af\u09be\u0987\u09df\u09be\u09b0\u09c7 \u09b9\u09c7\u09ae\u09be\u09df\u09c7\u09a4\u09aa\u09c1\u09b0 \u09a5\u09c7\u0987\u0995\u09be \u0996\u09cb\u09b2\u09be \u0985\u09ac\u09b8\u09cd\u09a5\u09be\u09df \u099b\u09be\u0987\u09dc\u09be \u09a6\u09bf\u099b\u09c7 \u0995\u09c7\u09dc\u09be\u09df ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09a6\u09c1\u09a7 \u0997\u09cb\u09b2\u09be \u098f\u09a4\u09cd\u09a4 \u09ac\u09dc \u0995\u09b0\u09c7 \u09aa\u09c7\u09b2\u099b\u09c7 \u0995\u09c7\u09ae\u09a8\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ac\u09cb\u0995\u09be \u099a\u09cb\u09a6\u09be \u09ac\u09be\u0987\u099e\u09cd\u099a\u09a6 \u09b8\u09cc\u09ad\u09bf\u0995 \u0995\u09be\u0987\u09b2\u09cd\u09b2\u09be ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09af\u09a6\u09bf \u0995\u09cb\u09a8 \u0996\u09be\u09a8\u0995\u09bf \u09a5\u09be\u0995\u09c7 \u09b8\u09c7\u0987\u099f\u09be \u09b9\u09b2\u09cb \u099f\u09df\u09be", + "output": [ + "Personal" + ] + }, + { + "input": "\u0995\u09a8\u09a1\u09ae \u09a8\u09bf\u09df\u09c7 \u0986\u0987\u099b\u09cb\u09a4\u09cb ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ae\u09be\u09a6\u09be\u09b0 \u099a\u09cb\u09a6 \u0986\u09b0\u09c7\u0995 \u099c\u09a8\u09c7\u09b0 \u0997\u09be\u09a8 \u09a8\u09bf\u09af\u09bc\u09c7 \u09ae\u099c\u09be \u099a\u09cb\u09a6\u09be\u0993 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u09a6\u09c7\u09b0 \u0995\u09c7\u09a8 \u09ab\u09be\u09b8\u09bf \u09a6\u09c7\u09df \u09a8\u09be \u098f\u0995\u099c\u09a8\u0995\u09c7 \u09ab\u09be\u09b8\u09bf \u09a6\u09bf\u09b2\u09c7 \u09b9\u09df\u09a4 \u098f\u09b8\u09ac \u09a8\u09b0\u09cb\u09aa\u09bf\u09b6\u09be\u099a\u09b0\u09be \u09a0\u09bf\u0995 \u09b9\u09a4", + "output": [ + "Personal" + ] + }, + { + "input": " \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u0986\u09a6\u09be\u09b2\u09a4 \u0987\u09b8\u09b2\u09be\u09ae \u09a7\u09b0\u09cd\u09ae\u09c0\u09df \u09a8\u09c7\u09a4\u09be \u0997\u09c1\u09b0\u09c1 \u09ae\u09be\u0993\u09b2\u09be\u09a8\u09be \u0986\u09b2\u09b9\u09be\u099c\u09cd\u09ac \u099c\u09be\u09a4\u09c0\u09df \u09aa\u09a4\u09be\u0995\u09be\u09ac\u09be\u09b9\u09c0 \u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0\u09b8\u09b9 \u09ac\u09bf\u0996\u09cd\u09af\u09be\u09a4 \u09b8\u09ae\u09be\u099c\u09b8\u09c7\u09ac\u0995\u09a6\u09c7\u09b0\u0995\u09c7 \u09b8\u09a8\u09cd\u09a4\u09cd\u09b0\u09be\u09b8\u09c0\u09a6\u09c7\u09b0 \u09ae\u09a4\u09cb \u09ab\u09be\u09b8\u09bf\u09b0 \u09ae\u099e\u09cd\u099a\u09c7 \u09ae\u09c3\u09a4\u09cd\u09af\u09c1\u09a6\u09a8\u09cd\u09a1 \u0995\u09be\u09b0\u09cd\u09af\u0995\u09b0 \u0995\u09b0\u09c7 \u099c\u09be\u09a4\u09bf\u0995\u09c7 \u0995\u09b2\u0982\u0995\u09ae\u09c1\u0995\u09cd\u09a4 \u0998\u09cb\u09b7\u09a8\u09be \u0995\u09b0\u09be\u09b0 \u0995\u09be\u09b0\u09a8 \u0995\u09bf \u09b8\u09c3\u09b7\u09cd\u099f\u09bf\u0995\u09b0\u09cd\u09a4\u09be\u09b0 \u0987\u099a\u09cd\u099b\u09be\u09df \u09af\u09a6\u09bf \u09b8\u09ac\u0995\u09bf\u099b\u09c1 \u09a8\u09bf\u09df\u09a8\u09cd\u09a4\u09cd\u09b0\u09bf\u09a4 \u09b9\u09df \u09a4\u09be\u09b9\u09b2\u09c7 \u09aa\u09cd\u09b0\u09b6\u09cd\u09a8 \u0995\u09c7\u09a8 \u09a8\u09bf\u09b6\u09cd\u099a\u09df \u09a4\u09c1\u09ae\u09bf \u09ac\u09cd\u09af\u09a4\u09bf\u0995\u09cd\u09b0\u09ae \u0995\u09b0\u09cb\u09a8\u09be \u0985\u0999\u09cd\u0997\u09c0\u0995\u09be\u09b0 \u09a8\u09be\u09ae\u09be\u099c\u09c7\u09b0 \u09aa\u09b0 \u0995\u09be\u09b0 \u09ac\u09be\u09a8\u09c0 \u09a4\u09be\u09b0 \u09ac\u09bf\u09b0\u09c1\u09a6\u09cd\u09a7\u09c7 \u09af\u09c7\u09a4\u09c7 \u099a\u09be\u09a8 \u09a4\u09ac\u09c1\u0993 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u0987\u0989\u099f\u09bf\u0989\u09ac \u09a5\u09c7\u0995\u09c7 \u09ac\u09bf\u09a6\u09be\u09df \u09a8\u09c7\u09b8 \u09a8\u09be \u0995\u09c7\u09a8 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ac\u09cd\u09b0\u09be \u09ac\u09b2\u09c7 \u09b9\u09be \u09b9\u09be \u09b9\u09be \u09b6\u09be\u09b2\u09be \u09b2\u09c1\u099a\u09cd\u099a\u09be", + "output": [ + "Personal" + ] + }, + { + "input": "\u0997\u09b2\u09be \u09b6\u09c1\u09a8\u09b2\u09c7 \u09ae\u09a8\u09c7 \u09b9\u09df \u09ae\u09c1\u0996\u09c7 \u09a7\u09cb\u09a8 \u09ad\u0987\u09b0\u09be \u09b0\u09be\u0996\u09b8\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": " \u09a4\u0996\u09a8 \u0995\u09bf \u0986\u09aa\u09a8\u09be\u09b0\u09be \u0996\u09ae\u09a4\u09be\u0987 \u09a5\u09be\u0995\u09ac\u09c7\u09a8 \u0986\u09b0 \u0996\u09be\u09b2\u09c7\u09a6\u09be \u099c\u09bf\u09df\u09be \u0996\u09ae\u09a4\u09be\u0987 \u0986\u09b8\u09b2\u09c7 \u09a4 \u09a4\u09be\u09a6\u09c7\u09b0\u0995\u09c7 \u09b8\u09bf\u099f\u09bf \u099c\u09c7\u09a8\u09c7 \u09a6\u09bf\u09ac\u09c7 \u09aa\u09be\u09b8\u09aa\u09c7\u09be\u09b0\u09cd\u099f \u09a6\u09bf\u09ac\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0986\u099c\u09be\u0987\u09b0\u09be \u09af\u09c7\u099f\u09be \u09aa\u09be\u09b0\u09cb \u09a8\u09be \u09b8\u09c7\u099f\u09be \u099a\u09c7\u09b8\u09cd\u099f\u09be \u0995\u09b0\u09cb \u0995\u09c7\u09a8 \u09b9\u09c1\u09a6\u09be\u0987", + "output": [ + "Personal" + ] + }, + { + "input": "\u0986\u09b6\u09be \u0995\u09b0\u09bf \u09a8\u09c7\u0995\u09cd\u09b8\u099f \u099f\u09be\u0987\u09ae\u09c7 \u09ac\u09a8\u09be\u09a8\u09bf \u09a5\u09c7\u0995\u09c7 \u0995\u09cb\u09a8 \u09ae\u09be\u0997\u09c0 \u09a7\u09b0\u09c7 \u098f\u09a8\u09c7 \u09a4\u09be\u09b0 \u0987\u09a8\u09cd\u099f\u09be\u09b0\u09ad\u09bf\u0989 \u09a8\u09bf\u09ac\u09c7\u09a8", + "output": [ + "Personal" + ] + }, + { + "input": "\u0993\u09a6\u09c7\u09b0 \u09b9\u09cb\u0997\u09be\u09df \u09ac\u09b0\u09bf\u09b6\u09be\u09b2 \u098f\u09b0 \u0986 \u099b\u09cb\u09b2\u09be \u09ac\u09be\u09b6 \u09a6\u09c7\u09df\u09be \u09b9\u09cb\u0995", + "output": [ + "Personal" + ] + }, + { + "input": "\u09a7\u09b0\u09cd\u09b7\u0995\u09b0\u09c7 \u09ae\u09b0\u099b\u09c7 \u09ac\u09b2\u09c7 \u09b0\u09c7\u09b9\u09be\u09a8\u09c7\u0995\u09c7 \u09ab\u09be\u09b8\u09bf \u09a8\u09be \u09a6\u09bf\u09df\u09c7 \u09aa\u09c1\u09b0\u09b8\u09cd\u0995\u09c3\u09a4 \u0995\u09b0\u09be \u0989\u099a\u09bf\u09ce \u099b\u09bf\u09b2", + "output": [ + "Personal" + ] + }, + { + "input": "\u0995\u09bf\u09a8\u09cd\u09a4 \u0995\u09a5\u09be \u09b9\u09b2 \u098f\u0987 \u09ae\u09be\u0997\u09bf \u09b0\u09c7 \u09ac\u09bf\u09df\u09c7 \u0995\u09b0\u09b8\u09c7 \u0995\u09c7", + "output": [ + "Personal" + ] + }, + { + "input": "\u099c\u09be\u09a4\u09bf\u09b8\u0982\u0998 \u09a8\u09c7\u09a4\u09be\u09b0\u09be \u0995\u09be\u09a8\u09be \u09b8\u09c2\u099a\u09bf\u09b0 \u09ab\u09be\u09b8\u09bf \u099a\u09be\u0987", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ad\u09be\u09b2\u09cb \u0995\u09cb\u09a8 \u0985\u09a8\u09c1\u09b7\u09cd\u09a0\u09be\u09a8\u09c7 \u09af\u09a4 \u09b8\u09ac \u09ae\u09c2\u09b0\u09cd\u0996\u09a6\u09c7\u09b0 \u09a6\u09be\u0993\u09df\u09be\u09a4 \u0995\u09b0\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09a4\u09cb\u09ae\u09be\u0997\u09cb \u09ae\u09a4\u09cb \u09aa\u09cb\u09b2\u09be \u09aa\u09be\u09a8\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u0986\u099c \u0995\u09c7 \u09a6\u09c7\u09b6\u09c7\u09b0 \u0987\u0989\u099f\u09bf\u0989\u09ac \u098f\u09b0 \u098f\u0987 \u0985\u09ac\u09b8\u09cd\u09a5\u09be", + "output": [ + "Personal" + ] + }, + { + "input": "\u0993 \u09ae\u09b9\u09bf\u09b2\u09be\u0995\u09c7 \u09ab\u09be\u09b8\u09bf\u09a4\u09c7 \u099c\u09c1\u09b2\u09bf\u09df\u09c7 \u09ae\u09be\u09b0\u09be \u09a6\u09b0\u0995\u09be\u09b0", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b8\u09be\u099c\u09c1 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u0993\u09b0 \u099c\u09a8\u09cd\u09ae \u09aa\u09a4\u09bf\u09a4\u09be\u09b2\u09df\u09c7 \u09ae\u09be\u09a6\u09be\u09b0\u099a\u09cb\u09a6 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ae\u099c\u09bf\u09ac \u0995\u09a8\u09cd\u09a1\u09ae \u099f\u09df\u09be \u0996\u09ac\u09bf\u09b8 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ac\u09bf\u099a\u09be\u09b0\u0995 \u09ae\u09c7\u09df\u09c7\u099f\u09be \u0995\u09c7 \u0986\u09ae\u09be\u09b0 \u0995\u09be\u099b\u09c7 \u09a8\u09bf\u09df\u09c7 \u0986\u09b8\u09cb \u0986\u09ae\u09bf \u09a4\u09be\u0995\u09c7 \u09a7\u09b0\u09c7 \u09b8\u09bf\u09ab\u09be\u09a6\u09c1 \u09a5\u09c7\u09b0\u09be\u09aa\u09bf \u09a6\u09bf\u09ac\u09cb ", + "output": [ + "Personal" + ] + }, + { + "input": " \u0986\u09ae\u09bf \u0997\u09df\u09c7\u09b6\u09cd\u09ac\u09b0 \u09ac\u09be\u09ac\u09c1\u09b0 \u0995\u09a5\u09be\u09df \u098f\u0995 \u09ae\u09a4 \u0986\u09ae\u09bf \u098f\u0995 \u099c\u09a8 \u09b8\u09be\u09ac\u09c7\u0995 \u099b\u09be\u09a4\u09cd\u09b0 \u09a8\u09c7\u09a4\u09be \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u098f\u0987 \u09ac\u09cd\u09af\u09c7\u09aa\u09be\u09b0\u09c7 \u0985\u09a8\u09c7\u0995 \u09aa\u09cd\u09b0\u09ae\u09be\u09a8 \u0986\u099b\u09c7 \u0986\u09ae\u09be\u09b0 \u0993 \u09a6\u09b2\u09c7\u09b0 \u09b8\u0995\u09b2 \u0986\u09b8\u09b2 \u09a8\u09c7\u09a4\u09be \u09a8\u09c7\u09a4\u09cd\u09b0\u09c0\u09b0 \u0995\u09be\u099b\u09c7 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u0993 \u09a6\u09be\u09ac\u09c0 \u09ac\u09c7\u0997\u09ae \u0996\u09be\u09b2\u09c7\u09a6\u09be \u099c\u09bf\u09df\u09be\u09b0 \u0995\u09be\u099b\u09c7 \u0986\u09aa\u09a8\u09bf \u09ac\u09be\u09ac\u09c1\u09a6\u09c7\u09b0 \u09ae\u09a4 \u09b8\u099f\u09bf\u0995 \u09aa\u09a5 \u099a\u09b2\u09be \u09a8\u09c7\u09a4\u09be\u09a6\u09c7\u09b0 \u0995\u09c7 \u09a8\u09bf\u09df\u09c7 \u09a6\u09b2\u0995\u09c7 \u09a1\u09c7\u09b2\u09c7 \u09b8\u09be\u099c\u09be\u09a8 \u098f\u0996\u09a8\u09cb \u09b8\u09ae\u09df \u0986\u099b\u09c7 \u0986\u09ae\u09b0\u09be \u09a6\u09b2\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09ae\u09be\u0987\u09b0 \u0996\u09be\u0987\u09a4\u09c7 \u0996\u09be\u0987\u09a4\u09c7 \u09b8\u09c7\u09b7 \u09b9\u09df\u09c7 \u09af\u09be\u099a\u09cd\u099b\u09bf \u0986\u09b0 \u099a\u09be\u099f\u09c1\u0995\u09be\u09b0 \u09b0\u09be \u09b8\u09c1\u09ac\u09bf\u09a6\u09be \u09ac\u09cb\u0997\u09cd\u09af \u0995\u09b0\u099b\u09c7 \u0993 \u09b8\u09b0\u0995\u09be\u09b0 \u098f\u09b0 \u09b8\u09be\u09a4\u09c7 \u0986\u09a4\u09cd\u09af \u0986\u09a4\u09cd\u09af \u0995\u09b0\u09c7 \u09aa\u09bf\u099f \u09ac\u09be\u099a\u09be\u099a\u09cd\u099b\u09c7 \u09a4\u09be\u0987 \u0986\u09aa\u09a8\u09be\u09b0 \u0995\u09be\u099b\u09c7 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09be\u09ac\u09bf \u0986\u09b2\u09c0\u0997 \u098f\u09b0 \u09b8\u09be\u09a5\u09c7 \u09ac\u09bf\u09df\u09be\u0987 \u0995\u09b0\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0 \u09ae\u09a4 \u09a8\u09c7\u09a4\u09be \u09a6\u09b2\u09c7 \u09a8\u09be \u09a5\u09be\u0995\u09b2\u09c7 \u09a6\u09b2\u09c7\u09b0 \u0995\u09bf\u099b\u09c1 \u09b9\u09ac\u09c7 \u09a8\u09be \u09a8\u09be \u09b9\u09df \u0986\u09ae\u09b0\u09be \u0986\u09aa\u09a8\u09be\u09b0 \u0995\u09be\u099b \u09a5\u09c7\u0995\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0 \u0995\u09c7 \u099f\u09c7\u09a8\u09c7\u09b9 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u0996\u09c1\u09a8\u09bf \u09a4\u09cb\u09ae\u09be\u09b0 \u09ab\u09be\u09b8\u09bf \u099a\u09be\u09df \u099c\u09be\u09a4\u09bf ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0996\u09ac\u09bf\u09b8 \u09ae\u09be\u0987\u09df\u09be \u09ae\u09be\u09a5\u09be\u09df 10 \u09a4\u09be\u09b2\u09be \u09ac\u09bf\u09b2\u09cd\u09a1\u09bf\u0982 \u09a8\u09bf\u09df\u09be \u0997\u09c1\u09b0\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0995\u09df\u09a6\u09bf\u09a8 \u09aa\u09b0 \u099a\u09c1\u09a6\u09a4\u09c7 \u099a\u09c1\u09a6\u09a4\u09c7 \u09ac\u09b2\u09ac\u09c7 \u09a4\u09be\u09b0\u09be \u09ab\u09be\u09a8 \u0995\u09b0\u099b\u09c7", + "output": [ + "Personal" + ] + }, + { + "input": "\u09aa\u09c1\u09b0\u09cb \u09ac\u09be\u0995\u09cd\u09af\u099f\u09bf \u09b9\u099a\u09cd\u099b\u09c7 \u098f\u0987 \u09af\u09c7 \u09a6\u09be\u09a6\u09be\u09b0\u09be \u09b6\u09c1\u09af\u09bc\u09cb\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09be \u0995\u09c1\u0995\u09c1\u09b0\u09c7\u09b0 \u099b\u09be\u09a8\u09be\u09b0\u09be \u09af\u09a6\u09bf \u0986\u09aa\u09a8\u09be\u09a6\u09c7\u09b0\u0995\u09c7 \u0995\u09be\u09ae\u09a1\u09bc\u09be\u09af\u09bc \u09ac\u09be \u0986\u099a\u09a1\u09bc\u09c7 \u09a6\u09c7\u09af\u09bc \u09a4\u09be\u09b9\u09b2\u09c7 \u098f\u0987", + "output": [ + "Personal" + ] + }, + { + "input": "\u09a6\u09c1\u09a6\u09ae\u09be\u09b0\u09be\u09a8\u09bf-\u09a6\u09c1\u09a6\u09ae\u09be\u09b0\u09be\u09a8\u09bf-\u09a6\u09c1\u09a6\u09ae\u09be\u09b0\u09be\u09a8\u09bf' ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ac\u09cd\u09b0\u09be-\u09aa\u09cd\u09af\u09be\u09a8\u09cd\u099f\u09bf \u09aa\u0987\u09dc\u09be \u09a8\u09bf\u0995\u09bf \u09ae\u09bf\u09a8\u09be\u099c\u09c7\u09b0 \u09ae\u09a4 \u098f\u09a8\u09be\u0995\u09cb\u09a8\u09cd\u09a1\u09be \u09aa\u09be\u09b0\u09cd\u099f \u099f\u09c1 \u09ac\u09c7\u09b0 \u0995\u09b0 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf \u09a4\u0995\u09c7 \u0986\u09b0 \u09ad\u09be\u09b2\u09cb \u0995\u09bf \u0995\u09b0\u09ac\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": " \u09ae\u09cd\u09af\u09be\u09a1\u09ae \u0996\u09be\u09b2\u09c7\u09a6\u09be \u099c\u09bf\u09df\u09be \u0995\u09cb\u09a8\u09cb \u09a6\u09bf\u09a8\u0993 \u099c\u09bf\u09a4\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09c7\u09a8\u09be \u098f\u09ac\u09be\u09b0\u09c7\u0993 \u09b6\u09c7\u0996 \u09b9\u09be\u09b8\u09bf\u09a8\u09be\u09b0 \u0995\u09be\u099b\u09c7 \u09b9\u09c7\u09b0\u09c7 \u09ad\u09c2\u09a4 \u09b9\u09df\u09c7 \u09af\u09be\u09ac\u09c7 \u0996\u09be\u09b2\u09c7\u09a6\u09be \u09ae\u09cd\u09af\u09be\u09a1\u09ae \u09ae\u09bf\u09b2\u09bf\u09df\u09c7 \u09a8\u09c7\u09ac\u09c7\u09a8 ", + "output": [ + "Personal" + ] + }, + { + "input": " \u0990 \u0995\u09c1\u09b2\u09be\u0999\u09cd\u0997\u09be\u09b0 \u099f\u09be\u09b0 \u09ac\u09bf\u09b0\u09c1\u09a6\u09cd\u09a7\u09c7 \u09b0\u09be\u09b7\u09cd\u099f\u09cd\u09b0\u09a6\u09cd\u09b0\u09b9\u09cb\u09b0 \u09ae\u09be\u09ae\u09b2\u09be \u0995\u09b0\u09be \u09b9\u09cb\u0995 \u098f\u09ac\u0982 \u09ab\u09be\u09b8\u09bf\u09a4\u09c7 \u099d\u09c1\u09b2\u09bf\u09df\u09c7 \u09ae\u09c3\u09a4\u09cd\u09af\u09a6\u09a8\u09cd\u09a1 \u0995\u09be\u09b0\u09cd\u09af\u0995\u09b0 \u0995\u09b0\u09be \u09b9\u09cb\u0995 \u0995\u09cb\u099f\u09bf \u09ae\u09be\u09a8\u09c1\u09b7\u09c7\u09b0 \u0987\u099c\u09cd\u099c\u09a4 \u09a8\u09b7\u09cd\u099f \u0995\u09b0\u099b\u09c7 \u098f\u0987 \u09b6\u09df\u09a4\u09be\u09a8 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09a6\u09c7\u09b0\u0995\u09c7 \u098f\u09cd\u09af\u09be\u0993\u09df\u09be\u09b0\u09cd\u09a1 \u09b9\u09bf\u09b8\u09c7\u09ac\u09c7 \u09aa\u09c1\u09b0\u09be\u09a4\u09a8 \u09ac\u09a6\u09a8\u09be \u09a6\u09c7\u0993\u09df\u09be \u09b9\u0995 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ac\u09be\u09b2\u09c7\u09b0 \u0986\u09ac\u09be\u09b2\u09c7\u09b0 \u09ae\u09a4 \u0996\u09be\u09b2\u09bf \u0987\u0982\u09b2\u09bf\u09b6 \u09ae\u09be\u09b0\u09be\u0993 \u09a8\u09be ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ae\u09c7\u09a7\u09be\u09b9\u09c0\u09a8 \u0986\u09ac\u09be\u09b2 \u0986\u09b0 \u09a6\u09c7\u0996\u09a4\u09c7 \u099a\u09be\u0987 \u09a8\u09be ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0985\u09b6\u09cd\u09b2\u09c0\u09b2\u09a4\u09be \u0986\u09b0 \u09ac\u09c7\u09b9\u09be\u09df\u09be\u09aa\u09a8\u09be \u099b\u09be\u09dc\u09be \u0986\u09b0 \u0995\u09bf\u099b\u09c1\u0987 \u09a8\u09be ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0985\u09a8\u09cd\u09af\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u0998\u09be\u09b0\u09c7\u09a8\u09bf\u099b\u09c7 \u09a4\u09be\u0993 \u0986\u09ac\u09be\u09b0 \u099c\u09be\u09b0\u099c ", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u09a6\u09c7\u09b0 \u0995\u09be\u09b0\u09a8\u09c7 \u098f\u09b2\u09bf\u09df\u09c7\u09a8\u09b0\u09be \u09aa\u09c3\u09a5\u09bf\u09ac\u09c0\u09a4\u09c7 \u09ac\u09c7\u09dc\u09be\u09a4\u09c7 \u0986\u09b8\u09c7 \u09a8\u09be ", + "output": [ + "Personal" + ] + }, + { + "input": " \u09af\u09a6\u09bf \u0985\u09a8\u09cd\u09af\u09a6\u09b2 \u0995\u09cd\u09b7\u09ae\u09a4\u09be\u09df \u0986\u09b8\u09c7 \u09a4\u09ac\u09c7 \u098f\u0987 \u09b8\u09b0\u0995\u09be\u09b0\u09c7\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf\u099f\u09be\u09b0\u09c7\u0987 \u09ab\u09be\u09b8\u09bf \u09b9\u09ac\u09c7 \u0995\u09c7\u0989 \u09af\u09a6\u09bf \u09ae\u09be\u09b0\u09be\u0993 \u09af\u09be\u09df \u09a4\u09ac\u09c7 \u09a4\u09be\u09b0 \u09ae\u09b0\u09a8\u09cb\u09a4\u09cd\u09a4\u09b0 \u09ab\u09be\u09b8\u09bf \u09b9\u09ac\u09c7 \u098f\u0987 \u09ad\u09df\u09c7 \u09b9\u09be\u09b8\u09bf\u09a8\u09be \u09b8\u09b0\u0995\u09be\u09b0 \u098f\u0996\u09a8 \u09a5\u09c7\u0995\u09c7\u0987 \u0995\u09be\u09a6\u09be \u09b6\u09c1\u09b0\u09c1 \u0995\u09b0\u09c7 \u09a6\u09bf\u09df\u09c7\u099b\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ac\u09bf\u099a\u09be\u09b0\u0995 \u09b6\u09be\u09b2\u09bf\u09b0 \u09ac\u09c7\u099f\u09bf \u09ae\u09a8\u09c7 \u09b9\u09df \u0987\u099a\u09cd\u099b\u09c7 \u098f\u09b0 \u09ac\u09be\u0982\u09b2\u09be \u099c\u09be\u09a8\u09c7 \u09a8\u09be ", + "output": [ + "Personal" + ] + }, + { + "input": " \u09ae\u09c7\u09df\u09c7\u09b0\u09be \u09af\u09a6\u09bf \u09b8\u09cd\u09ac\u09be\u09b0\u09cd\u09a5\u09aa\u09b0 \u09b9\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 \u09a4\u09be\u09b9\u09b2\u09c7 \u099b\u09c7\u09b2\u09c7\u09b0\u09be \u09aa\u09be\u09ac\u09c7 \u09a8\u09be \u0995\u09c7\u09a8\u09cb \u0990 \u09b8\u09cd\u09ac\u09be\u09b0\u09cd\u09a5\u09aa\u09b0 \u09aa\u09bf\u09a4\u09be\u0995\u09c7 \u09a4\u09bf\u09a8 \u09a6\u09bf\u09a8 \u09ab\u09be\u09b8\u09bf\u09a4\u09c7 \u099d\u09c1\u09b2\u09bf\u09df\u09c7 \u09b0\u09c7\u0996\u09c7 \u09ae\u09c3\u09a4\u09cd\u09af\u09c1\u09a6\u09a8\u09cd\u09a1 \u09a6\u09c7\u0993\u09df\u09be \u0989\u099a\u09bf\u09a4 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0995\u09bf \u0995\u09c1\u09a4\u09cd\u09a4\u09be \u0997\u09c7\u0993 \u0997\u09c7\u0993 \u0995\u09b0\u09c7\u099b \u0995\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0987\u0982\u09b0\u09c7\u099c\u09b0\u09be \u09b6\u09c1\u09a8\u09c7 \u099b\u09bf\u09b2 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u099c\u0999\u09cd\u0997\u09b2\u09c7 \u09ac\u09be\u0998 \u09aa\u09be\u0993\u09af\u09bc\u09be \u09af\u09be\u09af\u09bc \u0997\u09bf\u09af\u09bc\u09c7 \u09a6\u09c7\u0996\u09c7 \u09b6\u09c1\u09af\u09bc\u09cb\u09b0 \u099b\u09be\u09a1\u09bc\u09be \u0995\u09bf\u099b\u09c1 \u09a8\u09be\u0987 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u0987 \u09b8\u09ac \u09aa\u09a4\u09bf\u09a4\u09be \u09ae\u09be\u09a8\u09c1\u09b7\u09bf\u0995\u09a4\u09be\u09b0 \u09ae\u09c7\u09df\u09c7\u09b0\u09be \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09c7\u09b6\u09c7\u09b0 \u0986\u09ac\u09b0\u09cd\u099c\u09a8\u09be", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b8\u09ac \u0997\u09be\u09a8 \u0997\u099e\u09cd\u099c\u09bf\u0995\u09be \u0996\u09be\u0987\u09df\u09be \u0997\u09be\u0987\u099b\u09c7 \u09b9\u09cd\u09b2\u09be \u0986\u09ac\u09be\u09b2 \u099a\u09c1\u09a6\u09be\u09b0\u09be", + "output": [ + "Personal" + ] + }, + { + "input": "\u0986\u09ac\u09be\u09b2 \u098f\u0987\u0997\u09c1\u09b2\u09cb\u0993 \u09a4\u09cb\u09b0 \u0995\u09be\u099b\u09c7 \u09b2\u09cb\u0995 \u09b9\u09be\u09b8\u09be\u09a8\u09cb \u09aa\u09cd\u09b0\u09b6\u09cd\u09a8 \u09ae\u09a8\u09c7 \u09b9\u09af\u09bc ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09af\u09c7\u0987 \u09ae\u09be\u0987\u099c\u09cd\u099e\u09be \u09b9\u09be\u09b2\u09be\u09df \u09ac\u09bf\u09df\u09be \u0995\u09b0\u099b\u09c7 \u0993\u0987 \u09b9\u09be\u09b2\u09be\u09df \u09b8\u09be\u0997\u09b0 \u09aa\u09be\u0987\u099b\u09c7", + "output": [ + "Personal" + ] + }, + { + "input": " \u098f\u0987 \u099a\u09be\u09ae\u09be\u09b0\u09cd\u09a8\u09c0\u09b0\u09c7 \u09ab\u09be\u09b8\u09bf\u09a4\u09c7 \u09af\u09c1\u09b2\u09be\u0987\u09a4\u09c7 \u09b9\u09ac\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": " \u0987 \u0986\u0997\u09b8\u09cd\u099f \u0996\u09be\u09b2\u09c7\u09a6\u09be \u099c\u09bf\u09df\u09be\u09b0 \u099c\u09a8\u09cd\u09ae\u09a6\u09bf\u09a8 \u09a8\u09df \u09a4\u09ac\u09c1\u0993 \u09a4\u09bf\u09a8\u09bf \u0993\u0987\u09a6\u09bf\u09a8 \u099c\u09a8\u09cd\u09ae\u09a6\u09bf\u09a8 \u09aa\u09be\u09b2\u09a8 \u0995\u09b0\u09c7\u099b\u09c7\u09a8 \u09ac\u09b2\u09c7 \u09a4\u0995\u09c7 \u09ad\u09c1\u09df\u09be \u099c\u09a8\u09cd\u09ae\u09a6\u09bf\u09a8 \u09aa\u09be\u09b2\u09a8\u09c7\u09b0 \u09a6\u09be\u09df\u09c7 \u0997\u09cd\u09b0\u09c7\u09ab\u09a4\u09be\u09b0 \u0995\u09b0\u09be \u09b9\u09ac\u09c7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u098f\u09a6\u09c7\u09b6\u09c7 \u09a4\u09cb \u09b9\u09be\u099c\u09be\u09b0 \u09b9\u09be\u099c\u09be\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7 \u09ad\u09c1\u09df\u09be \u099c\u09a8\u09cd\u09ae\u09a6\u09bf\u09a8 \u09aa\u09be\u09b2\u09a8 \u0995\u09b0\u099b\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0 \u0995\u09c7\u09a8\u09cb \u0997\u09cd\u09b0\u09c7\u09ab\u09a4\u09be\u09b0 \u0995\u09b0\u09be \u09b9\u099a\u09cd\u099b\u09c7\u09a8\u09be \u0986\u099a\u09cd\u099b\u09be \u09ae\u09c7\u09a8\u09c7 \u09a8\u09bf\u09b2\u09be\u09ae \u09af\u09c7 \u0996\u09be\u09b2\u09c7\u09a6\u09be \u099c\u09bf\u09df\u09be \u09ad\u09c1\u09df\u09be \u099c\u09a8\u09cd\u09ae\u09a6\u09bf\u09a8 \u09aa\u09be\u09b2\u09a8 \u0995\u09b0\u099b\u09c7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09af\u09be\u09a6\u09c7\u09b0 \u09b8\u09a0\u09bf\u0995 \u099c\u09a8\u09cd\u09ae\u09a6\u09bf\u09a8 \u0987 \u0986\u0997\u09b8\u09cd\u099f \u09a4\u09be\u09b0\u09be\u0993 \u0995\u09bf \u09b8\u09c7\u0987\u09a6\u09bf\u09a8 \u099c\u09a8\u09cd\u09ae\u09a6\u09bf\u09a8 \u09aa\u09be\u09b2\u09a8 \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09c7\u09a8\u09be ", + "output": [ + "Personal" + ] + }, + { + "input": "\u099c\u0982\u09b2\u09bf \u09ae\u09c1\u09b0\u0997\u09bf\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09c7 \u098f\u0995\u099f\u09c1 \u09a6\u09c7\u0996\u09bf", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ad\u09be\u0987\u09df\u09be \u098f\u0987 \u09b8\u09ac \u09aa\u09be\u0997\u09b2 \u09a6\u09c7\u09b0\u0995\u09c7 \u09a8\u09bf\u09df\u09c7 \u0986\u09b8\u09c7\u09a8 \u0995\u09c7\u09a8 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0993\u0987 \u0995\u09c1\u0995\u09c1\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09ae\u09c7\u09df\u09c7 \u09a6\u09c7\u0996\u09b2\u09c7 \u09a6\u09a8 \u0996\u09be\u09b0\u09be \u09b9\u09df\u09c7 \u09af\u09be\u0987 \u09a8\u09be\u0995\u09bf \u09b8\u09be\u09b2\u09be\u09b0 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0987\u09df\u09be\u09ac\u09be\u09b9\u09cd \u0996\u09be\u0987\u09a4\u09c7 \u0996\u09be\u0987\u09a4\u09c7 \u09b8\u09bf\u09df\u09be\u09ae \u09b6\u09c7\u09b7", + "output": [ + "Personal" + ] + }, + { + "input": "\u09a4\u09cb\u09ae\u09be\u09b0 \u09ac\u09be\u09b2 \u0986\u09ae\u09be\u09b0 \u09ac\u09be\u09b2 \u0986\u09b0 \u0995\u09bf\u099b\u09c1 \u0995\u09ae\u09c1 \u09a8\u09be \u0986\u09ac\u09be\u09b2 \u09b6\u09be\u09b2\u09be", + "output": [ + "Personal" + ] + }, + { + "input": "\u099b\u09cb\u099f\u09bf \u0986\u099c\u09be\u09a6 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be", + "output": [ + "Personal" + ] + }, + { + "input": "\u09af\u09a4 \u09b8\u09ac \u0986\u09ac\u09be\u09b2\u09c7\u09b0 \u09aa\u09cd\u09b0\u09b2\u09be\u09ad ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0995\u09bf \u09b8\u09ac \u09ac\u09be\u09b2 \u09b8\u09be\u09b2 \u09b8\u09cb\u09a8\u09bf\u0995\u09be \u09a7\u09c1\u09b0 \u0995\u09cd\u09b7\u09cd\u09af\u09be\u09a4", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u0996\u09a8 \u0997\u09be\u09dc\u09bf \u099a\u09be\u09b2\u09be \u098f\u09b0\u09aa\u09b0 \u09b9\u09bf\u099c\u09be\u09ac \u098f\u09ad\u09be\u09ac\u09c7\u0987 \u09a4\u09cb \u0986\u09b8\u09cd\u09a4\u09c7 \u0986\u09b8\u09cd\u09a4\u09c7 \u09ac\u09a6\u09b2\u09be\u09ac\u09c7 \u09b9\u09be\u09df\u09b0\u09c7 \u099b\u09cc\u09a6\u09bf \u098f\u0987 \u0995\u09c1\u09b2\u09be\u0999\u09cd\u0997\u09be\u09b0\u09c7\u09b0 \u09ab\u09be\u09b8\u09bf \u099a\u09be\u0987", + "output": [ + "Personal" + ] + }, + { + "input": "\u09a6\u09be\u09dc\u09bf \u099f\u09c1\u09aa\u09bf \u09aa\u09b0\u09c7 \u0987\u09b8\u09b2\u09be\u09ae\u0995\u09c7 \u09b9\u09c7\u09df \u0995\u09b0\u099b\u09c7 \u09b8\u09be\u09b2\u09be \u099c\u0982\u0997\u09bf\u09a6\u09c7\u09b0 \u09ab\u09be\u09b8\u09bf \u09a6\u09c7\u0993\u09df\u09be \u09b9\u0989\u0995", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ac\u09be\u0981\u09b6 \u09ac\u09be\u0997\u09be\u09a8\u09c7\u09b0 \u09ae\u09be\u09b2\u09bf\u0995 \u0995\u09bf \u099a\u09c7\u099f\u09c7\u09b0 \u09ac\u09be\u09b2", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b8\u0989\u09ad\u09bf\u0995 \u09b8\u09be\u09b2\u09be \u0997\u09be\u099c\u09be\u0996\u09cb\u09b0\u09a6\u09c7\u09b0 \u09ae\u09a4 \u09b2\u09be\u0997\u09a4\u09c7\u099b\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ab\u0987\u09a8\u09cd\u09a8\u09bf \u09a5\u09be\u09b2\u09be \u09b9\u09be\u09a4\u09c7 \u09ad\u09bf\u0995\u09cd\u09b7\u09be \u099a\u09be\u0987\u099b\u09c7 \u09b9\u09be\u09b2\u09be\u09b0 \u09aa\u09cb \u09ad\u09bf\u0996\u09be\u09b0\u09c0 \u099c\u09be\u09a4\u09bf", + "output": [ + "Personal" + ] + }, + { + "input": "\u099f\u09c1\u0995\u09be\u0987 \u09b8\u09be\u09b2\u09be \u098f\u09b9\u09a8 \u0995\u09cb\u09b0\u09bf\u09af\u09bc\u09be\u09a8 \u09b9\u09c7\u09df\u09be\u09b0 \u09b8\u09cd\u099f\u09be\u0987\u09b2 \u0995\u09b0\u09a4\u09c7\u09b8\u09c7", + "output": [ + "Personal" + ] + }, + { + "input": "\u099f\u09af\u09bc\u09be \u098f\u0995\u099f\u09be \u09aa\u09a4\u09bf\u09a4\u09be \u0995\u09a8\u09a1\u09ae \u0995\u09a8\u09cd\u09af\u09be ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ae\u09c7\u09df\u09c7\u0997\u09c1\u09b2\u09be\u0993 \u09a8\u09bf\u09ae\u09a8\u09bf\u09ae\u09be \u09ac\u09c7\u09b6\u09cd\u09af\u09be \u0986\u09b0 \u09b6\u09df\u09a4\u09be\u09a8 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b6\u09c7\u09b7\u09c7\u09b0 \u099f\u09be \u09ae\u09be\u09a5\u09be\u09b2 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u0995\u09ac\u09be\u09b0 \u099c\u09a6\u09bf \u09a4\u09cb\u09b0\u09c7 \u09b8\u09be\u09ae\u09a8\u09c7 \u09aa\u09be\u0987\u09a4\u09be\u09ae \u09b9\u09be\u099c\u09be\u09b0 \u09aa\u09be\u09ac\u09b2\u09bf\u0995\u09c7\u09b0 \u09ae\u09be\u099d\u0996\u09be\u09a8\u09c7 \u09a4\u09cb\u09b0\u09c7 \u09b2\u09c7\u0982\u099f\u09be \u0995\u09b0\u09c7 \u09a6\u09bf\u09a4\u09be\u09ae ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ae\u09cd\u09af\u09be\u0997\u09bf\u09b8\u09cd\u09a5\u09be\u09aa\u09bf\u0995\u09be \u099f\u09df\u09be", + "output": [ + "Personal" + ] + }, + { + "input": "\u099f\u09df\u09be \u0995\u09bf \u0995\u09b0\u09c7 \u0986\u09b8\u09b2 \u09ae\u09bf\u09a1\u09bf\u09df\u09be\u09df \u099a\u09c7\u09b9\u09be\u09b0\u09be\u09b0 \u09b8\u09be\u0987\u099c \u09a8\u09be\u0987 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u09b8\u09ac \u09ad\u09be\u09b2\u0997\u09be\u09b0 \u09ad\u09bf\u09a1\u09bf\u0993 \u09ac\u09be\u09a8\u09be\u09a8\u09cb \u0985\u09ab \u0995\u09b0 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u0987 \u09b8\u09ac \u09aa\u09be\u0997\u09b2 \u099b\u09be\u0997\u09b2 \u0993 \u0987\u09a8\u09cd\u099f\u09be\u09b0\u09a8\u09c7\u099f \u098f \u09a6\u09c7\u0996\u09a4\u09c7 \u09b9\u09df ", + "output": [ + "Personal" + ] + }, + { + "input": " \u09ab\u09be\u09b8\u09bf\u0981\u09ac\u09bf\u099a\u09be\u09b0 \u09b6\u09c1\u09a7\u09c1 \u09ac\u09bf\u09b0\u09cb\u09a7\u09bf\u09a6\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09b8\u0982\u09b0\u0995\u09cd\u09b7\u09bf\u09a4 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u09b0 \u09af\u09a6\u09bf \u09ad\u09bf\u09a1\u09bf\u0993 \u09ac\u09be\u09b9\u09bf\u09b0 \u09b9\u09df \u09aa\u09cd\u09b0\u09ad\u09be\u09b0 \u099a\u09c7\u09df\u09c7 \u0993 \u09ac\u09c7\u09b6\u09bf \u099a\u09bf\u09b2\u09cd\u09b2\u09be\u0987 \u09ac\u09cb ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf\u09b0\u09c7 \u0995\u09c1\u09a4\u09cd\u09a4\u09be \u09a6\u09bf\u09df\u09c7 \u099a\u09c1\u09a6\u09be\u09a8\u09cb \u09a6\u09b0\u0995\u09be\u09b0 \u09ac\u09be\u0987\u09b0 \u09b9 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09a5\u09c7\u0995\u09c7 \u09a4\u09c1\u0987", + "output": [ + "Personal" + ] + }, + { + "input": "\u0986\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7 \u09aa\u09be\u0987\u09b2\u09bf \u09a8\u09be \u099c\u09be\u09ab\u09b0 \u09ac\u09be\u09b2\u09a1\u09be \u09b0\u09c7 \u0995\u09b2 \u09a6\u09bf\u099b\u09cb\u09b8 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u09b6\u09be\u09b2\u09be \u0996\u09ae\u09a4\u09be \u099b\u09c7\u09dc\u09c7 \u09a8\u09bf\u09b0\u09cd\u09ac\u09be\u099a\u09a8 \u09a6\u09c7\u09a8\u09be \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be", + "output": [ + "Personal" + ] + }, + { + "input": " \u0986\u09aa\u09a8\u09be\u09b0 \u09a8\u09be\u09ae \u09af\u09c7 \u0995\u09c7\u09a8 \u09b8\u09ac\u09be\u0987 \u099a\u099f\u09bf \u0986\u099c\u09be\u09a6 \u09b0\u09c7\u0996\u09c7\u099b\u09c7 \u09a4\u09be \u0986\u099c \u09ac\u09c1\u099d\u09b2\u09be\u09ae ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ac\u09be\u09b2\u09bf \u09b8\u09cb\u09a6\u09be\u0993 \u09a8\u09be \u0986\u09ac\u09be\u09b0 \u09ac\u09be\u0982\u09b2\u09be\u09df \u099c\u09a8\u09cd\u09ae\u0997\u09cd\u09b0\u09b9\u09a8 \u0995\u09b0\u09be \u09ae\u09be\u09b0\u09be\u0987\u099b \u0995\u09c7\u09a8 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0995\u09bf\u09b0\u09c7 \u09ad\u09cb\u09a6\u09be\u09df \u0995\u09bf \u099c\u09b2 \u098f\u09b8\u09c7 \u09aa\u09dc\u099b\u09c7 \u09a8\u09be\u0995\u09bf \u09ad\u09bf\u099c\u09c7 \u0997\u09c7\u099b\u09c7 \u09ac\u09b2\u09a4\u09c7\u099b\u09b8 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b8\u09cc\u09ad\u09bf\u0995 \u09a4\u09cb\u09b0 \u0995\u09be\u09b2\u09cb \u09aa\u09be\u099b\u09be\u09b0 \u09a6\u09be\u0997 \u099f\u09be \u0995\u09bf \u0997\u09c7\u099b\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": " \u09ae\u09bf\u09a5\u09cd\u09af\u09be \u0995\u09a5\u09be \u0996\u09be\u09b2\u09c7\u09a6\u09be \u099c\u09bf\u09df\u09be \u098f\u0996\u09a8\u09cb \u0985\u09ad\u09bf\u09a8\u09cd\u09a6\u09a8 \u099c\u09be\u09a8\u09be\u09df\u09a8\u09bf ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0986\u0993\u09ae\u09bf\u09b2\u09bf\u0997 \u098f\u0995\u09c7\u09b0 \u09aa\u09b0 \u098f\u0995 \u0998\u09a0\u09a8\u09be \u0995\u09b0\u09c7 \u099c\u09be\u099b\u099b\u09c7 \u09aa\u09cd\u09b0\u09ae\u09be\u09a8 \u09b8\u09b9\u09b6\u09bf\u0995\u09be\u09b0\u09c1\u09a4\u09bf \u09ae\u09bf\u09b2\u09be\u09b0 \u09aa\u09b0 \u09aa\u09b0 \u0993\u0995\u09cb\u09a8 \u09ac\u09bf\u099a\u09be\u09b0 \u09a8\u09be\u0987 \u09a6\u09b2 \u09a5\u09c7\u0995\u09c7 \u09b8\u09c1\u09a6\u09c1 \u09ac\u09b9\u09bf\u09b8\u0995\u09be\u09b0 \u0986\u09b0 \u09ac\u09bf\u098f\u09a8 \u09aa\u09bf \u099c\u09be\u09ae\u09be\u09a4 \u0997\u09c1\u09ae \u0996\u09c1\u09a8 \u099c\u09c7\u09b2 \u09ab\u09be\u09b8\u09bf \u09b8\u09ac \u09a8\u09bf\u099c\u099c\u09be \u09a4\u09a8\u09c7\u09b0 \u09b6\u09bf\u0996\u09be\u09b0 \u098f\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf\u09ac\u09be\u09a6 \u0995\u09b0\u09be\u09b0 \u09ae\u09a4 \u0995\u09bf \u0995\u09c7\u09b9 \u09a8\u09be\u0987 \u099c\u09be\u09a4\u09bf\u09b8\u0982\u0997\u09c7 \u098f\u09b0 \u09ac\u09bf\u099a\u09be\u09b0 \u099a\u09be\u0993\u09df\u09be \u09b9\u09cb\u0995 ", + "output": [ + "Personal" + ] + }, + { + "input": " \u0995\u09be\u09ac\u09be \u09b6\u09b0\u09bf\u09ab\u09c7\u09b0 \u0989\u09aa\u09b0 \u09af\u09c7 \u09ae\u09be\u09b2\u09be\u0993\u09a8 \u0995\u09c1\u0995\u09c1\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09ae\u09c1\u09b0\u09a4\u09bf \u099b\u09ac\u09bf \u09a6\u09bf\u0987\u09df\u09c7\u099b\u09c7 \u09a4\u09be\u0995\u09c7 \u09ab\u09be\u09b8\u09bf \u09a4\u09c7 \u099c\u09c1\u09b2\u09bf\u09df\u09c7 \u09ae\u09c3\u09a4\u09c1 \u09a6\u09c7\u0993\u09df\u09be \u09b9\u09cb\u0995 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0986\u09ac\u09be\u09b2\u09a6\u09c7\u09b0 \u09b0\u09c7\u09aa \u09b6\u09c1\u09a8\u09c7 \u0995\u09be\u09a8 \u09aa\u099b\u09c7 \u0997\u09c7\u099b\u09c7", + "output": [ + "Personal" + ] + }, + { + "input": "\u09a4\u09cb\u09b0 \u0993\u09af\u09bc\u09be\u09b2\u09c7 \u09a4\u09cb\u09b0 \u09ac\u09be\u09aa \u09a8\u09bf\u099c\u09be\u09ae\u09c0\u09b0 \u099b\u09ac\u09bf \u099d\u09c1\u09b2\u09be\u09a8\u09cb \u09a6\u09c7\u0996\u09b2\u09be\u09ae \u09b6\u09c1\u09af\u09bc\u09cb\u09b0\u09c7\u09b0 \u099b\u09be\u09a8\u09be \u09a4\u09cb\u09b0 \u09ac\u09be\u09aa\u09c7\u09b0 \u09a6\u09b2 \u099c\u09be\u09ae\u09be\u09a4\u09bf\u09b0\u09be \u09af\u09c7 \u098f\u09a8\u099c\u09bf\u0993\u09b0 \u09a8\u09be\u09ae\u09c7 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09a6\u09c7\u09b0 \u099c\u0999\u09cd\u0997\u09c0 \u099f\u09cd\u09b0\u09c7\u09a8\u09bf\u0982 \u09a6\u09c7\u09af\u09bc \u09b8\u09c7\u099f\u09be \u09b8\u09cd\u09ac\u09c0\u0995\u09be\u09b0 \u0995\u09b0\u09cb\u09b8 \u09a8\u09be \u0995\u09cd\u09af\u09be\u09a8 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u0985\u09aa\u09b0\u09be\u09a7\u09c7\u09b0 \u09b0\u09bf\u09aa\u09cb\u09b0\u09cd\u099f\u0997\u09c1\u09b2\u09bf\u09a4\u09c7 \u09a4\u09cb\u09b0 \u09ac\u09be\u09aa\u09c7\u09a6\u09c7\u09b0 \u09a8\u09be\u09ae \u0989\u09b2\u09cd\u09b2\u09c7\u0996 \u0995\u09b0\u09be \u0986\u099b\u09c7 \u09aa\u09a1\u09bc\u09c7 \u09a6\u09c7\u0996\u09bf\u09b8 \u09a8\u09bf\u099c\u09be\u09ae\u09c0\u09b0 \u09a8\u09be\u099c\u09be\u09af\u09bc\u09c7\u099c \u0986\u0993\u09b2\u09be\u09a6 \u09a4\u09cb\u09b0\u09be \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09a6\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09ae\u09be\u09af\u09bc\u09be\u0995\u09be\u09a8\u09cd\u09a8\u09be \u0995\u09b0\u09bf\u09b8 \u0995\u09be\u09b0\u09a8 \u0993\u09a6\u09c7\u09b0 \u09a6\u09bf\u09af\u09bc\u09c7 \u09b8\u09b9\u099c\u09c7\u0987 \u099c\u0999\u09cd\u0997\u09c0 \u0995\u09be\u09b0\u09cd\u09af\u0995\u09cd\u09b0\u09ae \u099a\u09be\u09b2\u09be\u09a4\u09c7 \u09aa\u09be\u09b0\u09bf\u09b8 \u09a4\u09cb\u09b0\u09be \u09a4\u09cb\u09b0\u09be \u0995\u0996\u09cb\u09a8\u0987 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09a6\u09c7\u09b0 \u09ae\u0999\u09cd\u0997\u09b2 \u099a\u09be\u09b8 \u09a8\u09be \u09a4\u09cb\u09b0\u09be \u099a\u09be\u09b8 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09b0\u09be \u098f\u09a6\u09c7\u09b6\u09c7\u09b0 \u09b0\u09bf\u09ab\u09bf\u0989\u099c\u09bf \u09b9\u09bf\u09b8\u09c7\u09ac\u09c7 \u0986\u09b8\u09c1\u0995 \u09af\u09be\u09a4\u09c7 \u0995\u09b0\u09c7 \u0993\u09a6\u09c7\u09b0 \u09a6\u09bf\u09af\u09bc\u09c7 \u09a4\u09cb\u09a6\u09c7\u09b0 \u099c\u0999\u09cd\u0997\u09c0 \u0995\u09be\u09b0\u09cd\u09af\u0995\u09cd\u09b0\u09ae \u099a\u09be\u09b2\u09be\u09a4\u09c7", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b8\u09bf\u09df\u09be\u09ae \u098f\u0995\u099f\u09be \u09aa\u09be\u09a1\u09be\u09b0 \u09aa\u09cb \u09aa\u09be\u09a1\u09be ", + "output": [ + "Personal" + ] + }, + { + "input": " \u098f\u09a6\u09c7\u09b0 \u09a6\u09c1\u0987 \u099c\u09a8\u0995\u09c7 \u09ab\u09be\u09b8\u09bf \u09a6\u09c7\u0993\u09df \u0989\u099a\u09a4 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u0996\u09a8\u0995\u09be\u09b0 \u09aa\u09cb\u09b2\u09be\u09aa\u09be\u09a8 \u09b0\u09c7 \u0995\u09bf\u099b\u09c1 \u0995\u0987\u09b2\u09c7 \u09af\u09c7 \u0995\u09df \u09a4\u09be\u09b0\u09c7\u0987 \u09aa\u09be\u0997\u09b2 \u09ad\u09c7\u09ac\u09c7 \u09a8\u09bf\u099c\u09c7\u0995\u09c7 \u09ac\u09c1\u09a6\u09cd\u09a7\u09bf\u09ae\u09be\u09a8 \u09ad\u09be\u09ac\u09a4\u09c7 \u09a5\u09be\u0995\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09a0\u09bf\u0995 \u09ae\u09a4\u09cb \u09ac\u09be\u0982\u09b2\u09be \u09ac\u09b2\u09a4\u09c7\u0987 \u09aa\u09be\u09b0\u09c7 \u09a8\u09be \u09b8\u09c7 \u0986\u09ac\u09be\u09b0 \u09a1\u09bf \u099c\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u0987 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09a6\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u0995\u09be\u09b2\u099a\u09be\u09b0 \u09a8\u09b7\u09cd\u099f \u09b9\u099a\u09cd\u099b\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ad\u09be\u0987 \u09a4\u09cb\u09ae\u09be\u09b0\u09c7 \u09a4\u09cb \u099a\u09c1\u09b0\u09c7\u09b0 \u09ae\u09a4 \u09b2\u09be\u0997\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u099b\u09be\u0997\u09b2\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09b8\u09bf\u09df\u09be\u09ae", + "output": [ + "Personal" + ] + }, + { + "input": "\u0993\u09b0 \u0986\u09b0 \u0995\u09cb\u09a8\u09cb\u09a6\u09bf\u09a8 \u09ab\u09be\u09b8\u09bf \u09b9\u09ac\u09c7 \u09a8\u09be", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ae\u09be\u09a6\u09be\u09b0\u099a\u09cb\u09a6 \u09b9\u09c7\u099f\u09be\u09b0 \u09aa\u09be\u099b\u09be\u09df \u09ad\u0987\u09b0\u09be \u09a6\u09bf\u09ae\u09c1 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0985\u09b8\u09ad\u09cd\u09af \u09b2\u09ae\u09cd\u09aa\u099f \u09a8\u09cb\u0982\u09b0\u09be \u0995\u09cb\u09a5\u09be\u0995\u09be\u09b0 ", + "output": [ + "Personal" + ] + }, + { + "input": " \u0995\u09c1\u09a4\u09be\u09b0 \u09ac\u099a\u09cd\u099a\u09be\u0995\u09c7 \u09ab\u09be\u09b8\u09bf \u09a6\u09c7\u0993\u09df\u09be \u0985\u099a\u09bf\u09a4 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ab\u09be\u09b8\u09bf\u09b0 \u09ae\u09a8\u09cd\u099a\u09c7 \u09a6\u09be\u09b0\u09bf\u09df\u09c7 \u09ac\u09b2\u09ac\u09cb \u0995\u09c1\u09b0\u0986\u09a8 \u0986\u09ae\u09be\u09b0 \u09b8\u0982\u09ac\u09bf\u09a7\u09be\u09a8 \u0986\u09ae\u09bf \u0995\u09c1\u09b0\u0986\u09a8\u09c7\u09b0 \u0986\u0987\u09a8 \u09ae\u09be\u09a8\u09bf", + "output": [ + "Personal" + ] + }, + { + "input": "\u09aa\u09be\u09b0\u09c7 \u09a8\u09be \u0995\u09a5\u09be \u09ac\u09b2\u09a4\u09c7 \u098f\u09b0 \u0986\u09ac\u09be\u09b0 \u0989\u09aa\u09b8\u09cd\u09a5\u09be\u09aa\u09a8\u09be \u0995\u09b0\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u0987 \u09ac\u09be\u0987\u09a8\u099a\u09cb\u09a6 \u099f\u09be \u0995\u09c7\u09ae\u09a8\u09c7 \u0995\u09cd\u09af\u09be\u09ae\u09c7\u09b0\u09be\u09b0 \u09b8\u09be\u09ae\u09a8\u09c7 \u0986\u09b8\u09c7 \u0997\u09b0\u09c1 \u09aa\u09bf\u099f\u09be\u09a8\u09cb \u09b2\u09be\u09a0\u09bf\u09b0 \u09ae\u09be\u0987\u09b0 \u0996\u09be\u0987\u09df\u09be \u09b9\u09df \u09a8\u09be\u0987 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf \u09a6\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09a6\u09c7\u09b6 \u099f\u09be \u09a8\u09b7\u09cd\u099f \u09b9\u09df\u09c7 \u09af\u09be\u099a\u09cd\u099b\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": " \u09b9\u09be\u09b2\u09be\u09b0 \u09aa\u09cb \u09b0\u09c7 \u09a7\u0987\u09b0\u09be \u099d\u09c1\u09b2\u09be\u0987 \u09a6\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u099f\u09df\u09be \u09ae\u09a8\u09c7\u09b9\u09df \u0998\u09c1\u09ae\u09be\u09df \u0993 \u09a6\u09be\u09a4 \u09ae\u09c7\u09b2\u09c7", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b8\u09be\u09b2\u09bf\u09b0\u09be \u09ae\u09bf\u09b8 \u0993\u09af\u09bc\u09be\u09b0\u09cd\u09b2\u09cd\u09a1 \u0986\u0987\u099b\u09c7 \u09a8\u09be\u0995\u09bf \u0997\u09be\u099c\u09be\u0996\u09c1\u09b0\u09c0 \u0995\u09a5\u09be \u09ac\u09b2\u09a4\u09c7 \u0986\u0987\u09b8\u09c7", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ac\u09b8\u09cd\u09a4\u09be\u09ad\u09b0\u09cd\u09a4\u09bf \u09ae\u09c7\u0995\u09be\u09aa \u09a8\u09bf\u09df\u09c7 \u09ac\u09be\u09b2\u09c7\u09b0 \u0995\u09a8\u09ad\u09be\u09b0\u09b8\u09c7\u09b6\u09a8 \u09a8\u09bf\u09df\u09be \u09ac\u09b8\u099b\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ac\u09bf\u09df\u09c7\u09b0 \u0995\u09df \u098f\u0995 \u09ae\u09be\u09b8\u09c7 \u09af\u09a6\u09bf \u09ac\u09be\u099a\u09cd\u099a\u09be \u09b9\u09df\u09c7 \u09af\u09be\u09df \u09a4\u09be\u0987\u09b2\u09c7 \u09a4\u09cb \u09b6\u09be\u09b2\u09c0 \u09a6\u09b6 \u09ac\u09c7\u099f\u09be\u09b0 \u09b2\u0997\u09c7 \u0998\u09b7\u09be\u0998\u09b7\u09bf \u0995\u09b0\u099b\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09a4\u09cb\u09ae\u09be\u09b0 \u09a6\u09c1\u09a7 \u09ac\u09dc \u0995\u09c7\u09a8\u09cb ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0996\u09c1\u09ac \u09b8\u09c1\u09a8\u09cd\u09a6\u09b0 \u0993 \u09b8\u09c7\u0995\u09cd\u09b8\u09bf \u09b2\u09be\u0997\u099b\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0987\u0989\u099f\u09bf\u0989\u09ac \u098f \u098f\u0995\u09be\u0989\u09a8\u09cd\u099f \u0996\u09c1\u09b2\u099b\u09cb\u09b8 \u09ad\u09be\u09b2\u09cb \u0995\u09bf\u099b\u09c1 \u09ac\u09be\u09a8\u09be \u09af\u09be\u09a4\u09c7 \u09ae\u09be\u09a8\u09c1\u09b7 \u09a6\u09c7\u0996\u09c7", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ac\u09be\u09b2 \u0997\u09c1\u09a8\u09c7 \u099b\u09c7\u09dc\u09c7 \u09a6\u09bf\u09b2\u09c7\u0993 \u09ae\u09cd\u09af\u09be\u0997\u09be\u099c\u09bf\u09a8 \u0985\u09a8\u09c1\u09b7\u09cd\u09a0\u09be\u09a8 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf \u099f\u09be\u09b0\u09c7 \u09a6\u09c7\u0996\u09b2\u09c7 \u09aa\u09b0\u09cd\u09a3 \u09b8\u09cd\u099f\u09be\u09b0 \u098f\u09b0 \u09ae\u09a4\u09c7 \u09b2\u09be\u0997\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b9\u09cd\u09af\u09be\u09b2\u09cb \u09b2\u09c1\u0987\u099a\u09cd\u099a\u09be \u0986\u099c\u09be\u09a6 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09bf\u09b0 \u09a6\u09be\u09a4 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09b9\u09b2\u09c1\u09a6 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b2\u09be\u0987\u09b8\u09c7\u09a8\u09cd\u09b8\u09c7\u09a1 \u09ae\u09be\u0997\u09c0 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf \u09ae\u09be\u0997\u09bf \u09a8\u09a1\u09bf\u09b0 \u09aa\u09c1\u09b2\u09be \u09ae\u09be\u09df\u09c7\u09b0 \u09b8\u09be\u09ae\u09a8\u09c7 \u09ad\u09bf\u09a1\u09bf\u0993 \u099a\u09be\u09b2\u09c1 \u0995\u09b0\u09b8\u09bf\u09b2\u09be\u09ae \u0986\u09b0 \u09a4\u09b0 \u09ac\u09be\u09b2\u09c7\u09b0 \u0986\u09b9 \u09b8\u09be\u0987\u09a8\u09cd\u09a1 \u0986\u0987\u09b8\u09be \u09aa\u09b0\u09b2 ", + "output": [ + "Personal" + ] + }, + { + "input": " \u09b0\u09c1\u09aa \u09b0\u09c7\u0996\u09be \u09a6\u09bf\u09df\u09c7\u099b\u09a8 \u09b8\u09b0\u0995\u09be\u09b0 \u0990 \u09b0\u09c1\u09aa\u09b0\u09c7\u0996\u09be \u0985\u09a8\u09c1\u09af\u09be\u09df\u09c0 \u09a8\u09bf\u09b0\u09cd\u09ac\u099a\u09a8 \u0995\u09ae\u09bf\u09b6\u09a8\u09be\u09b0 \u09a8\u09bf\u09b0\u09cd\u09ac\u09be\u099a\u09a8 \u0995\u09b0\u09b2\u09c7\u0993 \u09ac\u09c7\u0997\u09ae \u0996\u09be\u09b2\u09c7\u09a6\u09be \u09ac\u09b2\u09ac\u09c7\u09a8 \u09ae\u09be\u09a8\u09bf\u09a8\u09be \u09ae\u09be\u09a8\u09bf\u09a8\u09be\u0995\u09c7 \u0989\u09a8\u09bf \u0985\u09a8\u09c7\u0995 \u09ae\u09be\u09a8\u09cd\u09af \u0995\u09b0\u09c7\u09a8 \u09a4\u09be \u09b9\u09b2\u09c7 \u09b8\u09b0\u0995\u09be\u09b0\u0995\u09c7 \u0986\u0997\u09c7 \u09ae\u09be\u09a8\u09bf\u09a8\u09be \u09a6\u09be\u09ac\u09c0 \u09aa\u09c2\u09b0\u09a8 \u0995\u09b0\u09c7 \u09a8\u09bf\u09b0\u09cd\u09ac\u09be\u099a\u09a8 \u0995\u09ae\u09bf\u09b6\u09a8 \u0997\u09a0\u09a8\u09c7 \u0996\u09be\u09b2\u09c7\u09a6\u09be \u099c\u09bf\u09df\u09be\u09b0 \u09ae\u09a8\u09cb\u09a8\u09bf\u09a4\u09a6\u09c7\u09b0 \u09a8\u09bf\u09b0\u09cd\u09ac\u09be\u099a\u09bf\u09a4 \u0995\u09b0\u09be ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b6\u09be\u09b2\u09be \u09a4\u09c1\u0987 \u09b8\u09be\u09b2\u09ae\u09be\u09a8 \u09b0\u09bf\u09a6\u09bf\u09df\u09be \u0986\u09b8\u09bf\u09ab \u09b8\u09ac \u09aa\u09be\u0995\u09a8\u09be \u09aa\u09be\u0995\u09a8\u09be \u09aa\u09c1\u09b2\u09be\u09aa\u09be\u0987\u09a8 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ac\u09be\u0982\u09b2\u09be\u09af\u09bc \u0995\u09a5\u09be \u09ac\u09b2\u09a4\u09c7 \u0995\u09bf \u0986\u09aa\u09a8\u09be\u09b0 \u0995\u09b7\u09cd\u099f \u09b9\u09af\u09bc ", + "output": [ + "Personal" + ] + }, + { + "input": " \u098f\u09a6\u09c7\u09b0\u0995\u09c7 \u09aa\u09cd\u09b0\u0995\u09be\u09b6\u09cd\u09af\u09c7 \u09ab\u09be\u09b8\u09bf \u09a6\u09c7\u0993\u09df\u09be \u09b9\u09cb\u0995 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0986\u09ac\u09be\u09b8\u09bf\u0995 \u09b9\u09cb\u099f\u09c7\u09b2 \u09a8\u09be\u09ae\u0995 \u09af\u09c7\u0987 \u09a8\u09be\u099f\u0995 \u099f\u09be \u0995\u09b0\u09a4\u09c7\u09b8\u09bf\u09b8 \u09b8\u09c7\u0987\u099f\u09be \u09a6\u09c7\u0996\u09c7 \u09ae\u09a8\u09c7 \u09b9\u09df \u09a4\u09cb\u09a6\u09c7\u09b0 \u099c\u09a8\u09cd\u09ae \u0993\u09aa\u09c7\u09a8 \u09b0\u09be\u09b8\u09cd\u09a4\u09be \u0998\u09be\u099f\u09c7 \u09b9\u0987\u099b\u09c7 \u09af\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u098f\u09ae\u09a8 \u09a8\u09cb\u0982\u09b0\u09be\u09ae\u09c0 \u0995\u09b0\u09a4\u09c7 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09ac\u09bf\u09ac\u09c7\u0995\u09c7 \u09ac\u09be\u09a6\u09c7 \u09a8\u09be ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0995\u09cb\u0987\u099f\u09be \u09b2\u0997\u09c7 \u099a\u09cb\u09a6\u09be \u0996\u09be\u0987\u099a\u09a4", + "output": [ + "Personal" + ] + }, + { + "input": " \u09ac\u09c7\u0997\u09ae \u099c\u09bf\u09df\u09be\u0995\u09c7 \u0997\u09cd\u09b0\u09c7\u09ab\u09a4\u09be\u09b0 \u0995\u09b0\u09ac\u09c7\u09a8\u09be \u09b6\u09c1\u09a7\u09c1 \u09b9\u09c1\u09ae\u0995\u09bf \u09a6\u09bf\u09a4\u09be\u099b\u09c7 \u098f\u0987 \u09b6\u09c7\u0996 \u09b9\u09be\u099b\u09bf\u09a8\u09be \u099c\u09be\u09a8\u09c7 \u0985\u09ac\u09c8\u09a7 \u09ad\u09be\u09ac\u09c7 \u0995\u09cd\u09b7\u09ae\u09a4\u09be\u09df \u0986\u099b\u09c7 \u098f\u0996\u09a8 \u09af\u09a6\u09bf \u09ac\u09c7\u0997\u09ae \u0996\u09be\u09b2\u09c7\u09a6\u09be \u099c\u09bf\u09df\u09be\u0995\u09c7 \u0997\u09cd\u09b0\u09c7\u09ab\u09a4\u09be\u09b0 \u0995\u09b0\u09c7 \u09a4\u09be\u09b9\u09b2\u09c7 \u098f\u0995\u09a6\u09bf\u09a8\u0993 \u0986\u09b0 \u0995\u09cd\u09b7\u09ae\u09a4\u09be\u09df \u09a5\u09be\u0995\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09c7\u09a8\u09be \u099c\u09a8\u0997\u09a8\u09c7\u09b0 \u0986\u09a8\u09cd\u09a6\u09b2\u09cb\u09a8 \u0986\u09b0 \u0995\u09bf\u099b\u09c1\u09a4\u09c7 \u09a0\u09c7\u0995\u09be\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09c7 \u09a8\u09be \u09a6\u09c7\u09b6\u09c0 \u09ac\u09bf\u09a6\u09c7\u09b6\u09c0 \u099a\u09be\u09aa\u09c7 \u0995\u09cd\u09b7\u09ae\u09a4\u09be \u09a5\u09c7\u0995\u09c7 \u09a8\u09be\u09ae\u09a4\u09c7 \u09b9\u09ac\u09c7 \u0986\u09b0 \u09a6\u09c7\u09b6 \u09b8\u09c7\u09b0\u09c7 \u09ad\u09be\u09b0\u09a4 \u09aa\u09be\u09b0\u09bf \u09a6\u09bf\u09a4\u09c7 \u09b9\u09ac\u09c7 \u098f\u0987 \u09b8\u09ac \u09b6\u09c7\u0996 \u09b9\u09be\u099b\u09bf\u09a8\u09be \u099c\u09be\u09a8\u09c7 \u09a4\u09be\u0987 \u0997\u09cd\u09b0\u09c7\u09ab\u09a4\u09be\u09b0\u09c7\u09b0 \u09ae\u09bf\u099b\u09c7 \u09b9\u09c1\u09ae\u0995\u09bf \u09a6\u09bf\u09a4\u09be\u099b\u09c7 \u09af\u09be\u09a4\u09c7 \u0995\u09b0\u09c7 \u09ac\u09bf\u098f\u09a8\u09aa\u09bf \u09a8\u09c7\u09a4\u09b0\u09c0 \u09b0\u09be\u09b8\u09cd\u09a4\u09be\u09df \u098f\u09b8\u09c7 \u0986\u09a8\u09cd\u09a6\u09cb\u09b2\u09a8 \u09a8\u09be \u0995\u09b0\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ad\u09c1\u09b2\u099f\u09be \u09aa\u09cd\u09b0\u09b6\u09cd\u09a8 \u0995\u09b0\u09cd\u09a4\u09be\u09b0 \u09b8\u09c7 \u098f\u0995\u099f\u09be \u0989\u09a8\u09cd\u09a8\u09a4 \u09ae\u09be\u09a8\u09c7 \u099b\u09be\u0997\u09c0 \u099f\u09be\u0987\u09aa ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0995\u09bf\u09b0\u09c7 \u09b6\u09be\u09b2\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09ac\u09be\u09b6\u09c7\u09b0 \u09ac\u09be\u09b0\u09bf\u09b0 \u09ac\u09c7\u09a5\u09be \u0995\u09bf \u0995\u09ae\u09c7 \u0997\u09c7\u099b\u09c7 \u09af\u09c7 \u0986\u09ac\u09be\u09b0 \u0986\u09ac\u09b2\u09be\u09ae\u09c1 \u0995\u09b0\u09a4\u09c7 \u0986\u09b8\u099b\u09bf\u09b8", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b8\u09a4\u09cd\u09af\u09c7\u09b0 \u09ac\u09be\u09a8\u09c0 \u09a8\u09bf\u09b0\u09ac\u09c7 \u0995\u09be\u09a6\u09c7\u0981 \u09a4\u09cd\u09b0 \u09b2\u09cb\u0995\u09c7\u09b0 \u0985\u09aa\u09b0\u09be\u09a6 \u0995\u09bf \u099b\u09bf\u09b2 \u09b8\u09c7 \u09b8\u09a4\u09cd\u09af \u09b8\u0982\u09ac\u09be\u09a6 \u09aa\u0995\u09be\u09b6 \u0995\u09b0\u09a4 \u09a4\u09be\u0987\u09a4\u09cb \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09aa\u09be\u09df \u0995\u09cb\u099f\u09bf \u09ae\u09be\u09a8\u09c1\u09b7 \u099c\u09c7\u09a8\u09c7 \u0997\u09c7\u09b2 \u09a4\u09cd\u09b0 \u09ab\u09be\u09b8\u09bf\u0981\u0995 \u09b8\u09b0\u0995\u09be\u09b0\u09c7\u09b0 \u09b8\u09ac \u0995\u09c1\u0995\u09ae\u09c7\u09b0 \u0995\u09a5\u09be", + "output": [ + "Personal" + ] + }, + { + "input": "\u09a4\u09be\u09b0\u0989\u09aa\u09b0 \u098f\u099f\u09be \u0995\u09c7\u09ae\u09a8 \u099f\u09be\u0987\u099f\u09c7\u09b2 \u09a6\u09bf\u099b\u09b8 \u09a4\u09cb\u09b0 \u09ad\u09bf\u09a1\u09bf\u0993\u09b0 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09aa\u09b0\u09bf\u099a\u09df\u09c7\u09b0 \u0986\u0997\u09c7\u0987 \u099a\u09c1\u09a6\u09c7 \u09a6\u09bf\u09b2\u09cb ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09a4\u09cb\u09ae\u09be\u09a6\u09c7\u09b0 \u098f \u09b6\u09cb \u09a5\u09c7\u0995\u09c7 \u099c\u09c7\u099a\u09bf\u0995\u09be \u09b6\u09a8\u09be\u09ae \u09a8\u09c7\u09b0 \u099a\u099f\u09bf \u09a6\u09c7\u0996\u09be \u0985\u09a8\u09c7\u0995 \u09ad\u09be\u09b2 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b8\u09be\u099c\u09c1 \u0996\u09be\u09a6\u09c7\u09ae \u09a4\u09c1\u0987 \u098f\u0995\u099f\u09bf \u09b2\u099f\u09bf \u09ae\u09be\u0997\u09bf\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09a8\u09bf\u099c\u09c7\u09b0\u0987 \u09af\u09cb\u0997\u09cd\u09af\u09a4\u09be \u09a8\u09be\u0987 \u09ae\u09bf\u09b8 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09b9\u0993\u09df\u09be\u09b0 \u0986\u09ac\u09be\u09b0 \u0986\u0987\u09b8\u09c7 \u0985\u09a8\u09cd\u09af\u09a6\u09c7\u09b0 judge \u0995\u09b0\u09a4\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "Bong \u0986\u09b0 \u0995\u09a4 \u09a6\u09bf\u09a8 \u098f\u0987 \u09ac\u09be\u0987\u09a8\u099a\u09cb\u09a6 \u09a6\u09c7\u09b0 \u09a8\u09bf\u09df\u09c7 \u099a\u09be\u09b2\u09be\u09ac\u09c7", + "output": [ + "Personal" + ] + }, + { + "input": " \u09ae\u09cd\u09af\u09be\u09a1\u09be\u09ae \u09b8\u09b0\u09cd\u09ac\u09cb\u099a\u09cd\u099a \u09b8\u09be\u099c\u09be \u09ac\u09b2\u09a4\u09c7 \u09ab\u09be\u09b8\u09bf\u0981 \u09b9\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 \u09a4\u09be \u0995\u09b0\u09a4\u09c7 \u0997\u09c7\u09b2\u09c7 \u09ac\u09c7\u09b6 \u09b8\u09ae\u09be\u09df\u09c7\u09b0 \u09aa\u09cd\u09b0\u09df\u09cb\u099c\u09a8 \u099c\u09a8\u0997\u09a8 \u0996\u09be\u09a6\u09bf\u099c\u09be\u09b0 \u098f\u0987 \u0998\u099f\u09a8\u09be\u09b0 \u09ac\u09bf\u099a\u09be\u09b0 \u0996\u09c1\u09ac \u09a6\u09cd\u09b0\u09c1\u09a4 \u09aa\u09c7\u09a4\u09c7 \u099a\u09be\u0987 \u09a4\u09be\u0987 \u09ac\u09b2\u099b\u09bf \u0995\u09cd\u09b0\u09b8\u09ab\u09be\u09df\u09be\u09b0 \u09a4\u09cb \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09a8\u09bf\u09a4\u09cd\u09af \u09a6\u09bf\u09a8\u09c7\u09b0 \u09b8\u0999\u09cd\u0997\u09c0 \u09a4\u09be\u0987 \u09ac\u09b2\u09bf\u09b7\u09cd\u09a0 \u0995\u09a8\u09cd\u09a0\u09c7 \u09ac\u09b2\u09a4\u09c7 \u099a\u09be\u0987 \u09ac\u09a6 \u09ac\u09a6\u09b0\u09c1\u09b2\u09c7\u09b0 \u09ae\u09a4 \u099c\u09be\u09a8\u09cb\u09df\u09be\u09b0\u0995\u09c7 \u099c\u09a8\u09b8\u09ae\u09cd\u09ae\u09c1\u0996\u09c7 \u0995\u09cd\u09b0\u09b8\u09ab\u09be\u09df\u09be\u09b0 \u09a6\u09c7\u09df\u09be \u09b9\u09cb\u0995 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ae\u09be\u09a6\u09be\u09b0\u09bf\u099a\u09cb\u09a6 \u0995\u09a4\u09ac\u09a1 \u09ac\u09c7\u09df\u09be\u09a6\u09ac ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0986\u09b0 \u098f\u0987 \u09ae\u09be\u0998\u09be \u0997\u09c1\u09b2\u09be \u0995\u09c7 \u09a6\u09c7\u0996\u09a4\u09c7 \u09aa\u09c1\u09b0\u09be \u099d\u09be\u09b0\u099c \u09b8\u09a8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u09ae\u09a4 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0993\u09b0 \u0995\u09a5\u09be\u09b0 \u09a6\u09b0\u09a8\u0987 \u09ad\u09be\u09b2\u09cb \u09a8\u09be ", + "output": [ + "Personal" + ] + }, + { + "input": " \u09a4\u09be\u09b0\u09c7\u0995 \u0986\u09b0 \u0996\u09be\u09b2\u09c7\u09a6\u09be \u099c\u09bf\u09df\u09be\u09b0 \u09ac\u09be\u09b2\u09c7\u09b0 \u09af\u09cb\u0997\u09cd\u09af\u09a4\u09be \u09a8\u09c7\u0987 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09a4\u09c1\u0987 \u0986\u0987 \u0986\u09ae\u09b0\u09be \u0989\u099a\u09c1 \u0995\u09b0\u09c7 \u09a8\u09bf\u09df\u09c7 \u09a6\u09be\u09dc\u09bf\u09df\u09c7 \u0986\u099b\u09bf ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ae\u09be\u09a6\u09be\u09b0\u099a\u09cb\u09a6 \u09b9\u09cb\u09b2 \u09a4\u09c1\u0987\u09b2\u09be \u09a8\u09bf\u09df\u09be \u0986\u0987\u09b8\u09b8", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u09a6\u09c7\u09b0 \u0995\u09c7 \u099a\u09cb\u09a6\u09cd\u09a6 \u09ac\u099b\u09b0\u09c7 \u09ab\u09be\u09b8\u09bf \u09a6\u09c7\u09df\u09be \u09b9\u09cb\u0995", + "output": [ + "Personal" + ] + }, + { + "input": " \u09b9\u09be\u09b2\u09be\u09b0 \u09aa\u09cb \u09b9\u09be\u09b2\u09be\u09b0\u09be \u09ae\u09bf\u09df\u09be\u09a8\u09ae\u09be\u09b0\u09c7\u09b0 \u0996\u09ac\u09b0 \u0997\u09c1\u09b2\u09be \u099b\u09be\u09aa\u09be\u0987\u09a4\u09c7 \u09aa\u09be\u09b0\u09bf\u09b8 \u09a8\u09be \u09a8\u09a1\u09bf\u09b0 \u09aa\u09cb ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b0\u09be\u09b8\u09cd\u09a4\u09be\u09b0 \u09ae\u09c7\u09df\u09c7 \u09aa\u09a4\u09bf\u09a4\u09be\u09b0 \u099a\u09c7\u09df\u09c7 \u0996\u09be\u09b0\u09be\u09ab ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b2\u09be\u09ad \u09a8\u09be\u0987 \u0995\u09be\u09b0\u09a8 \u098f\u09a6\u09c7\u09b6\u09c7\u09b0 \u09b9\u09bf\u09a8\u09a6\u09c1\u09a6\u09c7\u09b0 \u099c\u09ae\u09bf \u09a6\u0996\u09b2 \u09b9\u09bf\u09a8\u09a6\u09c1 \u09ae\u09c7\u09df\u09c7 \u09ac\u0989\u09a6\u09c7\u09b0 \u09ac\u09c7\u0987\u099c\u099c\u09a6\u09bf \u0995\u09b0\u09be \u098f\u09a6\u09c7\u09b6\u09c7\u09b0 \u098f\u0995\u099f\u09bf \u09b0\u09cd\u09b8\u09be\u09ac\u099c\u09a8\u09bf\u09a8 \u0989\u09a4\u09b8\u09ac \u098f \u09ac\u09cd\u09af\u09be\u09aa\u09be\u09b0\u09c7 \u0995\u09cb\u09a8 \u0986\u09aa\u09cb\u09b8 \u0995\u09b0\u09be \u09b9\u09df \u09a8\u09be \u0995\u09a5\u09be\u09df \u0986\u099b\u09c7 \u09a8\u09be \u099a\u09cb\u09b0\u09c7 \u099a\u09cb\u09b0\u09c7 \u09ae\u09be\u0989\u09b8\u09a4\u09cb\u09a4\u09cb \u09ad\u09be\u0987 \u0986\u09ae\u09be\u09b0 \u09ae\u09a4\u09c7 \u098f\u0987 \u09b9\u09be\u09ae\u09b2\u09be\u09df \u09b9\u09bf\u09a8\u09a6\u09c1\u09a6\u09c7\u09b0 \u09af\u09c7 \u0996\u09a4\u09bf \u09b9\u0987\u099b\u09c7 \u09a4\u09be\u09b0 \u09aa\u09be\u099a\u0997\u09c1\u09a8 \u09ac\u09c7\u09b6\u09bf \u0996\u09a4\u09bf\u09aa\u09c1\u09b0\u09a8 \u09a6\u09c7\u09df\u09be \u09b9\u09cb\u0995 \u0986\u09b0 \u0985\u09aa\u09b0\u09be\u09a7\u09c0\u09a6\u09c7\u09b0 \u09ab\u09be\u09b8\u09bf \u09a6\u09c7\u09df\u09be \u09b9\u09cb\u0995 \u09af\u09a4\u0987 \u09aa\u09cd\u09b0\u09ad\u09be\u09ac\u09b6\u09be\u09b2\u09c0 \u09b9\u09cb\u0995 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ac\u09be\u0981\u09b6 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09a4\u09cb\u09ae\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u09b0\u09c7\u09a1\u09bf \u0986\u099b\u09c7 \u09b6\u09c1\u09a7\u09c1 \u09a4\u09cb\u09ae\u09be\u09b0\u09c7 \u0986\u09ac\u09be\u09b0 \u09ac\u09be\u09a1\u09c7 \u09aa\u09be\u0987\u09df\u09be \u09b2\u0987 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be ", + "output": [ + "Personal" + ] + }, + { + "input": "\u098f\u0987 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u098f\u099f\u09be \u0995\u09bf \u0987\u0982\u09b2\u09bf\u09b6 \u0985\u09a8\u09c1\u09b7\u09cd\u099f\u09be\u09a8 \u09ae\u09be\u09a6\u09be\u09a6\u09b0 \u099a\u09cb\u09a6", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b8\u09ac\u09be\u0987 \u09a6\u09c1\u09a7 \u09ad\u09be\u09b8\u09be\u0987\u09df\u09be \u0986\u09b6\u09c7 \u099f\u09bf\u09ad\u09bf\u09b0 \u09b8\u09be\u09ae\u09a8\u09c7 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09b9\u09be\u09b2\u09be\u09b0 \u09aa\u09cb \u09b9\u09be\u09b2\u09be \u09a4\u09cb\u09b0 \u09ac\u09be\u09aa \u0995\u09bf \u09ac\u09b2 \u0995\u09b0\u09ac\u09c7 \u0986\u09b8\u09bf\u09b8 \u0995\u09c7\u09ae\u09a8 \u0995\u09b0\u09c7 \u09b0\u09be\u09a8 \u0995\u09b0\u09a4\u09c7 \u09b9\u09df \u09a6\u09c7\u0996\u09bf\u09df\u09c7 \u09a6\u09bf\u09ae\u09c1 \u0995\u09c1\u09a4\u09cd\u09a4\u09be ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0986\u09ac\u09be\u09b2\u09c7\u09b0 \u0987\u0982\u09b2\u09bf\u09b6 \u09b6\u09be\u09b2\u09be", + "output": [ + "Personal" + ] + }, + { + "input": " \u099c\u09be\u09b0\u09be \u098f\u0997\u099f\u09a8\u09be\u09b0 \u09b8\u09be\u09a5\u09c7 \u099c\u09b0\u09bf\u09a4 \u09a4\u09be\u09a6\u09c7\u09b0 \u09ab\u09be\u09b8\u09bf \u099a\u09be\u0987 ", + "output": [ + "Personal" + ] + }, + { + "input": " \u099a\u09c1\u09b0\u09c7\u09b0 \u09b8\u09be\u09a4\u09cd\u09a4\u09bf \u09a8\u09cb\u0995 \u0995\u09be\u099f\u09be \u09aa\u09c1\u09b0\u09bf\u09af\u09c7 \u09ae\u09be\u09b0\u09be \u09a8\u09af \u098f\u099f\u09be \u098f\u0995 \u09a7\u09b0\u09a8\u09c7\u09b0 \u0996\u09c1\u09a8 \u0985\u09be\u09b0 \u0996\u09c1\u09a8\u09c7\u09b0 \u09b8\u09be\u09a4\u09cd\u09a4\u09bf \u09ab\u09be\u09b8\u09bf \u09af\u09be\u09b0\u09be \u098f \u0995\u09be\u099c \u0995\u09b0\u09c7\u099b\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0 \u09ab\u09be\u09b8\u09bf \u09a6\u09c7\u0993\u09af\u09be \u09a6\u09b0\u0995\u09be\u09b0 \u0985\u09be\u09ae\u09bf \u09ae\u09a8\u09c7 \u0995\u09b0\u09bf ", + "output": [ + "Personal" + ] + }, + { + "input": "\u099f\u09df\u09be \u09ae\u09be\u0997\u09c0 \u09ab\u09be\u09b2\u09a4\u09c1 ", + "output": [ + "Personal" + ] + }, + { + "input": "\u0995\u09cb\u09a8 \u0997\u09cd\u09b0\u09b9\u09c7\u09b0 \u09ae\u09be\u09a8\u09c1\u09b2 \u098f\u09b0\u09be ", + "output": [ + "Personal" + ] + }, + { + "input": "\u09ac\u09c7\u09af\u09bc\u09be\u09a6\u09ac\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u0996\u09be\u09ae\u09cd\u09ac\u09be \u099a\u09c1\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u098f\u0987 \u0995\u09c1\u0995\u09c1\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099b\u09be \u09aa\u09be\u09b0\u09cd\u09a5 \u098f\u0995\u099f\u09be \u09ac\u09c7\u09df\u09be\u09a6\u09ac \u098f \u0995\u09c7 \u099c\u09c1\u09a4\u09be \u09a6\u09bf\u09df\u09c7 \u09aa\u09bf\u099f\u09be\u09a8\u09cb \u09a6\u09b0\u0995\u09be\u09b0 \u09b6\u09c1\u09df\u09cb\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099b\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u09ae\u09be\u09b9\u09bf\u09b0 \u0995\u09be\u09b0\u09a8\u09c7 \u09a4\u09be\u09b0 \u09ac\u09be\u09aa\u09c7\u09b0 \u098f\u0987\u09a6\u09b6\u09be", + "output": [ + "Political" + ] + }, + { + "input": "\u0986\u09ae\u09b0\u09be \u0995\u09be\u0989\u09b0\u09c7 \u099c\u09be\u09ae\u09be\u09a4\u09c7\u09b0 \u0986\u09ae\u09bf\u09b0 \u09b9\u0987\u09a4\u09c7 \u09a6\u09bf\u09ae\u09c1\u09a8\u09be \u0986\u09ae\u09bf\u09b0 \u09b9\u0987\u09b2\u09c7\u0987 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09ac\u09be\u09a8\u09be\u0987\u09df\u09be \u09a6\u09bf\u09ae\u09c1 \u09a4\u09be\u09b0\u09aa\u09b0 \u09ae\u09c1\u09b9\u09be\u09b9\u09be\u09b9\u09be", + "output": [ + "Political" + ] + }, + { + "input": "\u09a6\u09c1\u0987\u09a6\u09bf\u09a8\u09c7\u0987 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09b9\u09df\u09c7 \u0997\u09c7\u09b2\u09cb \u0986\u09ae\u09be\u09b0\u09c7 \u0986\u09ae\u09bf\u09b0 \u09ac\u09be\u09a8\u09be\u0987\u09b2\u09c7 \u0993 \u09a6\u09c7\u0996\u09be \u09af\u09be\u09ac\u09c7 \u098f\u0987 \u099c\u09be\u09a8\u09cb\u09df\u09be\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099b\u09be\u09b0\u09be \u0986\u09ae\u09be\u0995\u09c7 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09ac\u09b2\u09ac\u09c7 \u0986\u09b8\u09b2\u09c7 \u09b8\u09be\u0982\u09ac\u09be\u09a6\u09bf\u0995 \u0986\u09b0 \u0986\u0993\u09df\u09be\u09ae\u09c0 \u09b2\u09c0\u0997 \u09b9\u09b2\u09cb \u09b8\u09c7\u09b2\u09bf\u09ae \u0993\u09b8\u09ae\u09be\u09a8\u09c7\u09b0 \u09ad\u09be\u09b7\u09be\u09df ", + "output": [ + "Political" + ] + }, + { + "input": "\u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b2\u09c0\u0997 \u098f\u0987 \u09b8\u09c7\u0987 \u09b2\u09cb\u0995 \u09af\u09be\u09b0 \u099c\u09c1\u09a4\u09be\u09b0 \u09ac\u09be\u09b0\u09bf \u0996\u09be\u0993\u09df\u09be\u09b0 \u09aa\u09b0 \u0993 \u0986\u09b0\u09cb \u0996\u09c7\u09a4\u09c7 \u099a\u09be\u0987\u09a4\u09c7\u099b\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": " \u09a8\u09bf\u099c\u09c7\u09b0 \u09a6\u09b2\u09c7\u09b0 \u09ad\u09c7\u09a4\u09b0 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0 \u09ac\u09bf\u099a\u09be\u09b0 \u0995\u09b0\u09c7 \u09a8\u09be \u0995\u09c7\u09a8 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b9\u09be\u09b8\u09bf\u09a8\u09be\u09b0 \u09aa\u09a4\u09a8 \u099a\u09be\u0987 \u09b8\u09cc\u09b0 \u09b9\u09be\u09b8\u09bf\u09a8\u09be\u09b0 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b2\u09c0\u0997 \u09ac\u09be\u0982\u09b2\u09be\u09b0 \u09ae\u09be\u09a0\u09bf\u09a4\u09c7 \u0986\u09ae\u09b0\u09be \u0986\u09b0 \u099a\u09be\u0987 \u09a8\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u09ae\u09b0\u09b2\u09c7 \u09a6\u09c7\u09b6\u09c7 \u09b8\u09be\u09a8\u09a4\u09bf \u0986\u09b8\u09ac\u09c7", + "output": [ + "Political" + ] + }, + { + "input": "\u0986\u09aa\u09a8\u09be\u09b0\u09be \u09ae\u09be\u09ae\u09be \u09ad\u09be\u0997\u09cd\u09a8\u09c7 \u0986\u09aa\u09a8\u09be\u09b0\u09be \u09a0\u09bf\u0995\u0987 \u0986\u099b\u09c7\u09a8 \u09a6\u09c7\u09b6\u09c7\u09b0 \u099c\u09a8\u0997\u09a3\u09c7\u09b0 \u0997\u09cb\u09df\u09be \u09ae\u09be\u09b0\u09be \u09b8\u09be\u09b0\u09be", + "output": [ + "Political" + ] + }, + { + "input": "\u09b8\u0995\u09be\u09b2\u09c7 \u098f\u0995\u099f\u09be \u09ac\u09b2\u09c7\u09a8 \u09ac\u09bf\u0995\u09c7\u09b2\u09c7 \u0986\u09b0\u09c7\u0995\u099f\u09be \u09ac\u09b2\u09c7\u09a8 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0 \u09b8\u09a8\u09cd\u09a4\u09be\u09a8\u09b0\u09be \u098f\u099f\u09be\u0987 \u09aa\u09cd\u09b0\u09ae\u09be\u09a8 \u09af\u09c7 \u0986\u09b2\u09cd\u09b2\u09be \u09aa\u09be\u0996 \u09a4\u09be\u0995\u09c7 \u09ac\u09be\u0981\u099a\u09bf\u09df\u09c7 \u09b0\u09be\u0996\u09ac\u09c7\u09a8 \u0987\u09a8\u09b6\u09be \u0986\u09b2\u09cd\u09b2\u09be\u09b9\u09cd\u09b0 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09a6\u09c1 \u09a6\u09bf \u09a8\u09c7\u0987 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u0995\u09ae\u09be\u09a8\u09cd\u09a1\u09be\u09b0 \u09b9 \u09df\u09c7 \u0997\u09c7\u09b2", + "output": [ + "Political" + ] + }, + { + "input": "\u09a4\u09cb\u09b0 \u09ae\u09be \u09a4\u09cb \u09af\u09c1\u09a6\u09cd\u09a7\u09c7\u09b0 \u09b8\u09ae\u09df \u09aa\u09be\u0995\u09b8\u09cd\u09a4\u09be\u09a8\u09c7 \u09ad\u09be\u09b2\u09cb\u0987 \u0986\u09b0\u09be\u09ae \u0986\u09df\u09c7\u09b6 \u0995\u09b0\u09c7\u099b\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": "\u0986\u0993\u09ae\u09b2\u09c0\u0997 \u09a8\u09be \u0995\u09bf \u09b9\u09bf\u09a8\u09a6\u09a6\u09c7 \u09aa\u09cb\u099c\u09be \u0995\u09b0\u09c7 \u09b6\u09bf\u09ac\u09bf\u09b0 \u09ac\u09bf\u098f\u09a8\u09aa\u09bf \u09ac\u09b2\u09c7 \u098f\u0996\u09a8 \u09a6\u09c7\u0996 \u0986\u0993\u09ae\u09b2\u09c0\u0997 \u0996\u09be\u099f\u09bf \u09ae\u09b8\u09b2\u09c0\u09ae \u0986\u09b0 \u09b8\u09ac \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0 \u09a6\u09b2", + "output": [ + "Political" + ] + }, + { + "input": "\u09a4\u09c7\u09be\u09ae\u09be\u09b0 \u09ae\u09a4 \u099c\u09be\u09ae\u09be \u09a4\u09bf \u09ae\u09c1\u09b8 \u09b2\u09bf\u09ae \u09a6\u09c7\u09b0 \u09a6\u09c7\u09be\u09df\u09be \u09aa\u09cd\u09b0 \u09df\u09c7\u09be\u099c\u09a8 \u09a8\u09be\u0987 \u09a4\u09c7\u09be \u09a6\u09c7\u09b0 \u0985\u09a8\u09cd\u09a4\u09b0\u09c7 \u0995\u09be \u09b2\u09c7\u09be \u09a6\u09be\u0997 \u0995\u09be\u09b0\u09a8 \u09a4\u09c7\u09be\u09b0\u09be \u09aa\u09be \u0995\u09bf \u0993 \u09b0\u09be\u099c\u09be\u0995\u09be \u09a6\u09c7\u09b0 \u09b0 \u0995\u09cd\u09a4\u09c7\u09be \u09a4\u09c7\u09be \u09a6\u09c7\u09b0 \u09b6 \u09b0\u09bf \u09b0\u09c7 \u09ae\u09c7\u09b8\u09be\u09a8 \u09a4\u09c7\u09be\u09a6\u09c7\u09b0 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09ac\u09be\u09aa \u09a6\u09c7\u09b0 \u09a5\u09c7 \u0995\u09c7 \u09ab \u09b0\u09bf\u09a6\u0989 \u09a6\u09cd\u09a6\u09bf\u09a8 \u09ae\u09c1\u09b8\u09c1\u09a6 \u0997\u09c1\u09a8 \u09ad\u09b2\u09bf \u0995\u09be\u09b0\u09a8 \u09a4\u09bf \u09a8\u09bf \u098f\u0995\u099c\u09a8 \u09ae\u09c1 \u0995\u09cd\u09a4\u09bf \u09af\u09c1\u09a6\u09cd\u09a7\u09be \u0993 \u0985\u09be \u09b2\u09c7\u09ae ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b9\u09be\u099b\u09bf\u09a8\u09be\u09b0 \u09b6\u09bf\u0995\u09cd\u09b7\u09be \u09ac\u09c7\u09b6\u09bf \u09a4\u09be\u0987 \u09b9\u09be\u099c\u09be\u09b0 \u09b9\u09be\u099c\u09be\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7 \u0996\u09c1\u09a8 \u0995\u09b0\u09c7\u099b\u09c7\u09a8 \u098f\u09ae\u09a8 \u09b6\u09bf\u0995\u09cd\u09b7\u09be\u09b0 \u09a6\u09b0\u0995\u09be\u09b0 \u09a8\u09be\u0987 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09ac\u099b\u09b0 \u09a7\u09b0\u09c7 \u09a6\u09c7\u09b6\u09c7 \u09a7\u09b0\u09cd\u09b7\u09a8 \u09b9\u09a4\u09cd\u09af\u09be \u099a\u09be\u09b2\u09bf\u09af\u09bc\u09c7 \u09af\u09be\u099a\u09cd\u099b\u09c7 \u099c\u0982\u09b2\u09bf \u09a8\u09be\u09ae\u0995 \u09ae\u09be\u09ab\u09bf\u09af\u09bc\u09be\u09b2\u09c0\u0997 \u09a4\u09be\u09b0\u09be \u0995\u09bf \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09a8\u09be ", + "output": [ + "Political" + ] + }, + { + "input": " \u09ac\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09b0 \u09aa\u0995\u09cd\u09b7 \u098f\u0987 \u09aa\u09cd\u09b0\u09a5\u09ae \u0986\u09a8\u09cd\u09a6\u09cb\u09b2\u09a8 \u09b6\u09bf\u09ac\u09bf\u09b0 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09ac\u09be\u09a7\u09be \u09a6\u09bf\u09b2 \u0985\u09a4\u09cd\u09af\u09be\u099a\u09be\u09b0\u09c0 \u099c\u09c1\u09b2\u09c1\u09ae\u0995\u09be\u09b0\u09c0 \u09b8\u09b0\u0995\u09be\u09b0\u09c7\u09b0 \u09b8\u09a8\u09cd\u09a4\u09cd\u09b0\u09be\u09b8 \u09aa\u09c1\u09b2\u09bf\u09b6 \u09ac\u09be\u09b9\u09bf\u09a8\u09c0 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09ac\u09bf\u09b6\u09cd\u09ac\u099c\u09bf\u09ce \u098f\u09b0 \u09aa\u09b0 \u098f\u09ac\u09be\u09b0 \u0996\u09be\u09a6\u09bf\u099c\u09be \u09b9\u09be\u09b8\u09bf\u09a8\u09be \u09a8\u09bf\u099c\u09c7\u0987 \u098f\u0995\u099c\u09a8 \u09b8\u09a8\u09cd\u09a4\u09cd\u09b0\u09be\u09b8\u09c0\u09b0 \u09ae\u09a6\u09a6 \u09a6\u09be\u09a4\u09be \u09a8\u09bf\u099c\u09c7\u09b0 \u0986\u099a\u09b2\u09c7\u09b0 \u09a4\u09b2\u09c7 \u09b8\u09a8\u09cd\u09a4\u09cd\u09b0\u09be\u09b8\u09c0 \u099c\u09a8\u09cd\u09ae \u09a6\u09c7\u09df \u0986\u09b0 \u09a6\u09c7\u09b6\u09c7 \u09ac\u09bf\u09a6\u09c7\u09b6\u09c7 \u09a8\u09be\u099f\u0995 \u0995\u09b0\u09c7 \u09ac\u09c7\u09dc\u09be\u09df \u09b8\u09a8\u09cd\u09a4\u09cd\u09b0\u09be\u09b8\u09c0\u09a6\u09c7\u09b0 \u099c\u09be\u09df\u0997\u09be \u09ac\u09be\u0982\u09b2\u09be\u09b0 \u09ae\u09be\u099f\u09bf\u09a4\u09c7 \u09b9\u09ac\u09c7\u09a8\u09be \u09b9\u09be\u09b8\u09bf\u09a8\u09be\u09b0 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b2\u09c0\u0997 \u098f\u09b0 \u09b8\u09a8\u09cd\u09a4\u09cd\u09b0\u09be\u09b8\u09c0\u09b0\u09be \u098f\u09ad\u09be\u09ac\u09c7\u0987 \u09a6\u09c7\u09b6\u09c7 \u09b8\u09a8\u09cd\u09a4\u09cd\u09b0\u09be\u09b8\u09c0 \u0995\u09be\u09b0\u09cd\u09af\u0995\u09cd\u09b0\u09ae \u099a\u09be\u09b2\u09be\u09df \u0985\u09a5\u099a \u09b9\u09b2\u09c1\u09a6 \u0995\u09c1\u09a4\u09cd\u09a4\u09be \u09ae\u09bf\u09a1\u09bf\u09df\u09be \u098f\u0987 \u09a8\u09bf\u0989\u099c \u09b8\u09ac\u09be\u09b0 \u09b8\u09be\u09ae\u09a8\u09c7 \u09a4\u09c1\u09b2\u09c7 \u09a7\u09b0\u09c7\u09a8\u09be \u098f\u0987 \u0995\u09be\u099c \u099b\u09be\u09a4\u09cd\u09b0\u09b2\u09c0\u0997 \u09a8\u09be \u0995\u09b0\u09c7 \u09af\u09a6\u09bf \u099b\u09be\u09a4\u09cd\u09b0\u09a6\u09b2 \u0995\u09bf\u0982\u09ac\u09be \u099b\u09be\u09a4\u09cd\u09b0\u09b6\u09bf\u09ac\u09bf\u09b0 \u0995\u09b0\u09a4 \u09a4\u09be\u09b9\u09b2\u09c7 \u09ae\u09bf\u09a1\u09bf\u09df\u09be \u09a8\u09bf\u099c\u09c7\u0987 \u09a4\u09a6\u09a8\u09cd\u09a4\u09c7 \u09a8\u09c7\u09ae\u09c7 \u09aa\u09b0\u09a4 \u098f\u099f\u09be \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u098f\u09a6\u09c7\u09b6\u09c7\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7 \u09ac\u09cb\u0995\u09be \u09ac\u09b2\u09c7 \u09b9\u09be\u09b8\u09bf\u09a8\u09be \u0993 \u09a4\u09be\u09b0 \u09b8\u09a8\u09cd\u09a4\u09cd\u09b0\u09be\u09b8\u09c0 \u09a6\u09b2 \u0986\u0993\u09df\u09be\u09ae\u09c0\u09b2\u09c0\u0997 \u098f\u0995\u09c7\u09b0 \u09aa\u09b0 \u098f\u0995 \u09b8\u09a8\u09cd\u09a4\u09cd\u09b0\u09be\u09b8\u09c0 \u0995\u09b0\u09cd\u09ae \u0995\u09b0\u09c7 \u09aa\u09be\u09b0 \u09aa\u09c7\u09df\u09c7", + "output": [ + "Political" + ] + }, + { + "input": "\u09ae\u09be\u09b9\u09bf\u09b0 \u0986\u099a\u09b0\u09a3\u09c7 \u099b\u09be\u0997\u09b2\u09c7\u09b0 \u09e9 \u09a8\u09be\u09ae\u09cd\u09ac\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0 \u09ae\u09a4 \u09b2\u09be\u0997\u099b\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": " \u0986 \u09b2\u09c0\u0997 \u09a8\u09c7\u09a4\u09be\u09a6\u09c7\u09b0 \u09ac\u09bf\u09b0\u09c1\u09a6\u09cd\u09a7\u09c7 \u0989\u09b8\u0995\u09be\u09a8\u09bf\u09b0 \u0985\u09ad\u09bf\u09af\u09cb\u0997 \u09b8\u09ae\u09cd\u09aa\u09b0\u09cd\u0995\u09c7 \u099c\u09be\u09a8\u09a4\u09c7 \u099a\u09be\u0987\u09b2\u09c7 \u099c\u09c7\u09b2\u09be \u0986\u0993\u09df\u09be\u09ae\u09c0 \u09b2\u09c0\u0997\u09c7\u09b0 \u09b8\u09be\u09a7\u09be\u09b0\u09a3 \u09b8\u09ae\u09cd\u09aa\u09be\u09a6\u0995 \u0986\u09b2 \u09ae\u09be\u09ae\u09c1\u09a8 \u09b8\u09b0\u0995\u09be\u09b0 \u09ac\u09b2\u09c7\u09a8 \u0989\u09b8\u0995\u09be\u09a8\u09bf \u09a5\u09be\u0995\u09be\u099f\u09be \u0985\u09b8\u09cd\u09ac\u09be\u09ad\u09be\u09ac\u09bf\u0995 \u09a8\u09df \u0995\u09be\u09b0\u09a3 \u0998\u099f\u09a8\u09be\u09b0 \u0989\u09ce\u09aa\u09a4\u09cd\u09a4\u09bf\u09b8\u09cd\u09a5\u09b2 \u09b9\u09b0\u09bf\u09aa\u09c1\u09b0 \u09af\u09c7 \u09b0\u09b8\u09b0\u09be\u099c \u09a6\u09be\u09b8\u09c7\u09b0 \u09ab\u09c7\u09b8\u09ac\u09c1\u0995 \u09a5\u09c7\u0995\u09c7 \u0995\u09be\u09ac\u09be \u09b6\u09b0\u09bf\u09ab \u0985\u09ac\u09ae\u09be\u09a8\u09a8\u09be\u09b0 \u0995\u09a5\u09be \u09ac\u09b2\u09be \u09b9\u099a\u09cd\u099b\u09c7 \u09b8\u09c7 \u09aa\u09c7\u09b6\u09be\u09df \u098f\u0995\u099c\u09a8 \u099c\u09c7\u09b2\u09c7 \u098f\u09ac\u0982 \u09b9\u09b0\u09bf\u09aa\u09c1\u09b0 \u09ae\u09ce\u09b8\u09cd\u09af\u099c\u09c0\u09ac\u09c0 \u09b8\u09ae\u09bf\u09a4\u09bf\u09b0 \u09b8\u09be\u09a7\u09be\u09b0\u09a3 \u09b8\u09ae\u09cd\u09aa\u09be\u09a6\u0995 \u0993\u0987 \u09b8\u0982\u0997\u09a0\u09a8\u09c7\u09b0 \u09b8\u09ad\u09be\u09aa\u09a4\u09bf \u09b9\u09b2\u09c7\u09a8 \u09b8\u09be\u09b2\u09c7\u09b0 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09a4\u09be\u0987\u099c\u09c1\u09a6\u09cd\u09a6\u09bf\u09a8 \u098f\u09b0 \u099b\u09c7\u09b2\u09c7 \u09ab\u09be\u09b0\u09c1\u0995 \u09ae\u09bf\u09df\u09be \u09ab\u09be\u09b0\u09c1\u0995 \u0986\u09ac\u09be\u09b0 \u0987\u0989\u09a8\u09bf\u09df\u09a8 \u0986\u0993\u09df\u09be\u09ae\u09c0 \u09b2\u09c0\u0997\u09c7\u09b0 \u09b8\u09ad\u09be\u09aa\u09a4\u09bf \u09ab\u09c7\u09b8\u09ac\u09c1\u0995\u09c7 \u0998\u099f\u09a8\u09be\u09b0 \u09aa\u09b0 \u09b0\u09b8\u09b0\u09be\u099c\u0995\u09c7 \u09ab\u09be\u09b0\u09c1\u0995 \u09ac\u09c7\u09a7\u09dc\u0995 \u09aa\u09bf\u099f\u09bf\u09df\u09c7 \u09aa\u09c1\u09b2\u09bf\u09b6\u09c7\u09b0 \u0995\u09be\u099b\u09c7 \u09b8\u09cb\u09aa\u09b0\u09cd\u09a6 \u0995\u09b0\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": "\u098f\u09a4 \u09a6\u09bf\u09a8 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u099b\u09bf\u09b2 \u09a8\u09be \u0986\u09ae\u09bf\u09b0 \u09b9\u0987\u099b\u09c7 \u098f\u0996\u09a8 \u099c\u09cb\u09b0 \u0995\u09b0\u09c7 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09ac\u09be\u09a8\u09be\u09a4\u09c7 \u09b9\u09ac\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b6\u09be\u09b2\u09be \u09a4\u09c1\u0987\u09a4 \u09ac\u09dc \u098f\u0995\u099f\u09be \u099a\u09c1\u09b0 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09a8\u09be\u09b8\u09bf\u09b0 \u0995\u09c7 \u09a6\u09b2\u09c7 \u09a6\u09c7\u0996\u09a4\u09c7 \u099a\u09be\u0987 \u0986\u09b0 \u09aa\u09be\u09aa\u09a8 \u09b8\u09be\u09b9\u09c7\u09ac \u0995\u09c7 \u09ac\u09b2\u09a4\u09c7 \u099a\u09be\u0987 \u09a4\u09c1\u0987 \u0995\u09bf \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09a6\u09c7\u09b6\u09c7\u09b0 \u09ad\u09be\u09b2\u09cb \u099a\u09be\u09b8\u09a8\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u09af\u09c7 \u09b8\u09ac \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09be \u098f\u0987 \u09b2\u09be\u0987\u09ad \u09af\u09cb\u0997 \u09a6\u09bf\u09df\u09c7 \u0986\u099c\u09c7 \u09ac\u09be\u099c\u09c7 \u0995\u09ae\u09c7\u09a8\u09cd\u099f \u0995\u09b0\u099b\u09c7 \u09b8\u09ac \u0997\u09c1\u09b2\u09c1 \u0995\u09c7 \u0995\u09b0\u09be \u09b9\u09ac\u09c7 \u0995\u09b0", + "output": [ + "Political" + ] + }, + { + "input": "\u09ac\u09bf\u09dc\u09be\u09b2 \u09b6\u09c1\u099f\u0995\u09bf\u09b0 \u09a8\u09be\u0997\u09be\u09b2 \u09a8\u09be \u09aa\u09c7\u09b2\u09c7 \u09ac\u09b2\u09c7 \u09aa\u09b0\u09c7\u09b0 \u09b9\u0995\u09cd\u09ac \u0996\u09be\u0987\u09a8\u09be", + "output": [ + "Political" + ] + }, + { + "input": "\u09ae\u09be\u09b9\u09bf \u09ac\u09bf \u099a\u09cc\u09a7\u09c1\u09b0\u09c0 \u0986\u0993\u09af\u09bc\u09be\u09ae\u09c0 \u09b2\u09c0\u0997\u09c7\u09b0 \u09a6\u09be\u09b2\u09be\u09b2", + "output": [ + "Political" + ] + }, + { + "input": "\u09b8\u09ac \u09a6\u09b2\u09c7\u09b0 \u09a8\u09bf\u0995\u099f \u0997\u09cd\u09b0\u09b9\u09a8\u09af\u09cb\u0997\u09cd\u09af \u0986\u09b6\u09be \u0995\u09b0\u09be \u0985\u09ac\u09be\u09b8\u09cd\u09a4\u09ac \u09ae\u09c1\u0995\u09cd\u09a4\u09bf\u09af\u09cb\u09a6\u09cd\u09a7\u09be \u0986\u09b0 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09a6\u09b0\u09cd\u09b6\u09a8 \u0995\u0996\u09a8\u09cb\u0987 \u098f\u0995 \u09b9\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7\u09a8\u09be \u09ac\u09b0\u09cd\u09a4\u09ae\u09be\u09a8 \u0995\u09ae\u09bf\u09b6\u09a8 \u0997\u09a0\u09a8\u09c7\u09b0 \u0986\u0997\u09c7 \u09ae\u09b9\u09be\u09ae\u09be\u09a8\u09cd\u09af \u09b0\u09be\u09b7\u09cd\u099f\u09cd\u09b0\u09aa\u09a4\u09bf \u09b8\u09ac \u09a6\u09b2\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u0986\u09b2\u09cb\u099a\u09a8\u09be \u0995\u09b0\u09be \u09b9\u09df\u09c7\u099b\u09bf\u09b2 \u098f\u09b0 \u09ab\u09b2 \u0995\u09bf \u09b9\u09df\u09c7\u099b\u09c7 \u0986\u09ae\u09b0\u09be \u099c\u09be\u09a8\u09bf \u0995\u09be\u099c\u09c7\u0987 \u09b8\u09b0\u09cd\u09ac\u09a6\u09b2\u09c7\u09b0 \u0997\u09cd\u09b0\u09b9\u09a8\u09af\u09cb\u0997\u09cd\u09af \u098f\u09ae\u09a8 \u09ae\u09c1\u0996\u09b0\u09cb\u099a\u0995 \u0995\u09a5\u09be \u09ac\u09b2\u09be \u09b8\u09b9\u099c \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09ac\u09be\u09b8\u09cd\u09a4\u09ac\u09a4\u09be \u09ad\u09bf\u09a8\u09cd\u09a8 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09af\u09a4\u09c7\u09be\u0987 \u09ad\u09be\u09b2 \u0996\u09c7\u09b2\u09c1\u0995 \u09b8\u09c7 \u09b9\u09b2\u09c7\u09be \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0 \u09ac\u0982\u09b6 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09ad\u09be\u09a4\u09be \u09a6\u09c7\u0993\u09df\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u09b8\u09b0\u0995\u09be\u09b0\u0995\u09c7 \u0985\u09be\u09ae\u09bf \u0985\u09a8\u09c1\u09b0\u09cb\u09a7 \u099c\u09be\u09a8\u09be\u099a\u09cd\u099b\u09bf \u09a6\u09c7\u0996\u09bf \u09a6\u09c7\u09b6\u09c7 \u0995\u09df\u099c\u09a8 \u09ae\u09c1\u0995\u09cd\u09a4\u09bf\u09af\u09cb\u09a6\u09cd\u09a7\u09be \u09aa\u09be\u0993\u09df\u09be \u09af\u09be\u09df", + "output": [ + "Political" + ] + }, + { + "input": "\u09a4\u09c1\u09ae\u09bf \u09b2\u09bf\u0996\u09c7 \u09af\u09be \u0993 \u09ac\u09cb\u09a8 \u0995\u09a4\u09cd\u09a4 \u09b0\u09c7\u09ab\u09be\u09b0\u09c7\u09a8\u09cd\u09b8 \u09b2\u09be\u0997\u09ac\u09c7 \u0987\u09a8\u09ac\u0995\u09cd\u09b8\u09c7 \u0986\u09b8\u09b2\u09c7 \u09aa\u09be\u09ac\u09c7 \u0996\u09be\u09a8\u0995\u09c0\u09b0 \u099c\u09be\u09b0\u099c \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09a6\u09c7\u09b0 \u0997\u09c1\u09b8\u09cd\u099f\u09bf \u09b8\u09be\u09ab \u099a\u09b2\u09c7 \u099a\u09b2\u09ac\u09c7 \u09ac\u09c1\u0987\u09dc\u09be \u0987\u09ac\u09b2\u09bf\u09b8 \u0997\u09c1\u09b2\u09be \u099d\u09c1\u09b2\u09c7\u099b\u09c7 \u0986\u09b0 \u09a8\u09ac\u09cd\u09af \u0987\u09ac\u09b2\u09bf\u09b6 \u0997\u09c1\u09b2\u09bf \u099d\u09c1\u09b2\u09ac\u09c7 \u09a8\u09be \u09a1\u09be\u09be\u0987\u09b0\u09c7\u0995\u09cd\u099f \u09b6\u09cd\u09af\u09c1\u099f \u099f\u09cd\u09b0\u09bf\u0997\u09be\u09b0 \u09ad\u09b0\u09ac\u09cb \u09aa\u09be\u099b\u09be\u09df \u099a\u09be\u09aa \u09a6\u09bf\u09ac\u09be \u09ae\u09be\u09a5\u09be \u099b\u09bf\u099f\u0995\u09c7 \u09aa\u09dc\u09ac\u09c7 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09a6\u09c7\u09b0 \u09ad\u09c1\u09b0\u09bf\u09ad\u09cb\u099c \u098f\u09b0 \u0986\u09df\u099c\u09cb\u09a8 \u09b0\u09c7\u09a1\u09bf \u09b9\u099a\u09cd\u099a\u09c7 \u09ad\u09be\u09ac\u09a8\u09be \u09ac\u09be \u09ad\u09df\u09c7\u09b0 \u0995\u09bf\u099b\u09c1\u0987 \u09a8\u09be\u0987 \u09ac\u09cb\u09a8 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09a0\u09be\u0987 \u09a6\u09c7\u09a8 \u0986\u09aa\u09a8\u09be\u09b0\u09be \u09ae\u09bf\u09a1\u09bf\u09df\u09be\u09a4\u09c7 \u09ad\u09a8\u09cd\u09a1\u09be\u09ae\u09bf \u0995\u09b0\u09c7\u09a8 \u0986\u09aa\u09a8\u09be\u09b0\u09be \u0986\u09aa\u09a8\u09be\u09a6\u09c7\u09b0 \u09ae\u09c1\u0996\u09c7 \u09ac\u0999\u09cd\u0997\u09ac\u09a8\u09cd\u09a7\u09c1\u09b0 \u09a8\u09be\u09ae \u09a8\u09bf\u09b2\u09c7 \u09aa\u09be\u09aa \u0987\u09ac\u09c7 \u0997\u09c1\u09a8\u09a1\u09be \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09ad\u09c2\u09ae\u09bf\u09a6\u09c2\u09b8 \u0986\u0996\u09b0\u09be \u0986\u0993\u09df\u09be\u09ae\u09c0 \u09b2\u09c0\u0997 \u09b8\u09c1\u09b7\u09cd\u09a0\u09c1 \u09a8\u09bf\u09b0\u09cd\u09ac\u09be\u099a\u09a8 \u09a6\u09c7\u09a8 \u09a4\u09be\u09b0\u09aa\u09b0 \u09a6\u09c7\u0996\u09c7\u09a8 \u0995\u09bf \u09b9\u09df", + "output": [ + "Political" + ] + }, + { + "input": "\u09b6\u09c7\u0996 \u09b9\u09be\u09b8\u09bf\u09a8\u09be \u0995\u09bf \u09ac\u09b2\u099b\u09c7 \u09b8\u09c7\u099f\u09be \u09a8\u09bf\u09df\u09c7 \u09ae\u09be\u09a5\u09be \u09a8\u09be \u0998\u09be\u09ae\u09bf\u09df\u09c7 \u09a8\u09bf\u099c\u09c7\u09b0 \u0995\u09be\u09b0\u09be\u09a6\u09a8\u09cd\u09a1 \u09a8\u09bf\u09df\u09c7 \u09ae\u09be\u09a5\u09be \u0998\u09be\u09ae\u09be \u09b9\u09be\u09b2\u09be \u09aa\u09be\u0997\u09b2 ", + "output": [ + "Political" + ] + }, + { + "input": "\u0985\u09be\u0993\u09df\u09be\u09ae\u09bf\u09b2\u09c0\u0997 \u0985\u09be\u099a\u09be\u09b0 \u0996\u09be\u0987\u09b2\u09c7\u0993 \u0995\u09cb\u09a8 \u09a6\u09bf\u09a8 \u09b6\u09bf\u0995\u09be\u09b0 \u0995\u09b0\u09a8\u09be \u098f\u099f\u09be \u09b9\u09b2\u09cb \u099a\u09be\u09aa\u09be\u09ac\u09be\u099c \u0985\u09be\u0993\u09df\u09be\u09ae\u09bf\u09b2\u09c0\u0997\u09c7\u09b0 \u09a8\u09bf\u09a4\u09bf", + "output": [ + "Political" + ] + }, + { + "input": "\u09aa\u09be\u09b0\u09cd\u09a5 \u09b8\u09be\u09b2\u09be\u09b0 \u09aa\u09c1\u09a4 \u09b9\u09b2\u09cb \u09b9\u09be\u09b8\u09bf\u09a8\u09be\u09b0 \u09ac\u09dc \u09a6\u09be\u09b2\u09be\u09b2 \u09aa\u09be\u09b0\u09cd\u09a5 \u0995\u09c7 \u09ac\u09bf\u098f\u09a8\u09aa\u09bf\u09b0 \u09af\u09cb\u099f \u09a5\u09c7\u0995\u09c7 \u09ac\u09be\u09a6 \u09a6\u09c7\u0993\u09df\u09be \u09b9\u0995 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09a6\u09c7\u09b6\u099f\u09be \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7 \u09ad\u09b0\u09a4\u09bf \u09b9\u09df\u09c7 \u0997\u09c7\u09b2 \u09b0\u09c7 \u0986\u09ab\u09b8\u09cb\u09b8 ", + "output": [ + "Political" + ] + }, + { + "input": "\u0996\u09be\u09b2\u09c7\u09a6\u09be \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09a6\u09c7\u09b0 \u09a8\u09bf\u09af\u09bc\u09c7 \u09b8\u0982\u09b8\u09a6\u09c7 \u09ac\u09b8\u09c7\u099b\u09bf\u09b2 \u09a4\u09be\u0981\u09a4\u09c7\u0993 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09ac\u09c7\u09b6\u09bf \u09ad\u09be\u09b2 \u09b2\u09be\u0997\u099b\u09bf\u09b2", + "output": [ + "Political" + ] + }, + { + "input": "\u09b8\u09ae\u09cd\u09aa\u09cd\u09b0\u09a4\u09bf \u099c\u09be\u09ae\u09be\u09df\u09be\u09a4\u09c7\u09b0 \u0986\u09ae\u09c0\u09b0 \u099c\u09a8\u09be\u09ac \u09ae\u0995\u09ac\u09c1\u09b2 \u0986\u09b9\u09ae\u09be\u09a6 \u09a6\u09b2\u09c7\u09b0 \u0986\u09ae\u09c0\u09b0 \u09a8\u09bf\u09b0\u09cd\u09ac\u09be\u099a\u09bf\u09a4 \u09b9\u0993\u09df\u09be\u09b0 \u09aa\u09b0 \u09a4\u09be\u09b0\u09be \u09b0\u09be\u09a4\u09be\u09b0\u09be\u09a4\u09bf \u09a4\u09be\u0981\u0995\u09c7 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09ac\u09be\u09a8\u09bf\u09df\u09c7 \u099b\u09be\u09dc\u099b\u09c7\u09a8 \u09a8\u09bf\u09b0\u09cd\u09b2\u099c\u09cd\u099c \u09ac\u09be\u09a8\u09cb\u09df\u09be\u099f \u0995\u09be\u09b2\u09cd\u09aa\u09a8\u09bf\u0995 \u0997\u09be\u0981\u099c\u09be\u0996\u09c1\u09b0\u09bf \u0997\u09b2\u09cd\u09aa\u09ac\u09be\u099c\u09c0 \u09b6\u09c1\u09b0\u09c1 \u0995\u09b0\u09c7\u099b\u09c7\u09a8", + "output": [ + "Political" + ] + }, + { + "input": "\u09ac\u09bf \u098f\u09a8 \u09aa\u09bf \u09a6\u09b2\u099f\u09bf \u09aa\u09c1\u09b0\u09be\u09df \u0985\u09b6\u09bf\u0996\u09bf\u09a4\u09cb \u09b6\u09be\u09b2\u09be\u09b0 \u09b6\u09be\u09b2\u09be\u09b0\u09be", + "output": [ + "Political" + ] + }, + { + "input": " \u098f \u09af\u09c7 \u09a6\u09c7\u0996\u09bf \u09b8\u09ac \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09ad\u09be\u09b0\u09a4\u09c0\u09af\u09bc \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0\u09be \u0995\u09cb\u09a4\u09be\u09af\u09bc \u0986\u09b0\u09c7 \u09ac\u09b2\u099b\u09bf \u09ad\u09be\u09b0\u09a4\u09c0\u09af\u09bc \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0\u09be \u0995\u09cb\u09a4\u09be\u09af\u09bc ", + "output": [ + "Political" + ] + }, + { + "input": " \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u0987\u09a8\u09cd\u09a1\u09bf\u09df\u09be \u0996\u09c7\u09b2\u09be\u09df \u09a7\u09ae \u09a8\u09bf\u09df\u09c7 \u0995\u09a5\u09be \u09ac\u09b2\u09be \u098f\u09a6\u09c7\u09b0\u0995\u09c7 \u09aa\u09be\u0997\u09b2 \u09ac\u09b2\u09be \u09b9\u09df \u0986\u09b0 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u0995\u09bf \u09ac\u09b2\u09ac \u09b8\u09be\u09b2 \u09a5\u09c7\u0995\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09af\u09a4 \u09ae\u09cd\u09af\u09be\u099a \u0996\u09c7\u09b2\u09c7\u099b\u09c7 \u09b8\u09ac\u09a4\u09c7\u09be \u09b9\u09c7\u09b0\u09c7\u099b\u09c7 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09c7\u09b6\u09c7 \u0995\u09a4\u0997\u09c1\u09b2\u09c7\u09be \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u0986\u099b\u09c7 \u09af\u09be\u09b0\u09be \u09b8\u09be\u09b2\u09c7 \u09b8\u09c1\u09a6\u09be \u098f\u0996\u09a8\u09cb \u09ad\u09c1\u09b2\u09c7 \u09a8\u09be\u0987 \u09a4\u09be\u0987 \u0993\u09b0\u09be \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09bf \u09a8\u09bf\u09df\u09c7 \u09ac\u09c7\u09b6\u09bf \u09ae\u09be\u09a5\u09be \u09ac\u09cd\u09af\u09a5\u09be \u0995\u09c7\u0987\u09b8 \u0995\u09b0\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ac\u09be\u09b2 \u0993 \u09b9\u09be\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09c7 \u09a8\u09be \u09ad\u09bf\u0995\u09cd\u09b7\u09c1\u0995 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c0 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u098f\u09b0 \u09aa\u09ac\u09bf\u09a4\u09cd\u09b0 \u0987\u09b8\u09b2\u09be\u09ae \u0993 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u09a6\u09c7\u09b0 \u0986\u09b0 \u0995\u09a4 \u0995\u09b2\u09c1\u09b7\u09bf\u09a4 \u0995\u09b0\u09ac\u09bf \u09b8\u09be\u09b2\u09c7 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09ac\u09be\u09aa \u09a6\u09be\u09a6\u09be \u09b0\u09be \u09aa\u09b6\u09cd\u099a\u09bf\u09ae \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u099b\u09bf\u09b2 \u0986\u09b0 \u09a8\u09bf\u09b0\u09cd\u09ac\u09bf\u099a\u09be\u09b0\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7 \u09b9\u09a4\u09cd\u09af\u09be \u0995\u09b0\u09c7\u099b\u09c7 \u0986\u09b0 \u098f\u0996\u09a8 \u09a4\u09cb\u09b0\u09be \u099c\u0999\u09cd\u0997\u09bf \u09b9\u09af\u09bc\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u098f\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7 \u09ae\u09be\u09b0\u099b\u09bf\u09b8 ", + "output": [ + "Political" + ] + }, + { + "input": "\u098f\u0987 \u0995\u09be\u0982\u0995\u09bf\u09b0 \u099b\u09c7\u09b2\u09c7 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09b8\u09ac\u09be\u0987 \u09a4\u09cb \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b2\u09c0\u0997 \u0995\u09b0\u09c7 \u098f\u0987 \u0995\u09a5\u09be \u09a4\u09c1\u0987 \u099c\u09be\u09a8\u09bf\u09b8 \u09a8\u09be", + "output": [ + "Political" + ] + }, + { + "input": "\u09ae\u09be\u09b9\u09c0\u09ac\u09bf \u098f\u0995\u099f\u09be \u09ad\u09c7\u09a6\u09a7\u09ac \u0987\u09b8\u09cd\u099f\u09aa\u09bf\u099f ", + "output": [ + "Political" + ] + }, + { + "input": " \u09aa\u09be\u0997\u09b2 \u09b9\u09df\u09c7\u099b\u09bf \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b2\u09c0\u0997\u09c7\u09b0 \u09a6\u09be\u09b2\u09be\u09b2\u09a6\u09c7\u09b0 \u09b6\u09c7\u09b7 \u0995\u09b0\u09a4\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09aa\u09c3\u09a5\u09bf\u09ac\u09c0\u09b0 \u09ae\u09be\u099d\u09c7 \u09b8\u09ac\u099a\u09c7\u09df\u09c7 \u0985\u09ad\u09a6\u09cd\u09b0 \u0986\u09b0 \u099c\u09be\u09a8\u09df\u09be\u09b0 \u09ac\u09b2\u09a4\u09c7 \u098f\u0995\u099f\u09be \u09a6\u09c7\u09b6\u0987 \u09b0\u09df\u09c7\u099b\u09c7 \u09a4\u09be\u09b0 \u09a8\u09be\u09ae \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u0986\u09b0 \u09ac\u09be\u0982\u0997\u09be\u09b2\u09c0 \u098f\u0995 \u099c\u09be\u09a8\u09df\u09be\u09b0 \u0995\u09ae\u09c7\u09a8\u09cd\u099f\u09c7 \u09b2\u09bf\u0996\u09c7\u099b\u09c7 \u099f\u09be\u0995\u09be \u09ab\u09c7\u09b0\u09a4 \u09a6\u09bf\u09a4\u09c7 \u098f\u0987\u09b9\u09b2 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u0986\u09b0 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09a4\u09ac\u09c7 \u0986\u09ae\u09be\u09b0 \u09ae\u09a4\u09c7 \u09af\u09be\u09b0\u09be \u09aa\u09be\u0995\u09bf\u09a6\u09c7\u09b0 \u09b8\u09c1\u09b0\u09c7 \u0997\u09be\u09a8\u0997\u09be\u09df \u09a4\u09be\u09a6\u09c7\u09b0 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u099a\u09b2\u09c7 \u09af\u09be\u0993\u09df\u09be \u0989\u099a\u09bf\u09a4 \u0986\u09ae\u09b0\u09be \u09ac\u09bf\u09b0\u09c7\u09b0\u099c\u09be\u09a4\u09bf \u09b9\u09be\u09b0\u09a4\u09c7 \u09b6\u09bf\u0996\u09bf\u09a8\u09c0 \u09ac\u09bf\u099c\u09df\u09c0 \u09b9\u09df\u09c7\u099b\u09bf \u09b8\u09c7\u099f\u09be\u0993 \u09af\u09be\u09a8\u09be \u0986\u099b\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0 \u09b8\u09c7\u0987 \u09b8\u09be\u09b9\u09b8 \u09a8\u09c7\u0987 \u099f\u09be\u0995\u09be \u099a\u09be\u0993\u09df\u09be\u09b0 \u0995\u09c1\u09a4\u09cd\u09a4\u09be \u09b6\u09c1\u09a7\u09c2 \u0998\u09c8\u0993 \u0998\u09c8\u0993 \u0987 \u0995\u09b0\u09a4\u09c7 \u09af\u09be\u09a8\u09c7 \u0986\u09b0 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u0995\u09c7 \u0995\u09bf\u09ad\u09be\u09ac\u09c7 \u0994\u09b7\u09a6 \u09a6\u09bf\u09a4\u09c7 \u09b9\u09df \u09ad\u09be\u0999\u09be\u09b2\u09bf\u09b0\u09be \u09af\u09be\u09a8\u09c7", + "output": [ + "Political" + ] + }, + { + "input": " \u099c\u09be\u09ae\u09be\u09a4 \u09ae\u09be\u09a8\u09c7 \u09af\u09a6\u09bf \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09b9\u09df \u09a4\u09be\u09b9\u09b2\u09c7 \u0986\u09b2\u09c0\u0997 \u09ae\u09be\u09a8\u09c7 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b0 \u099a\u09cb\u09a6\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u09ae\u0995\u09ac\u09c1\u09b2 \u0995\u09c7\u09a8 \u098f\u0987 \u09af\u09be\u09ac\u09ce \u09af\u09a4 \u099c\u09be\u09ae\u09be\u09df\u09be\u09a4 \u09a8\u09c7\u09a4\u09be\u09b0 \u09ab\u09be\u09b8\u09bf \u09b9\u09df\u09c7\u099b\u09c7 \u09a4\u09be\u09b0\u09be \u0995\u09c7\u0989 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09ac\u09be \u0995\u09cb\u09a8 \u0985\u09aa\u09b0\u09be\u09a7\u09bf \u099b\u09bf\u09b2\u09a8\u09be \u09a6\u09cb\u09b7 \u098f\u0995\u099f\u09be\u0987 \u0995\u09cb\u09b0\u0986\u09a8\u09c7\u09b0 \u09b6\u09be\u09b8\u09a8 \u0995\u09be\u09df\u09c7\u09ae\u09c7\u09b0 \u0995\u09be\u099c \u0995\u09b0\u099b\u09bf\u09b2 \u0987\u09a4\u09bf\u09b9\u09be\u09b8\u09c7 \u098f\u09b0\u09be \u0995\u09bf\u09a8\u09a4\u09c1 \u0985\u09ae\u09b0 \u0985\u09ae\u09b2\u09be\u09a8", + "output": [ + "Political" + ] + }, + { + "input": " \u09b9\u09be\u09df \u09b0\u09c7 \u098f\u0987 \u099c\u0982\u0997\u09c0 \u09a8\u09c7\u09a4\u09cd\u09b0\u09c0 \u0996\u09be\u09b2\u09c7\u09a6\u09be \u09a4\u09be\u09b0 \u09b6\u09be\u09b8\u09a8 \u0986\u09ae\u09b2\u09c7 \u0986\u0993\u09df\u09be\u09ae\u09c0 \u09b2\u09c0\u0997\u09c7\u09b0 \u098f\u0987 \u09a8\u09bf\u09b0\u09aa\u09c7\u0995\u09cd\u09b7\u09b0 \u09b8\u09b0\u0995\u09be\u09b0 \u0997\u09a0\u09a8\u09c7\u09b0 \u09a6\u09be\u09ac\u09bf \u0995\u09b0\u09b2\u09c7 \u09a4\u09be\u0987\u09a8\u09c7 \u09ac\u09b2\u09c7\u099b\u09bf\u09b2 \u098f\u0987 \u09a6\u09c7\u09b6\u09c7 \u09aa\u09be\u0997\u09b2 \u0993 \u09b6\u09bf\u09b6\u09c1 \u099b\u09be\u09b0\u09be \u0995\u09c7\u09b9\u0987 \u09a8\u09bf\u09b0\u09aa\u0995\u09cd\u09b7 \u09a8\u09df \u09ae\u09a8\u09c7 \u09aa\u09b0\u09b2\u09cb \u098f\u0995\u099f\u09bf \u09aa\u09cd\u09b0\u09ac\u09be\u09a6 \u09aa\u09b0\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u0997\u09b0\u09cd\u09a4 \u0995\u09b0\u09b2\u09c7 \u09b8\u09c7\u0987 \u0997\u09b0\u09cd\u09a4\u09c7 \u09a8\u09bf\u099c\u09c7\u0995\u09c7 \u09aa\u09b0\u09a4\u09c7 \u09b9\u09df \u0986\u09b0 \u09b8\u09ac\u099a\u09c7\u09df\u09c7 \u09ac\u09b0 \u0995\u09a5\u09be \u09b9\u09b2\u09cb \u09ac\u09b0\u09cd\u09a4\u09ae\u09be\u09a8 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u099c\u09a8 \u09a8\u09c7\u09a4\u09cd\u09b0\u09c0 \u09af\u09c7 \u09aa\u09cd\u09b0\u099c\u09cd\u099e\u09be \u0993 \u09ae\u09c7\u09a7\u09be \u0996\u09be\u099f\u09bf\u09df\u09c7 \u09a6\u09c7\u09b6 \u0995\u09c7 \u09b8\u0995\u09b2 \u09b8\u09c1\u099a\u0995\u09c7 \u09ac\u09bf\u09b6\u09cd\u09ac \u09a6\u09b0\u09ac\u09be\u09b0\u09c7 \u0986\u099c \u09b0\u09cb\u09b2 \u09ae\u09cb\u09a1\u09c7\u09b2 \u09b9\u09bf\u09b8\u09be\u09ac\u09c7 \u09a6\u09be\u09b0\u09be\u09a4\u09c7 \u09a4\u09be\u0981\u09b0 \u09a8\u09bf\u09b0\u09a8\u09cd\u09a4\u09a8 \u099a\u09c7\u09b7\u09cd\u099f\u09be \u0985\u09ac\u09cd\u09af\u09be\u09b9\u09a4 \u0986\u099b\u09c7 \u09af\u09be \u09b8\u09be\u09b2\u09c7 \u098f\u0987 \u09a6\u09c7\u09b6\u0995\u09c7 \u098f\u0995\u099f\u09bf \u09b6\u0995\u09cd\u09a4\u09bf\u09b6\u09be\u09b2\u09c0 \u09a6\u09c7\u09b6 \u0997\u09b0\u09a4\u09c7 \u098f\u0987 \u09b8\u09ae\u09df \u09ac\u09bf \u098f\u09a8 \u09aa\u09bf \u099c\u09be\u09ae\u09be\u09a4 \u09b6\u09bf\u09ac\u09bf\u09b0\u09c7\u09b0 \u09a8\u09bf\u09b0\u09cd\u09ac\u09be\u099a\u09a8 \u09b9\u0989\u0995 \u0986\u09b0 \u0986\u09a6\u09b0 \u0995\u09b0\u09c7 \u0997\u09a6\u09bf\u09a4\u09c7 \u09ac\u09b8\u09be\u09b2\u09c7 \u099c\u09be\u09a4 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09a6\u09be\u09b2\u09be\u09b2 \u09ae\u09be\u09a6\u09be\u09b0\u09bf \u099c\u09be\u09ae\u09be\u09a4\u09c7\u09b0 \u098f\u0995\u099f\u09be \u0986\u09b8\u09a8\u09c7\u09b0 \u09b9\u09be\u09ab \u09ad\u09cb\u099f\u09c7 \u0993 \u09aa\u09be\u09ac\u09c7 \u09a8\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u099c\u09be\u09ae\u09be\u09a4 \u09ae\u09be\u09a8\u09c7 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09ac\u09b2\u09c7 \u09a6\u09bf\u09b2\u09c7\u0987 \u09b9\u09df ", + "output": [ + "Political" + ] + }, + { + "input": " \u09ad\u09be\u09b2\u09cb \u09ac\u09b2\u09c7\u099b\u09bf\u09b8 \u09ac\u09a8\u09cd\u09a7\u09c1 \u09b6\u09bf\u09ac\u09bf\u09b0 \u09b9\u09cb\u099b\u09be\u0987\u09a8 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b8\u09b0\u0995\u09be\u09b0 \u098f\u09b0 \u09b8\u09be\u09a5\u09c7 \u0986\u09a4\u09be\u09a4 \u0995\u09b0\u09c7 \u0990\u0995\u09cd\u09af \u09a8\u09bf\u09df\u09c7 \u099a\u0995\u09cd\u09b0\u09be\u09a8\u09cd\u09a4 \u09a4\u09cb \u0986\u09aa\u09a8\u09be\u09b0\u09be \u09ac\u09be\u09aa \u09ac\u09c7\u099f\u09be\u0987 \u0995\u09b0\u099b\u09c7\u09a8 \u09ae\u09bf: \u09ae\u09be\u09b9\u09bf ", + "output": [ + "Political" + ] + }, + { + "input": "\u09a4\u09c1\u09ae\u09bf \u09b9\u09be\u09b8\u09bf\u09a8\u09be \u099c\u0999\u09cd\u0997\u09bf\u09ac\u09be\u09a6 \u0989\u0997\u09cd\u09b0\u09ac\u09be\u09a6 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u098f\u0987 \u09b8\u09ac \u09a1\u09be\u09df\u09be\u09b2\u0997 \u09ae\u09be\u0987\u09b0\u09be \u0986\u09b0 \u0995\u09a4\u09a6\u09bf\u09a8 \u0996\u09be\u0987\u09ac\u09be \u099c\u09a8\u0997\u09a8\u09c7\u09b0 \u099a\u09be\u0995\u09b0\u09bf \u09a8\u09be\u0987 \u09ad\u09bf\u09b8\u09be \u09a8\u09be\u0987 \u09a4\u09ac\u09c7 \u0996\u09be\u0987\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09be \u0995\u09be\u09b0\u09a8 \u099c\u09a8\u0997\u09a8 \u09b8\u09ac \u09b9\u09bf\u099c\u09b0\u09be \u09b9\u09df\u09c7 \u0997\u09c7\u099b\u09c7", + "output": [ + "Political" + ] + }, + { + "input": "\u098f\u0987 \u0990\u0995\u09cd\u09af \u099a\u09cb\u09b0 \u0986\u09b0 \u09b6\u09a4\u09be\u09a8\u09c7\u09b0 \u0990\u0995\u09cd\u09af ", + "output": [ + "Political" + ] + }, + { + "input": "\u09a6\u09be\u09b2\u09be\u09b2 \u09ae\u09bf\u09a1\u09bf\u09df\u09be \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b2\u09c0\u0997 \u098f\u09b0 \u09a8\u09be\u09ae \u09a8\u09bf\u09a4\u09c7 \u0995\u09bf \u099a\u09c1\u09b2\u0995\u09be\u0987", + "output": [ + "Political" + ] + }, + { + "input": "\u09a4\u09c1\u09b0 \u09ae\u09c1\u0996\u09c7 \u099c\u09c1\u09a4\u09be \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u09ac\u09be\u09aa \u09ac\u09c7\u099f\u09be\u09b0\u09c7 \u0986\u09b0\u09cb \u0986\u0997\u09c7 \u09b2\u09be\u09a4\u09bf \u09a6\u09c7\u0993\u09df\u09be \u0989\u099a\u09bf\u09ce \u099b\u09bf\u09b2 ", + "output": [ + "Political" + ] + }, + { + "input": "\u099c\u09a8\u0997\u09a3\u09c7\u09b0 \u099f\u09be\u0995\u09be \u0995\u09c7 \u09a6\u09bf\u09ac\u09c7 \u098f\u0987 \u09b6\u09df\u09a4\u09be\u09a8\u0995\u09c7 \u099b\u09be\u09dc \u09a6\u09bf\u09b2\u09c7 \u09a6\u09c7\u09b6\u09c7 \u0986\u0987\u09a8 \u09ac\u09b2\u09a4\u09c7 \u0995\u09bf\u099b\u09c1 \u09a5\u09be\u0995\u09ac\u09c7 \u09a8\u09be \u09b9\u09be\u099c\u09be\u09b0 \u09b9\u09be\u099c\u09be\u09b0 \u0995\u09cb\u099f\u09bf \u099f\u09be\u0995\u09be \u09b2\u09c1\u099f\u09aa\u09be\u099f \u0995\u09b0\u09c7\u099b\u09c7 \u09af\u09be\u09b0\u09be \u09a4\u09be\u09a6\u09c7\u09b0 \u0995\u09c7\u09a8 \u09b6\u09be\u09b8\u09cd\u09a4\u09bf \u09a6\u09c7\u0993\u09df\u09be \u09b9\u09ac\u09c7 \u09a8\u09be \u09ac\u09bf\u09a6\u09c7\u09b6\u09c7 \u09b9\u09be\u099c\u09be\u09b0 \u09b9\u09be\u099c\u09be\u09b0 \u0995\u09cb\u099f\u09bf \u099f\u09be\u0995\u09be \u09aa\u09be\u09a0\u09bf\u09df\u09c7 \u09a6\u09bf\u09df\u09c7\u099b\u09c7 \u098f\u09a6\u09c7\u09b0 \u0995\u09c7\u09a8 \u09b6\u09be\u09b8\u09cd\u09a4\u09bf \u09b9\u09ac\u09c7 \u09a8\u09be \u09a6\u09c7\u09b6\u09c7\u09b0 \u0985\u09b0\u09cd\u09a5\u09a8\u09c0\u09a4\u09bf\u0995\u09c7 \u09a7\u09cd\u09ac\u0982\u09b8 \u0995\u09b0\u09c7\u099b\u09c7 \u099c\u09a8\u0997\u09a3\u0995\u09c7 \u09ae\u09c7\u09b0\u09c7\u099b\u09c7 \u098f\u0997\u09c1\u09b2\u09cb \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09a5\u09c7\u0995\u09c7\u0993 \u0996\u09be\u09b0\u09be\u09aa ", + "output": [ + "Political" + ] + }, + { + "input": "\u098f\u0987 \u09ac\u09bf \u09ae\u09be\u09b9\u09bf \u09ae\u09be\u09b0\u09cd\u0995\u09be \u09b2\u09cb\u0995\u09c7\u09b0 \u0995\u09cb\u09a8 \u09a6\u09b0\u0995\u09be\u09b0 \u09a8\u09be\u0987 ", + "output": [ + "Political" + ] + }, + { + "input": " \u09ac\u09bf\u098f\u09a8\u09aa\u09bf \u099c\u09be\u09ae\u09be\u09df\u09be\u09a4\u09cd\u09af\u09be \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0 \u09b2\u09a4\u09be \u09b8\u09a8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0\u09be \u09ac\u09c7\u09b6\u09bf \u09b2\u09be\u09ab\u09be\u0987\u09b8\u09a8\u09be \u09b8\u09be\u09ae\u09a8\u09c7 \u0986\u09df \u09a0\u09c7\u0982 \u09ac\u09c7\u0999\u09cd\u0997\u09c7 \u09b9\u09be\u09a4\u09c7 \u09a7\u09b0\u09bf\u09df\u09c7 \u09a6\u09bf\u09ac\u09cb ", + "output": [ + "Political" + ] + }, + { + "input": " \u09a4\u09be\u09b9\u09b2\u09c7 \u09ae\u09a8\u09c7 \u09b9\u09af\u09bc \u099c\u09be\u09ae\u09be\u09a4 \u09b6\u09bf\u09ac\u09bf\u09b0\u09c7\u09b0 \u09b2\u09cb\u0995 \u098f \u09b8\u09ac \u0995\u09a5\u09be \u09ac\u09b2\u09c7 \u09ac\u09b2\u09c7 \u0986\u099c \u09a6\u09c7\u09b6\u09c7\u09b0 \u098f \u0985\u09ac\u09b8\u09cd\u09a5\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u09aa\u09be\u09aa\u09a8 \u09a8\u09be\u09a8\u09cd\u09a8\u09c1 \u09a6\u09c1\u0987 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0\u09c7 \u099c\u09c1\u09a4\u09be\u09b0 \u09ae\u09be\u09b2\u09be \u0997\u09b2\u09be\u09df \u09a6\u09bf\u09df\u09c7 \u09a6\u09c7\u09b6 \u09a5\u09c7\u0995\u09c7 \u09a4\u09be\u09dc\u09bf\u09df\u09c7 \u09a6\u09c7\u0993\u09df\u09be \u0989\u099a\u09bf\u09a4 ", + "output": [ + "Political" + ] + }, + { + "input": " \u099c\u09be\u09ae\u09be\u09a4 \u09b6\u09bf\u09ac\u09bf\u09b0 \u09b9\u09bf\u09b8\u09be\u09ac\u09c7 \u099a\u09be\u09b2\u09bf\u09df\u09c7 \u09a6\u09bf\u09df\u09c7\u09a8 \u0986\u0993\u09ae\u09c0\u09b2\u09c0\u0997\u09a4 \u09ab\u09c7\u09b0\u09c7\u09b8\u09cd\u09a4\u09be \u09a4\u09be\u0987\u09a8\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u098f\u099f\u09be \u0986\u09ac\u09be\u09b0 \u09ac\u09b2\u09a4\u09c7 \u09b9\u09af\u09bc \u09ac\u09bf\u0995\u09b2\u09cd\u09aa \u099a\u09bf\u09a8\u09cd\u09a4\u09be \u0995\u09b0\u09c1\u09a8 \u0995\u09c1\u0995\u09c1\u09b0 \u0995\u0996\u09a8\u09cb \u09ad\u09be\u09b2\u09cb \u09b9\u09af\u09bc \u09a8\u09be \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b2\u09c0\u0997\u09c7\u09b0 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09ae\u09bf \u09af\u09be\u09ac\u09c7\u09a8\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b2\u099f\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09a8\u09be\u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7 \u099c\u09bf\u09a8\u09cd\u09a8\u09be\u09b9 \u09ac\u09be\u099a\u099a\u09be\u09a6\u09c7\u09b0 \u0997\u09c1\u09b7\u09cd\u099f\u09bf \u09ae\u09be\u09b0\u09bf \u099c\u09df \u09ac\u09be\u0982\u09b2\u09be \u099c\u09df \u09ac\u0999\u09cd\u0997\u09ac\u09a8\u09cd\u09a7\u09c1 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09ae\u09c1\u09b0\u09cd\u09a6\u09be\u09ac\u09be\u09a6 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09af\u09be\u09b0\u09be \u099c\u09be\u09ae\u09be\u09df\u09be\u09a4 \u0987\u09b8\u09b2\u09be\u09ae\u09bf\u09b0 \u09a8\u09a4\u09c1\u09a8 \u0986\u09ae\u09c0\u09b0 \u099c\u09a8\u09be\u09ac \u09ae\u0995\u09ac\u09c1\u09b2 \u0986\u09b9\u09ae\u09c7\u09a6 \u0995\u09c7 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0 \u0995\u09ae\u09be\u09a8\u09cd\u09a1\u09be\u09b0 \u09ac\u09b2\u09c7 \u0985\u09aa\u09cd\u09b0\u09aa\u09cd\u09b0\u099a\u09be\u09b0 \u0995\u09b0\u099b\u09c7\u09a8 \u0995\u09c1 \u09b0\u09c1\u099a\u09bf\u09aa\u09c2\u09b0\u09cd\u09a8 \u09ad\u09be\u09b7\u09be \u09ac\u09cd\u09af\u09ac\u09b9\u09be\u09b0 \u0995\u09b0\u099b\u09c7\u09a8", + "output": [ + "Political" + ] + }, + { + "input": " \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09b8\u09ae\u09be\u09ac\u09c7\u09b6 \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7\u09a8 \u09b8\u09c7\u099f\u09be \u09ae\u09a8\u09cd\u09a6 \u09a8\u09df \u0986\u09aa\u09a8\u09be\u09b0\u09be\u09a4\u09cb \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09a6\u09c7\u09b0 \u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0 \u09ac\u09be\u09a8\u09be\u0987\u099b\u09c7\u09a8 \u098f\u0996\u09a8 \u09ae\u09c1\u0995\u09cd\u09a4\u09bf\u09af\u09cb\u09a6\u09cd\u09a7\u09be \u09b8\u09ae\u09be\u09ac\u09c7\u09b6 \u0995\u09b0\u09c7 \u09ae\u09c1\u0995\u09cd\u09a4\u09bf\u09af\u09c1\u09a6\u09cd\u09a7\u0995\u09c7 \u0985\u09aa\u09ae\u09be\u09a8 \u099b\u09be\u09dc\u09be \u0986\u09b0 \u0995\u09bf\u099b\u09c1\u0987 \u09a8\u09df ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b9\u09be\u09a8\u09bf\u09ab \u09b8\u09be\u09b9\u09c7\u09ac \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b2\u09c0\u0997 \u099c\u09df\u09c0 \u09b9\u09a4\u09c7 \u09b8\u09c7\u09a8\u09be\u09ac\u09be\u09b9\u09bf\u09a8\u09c0\u09b0 \u09a6\u09b0\u0995\u09be\u09b0 \u09a8\u09be\u0987", + "output": [ + "Political" + ] + }, + { + "input": "\u09b6\u09c7\u0996 \u09b9\u09be\u09b8\u09bf\u09a8\u09be \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0 \u09ac\u099a\u09cd\u099a\u09be \u09a4\u09c1\u09b0 \u09ac\u09cb\u09a6\u09be \u09aa\u09be\u099f\u09be\u09ae\u09c1 \u09ae\u09be\u0997\u09bf \u099a\u09cb\u0987\u09a6\u09cd\u09a6\u09be \u09a4\u09cb\u09b0 \u09ae\u09be\u0997\u09bf\u09ac\u09be\u099c \u09ae\u099c\u09bf\u09ac\u09c7\u09b0 \u0995\u09be\u09a8\u09a1\u09c7 \u09b0\u09be\u0987\u0996\u09be \u09aa\u09b0\u09c7 \u099c\u09af\u09bc \u09b0\u09c7 \u09a6\u09bf\u09af\u09bc\u09be \u09a4\u09cb\u09b0 \u09ac\u09cb\u09a6\u09be \u099a\u09be\u099f\u09be\u09ae\u09c1 \u0986\u09b0 \u09a4\u09c1\u09b0 \u0995\u09c1\u09a4\u09cd\u09a4\u09be \u09b2\u09c0\u0997 \u09a4\u09c1\u09b0\u09c7 \u099a\u09be\u0987\u099f\u09cd\u099f\u09be \u0996\u09be\u0987\u09ac\u09cb", + "output": [ + "Political" + ] + }, + { + "input": "\u09a1\u0983 \u0995\u09be\u09ae\u09be\u09b2 \u09b9\u09cb\u09b8\u09c7\u09a8 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09a6\u09be\u09b2\u09be\u09b2 \u09b9\u09af\u09bc\u09c7 \u09ac\u09bf\u098f\u09a8\u09aa\u09bf\u0995\u09c7 \u09a7\u09cd\u09ac\u0982\u09b8 \u0995\u09b0\u09a4\u09c7 \u098f\u09b8\u09c7\u099b\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": " \u0993\u0987 \u09aa\u09c1\u09b2\u09bf\u09b6 \u09ae\u09a8\u09c7 \u09b9\u09df \u09b6\u09bf\u09ac\u09bf\u09b0 \u099c\u09be\u09ae\u09be\u09a4 \u098f\u09b0 \u0995\u09b0\u09cd\u09ae\u09c0 \u09b8\u09c7 \u09af\u09a6\u09bf \u09a8\u09bf\u099c\u09c7 \u0995\u09b0\u09cd\u09ae\u09c0 \u09a8\u09be\u0993 \u09b9\u09df \u09a4\u09ac\u09c7 \u09a4\u09be\u09b0 \u098f\u09b2\u09be\u0995\u09be\u09b0 \u0995\u09c7\u0989 \u099c\u09be\u09ae\u09be\u09a4 \u0995\u09b0\u09c7 \u09ad\u09be\u09ac \u09ae\u09c1\u09b0\u09cd\u09a4\u09bf \u0985\u09b0\u09cd\u099c\u09a8\u09c7 \u098f\u09ad\u09be\u09ac\u09c7\u0987 \u0995\u09be\u099c \u0995\u09b0\u09a4\u09c7 \u09b9\u09ac\u09c7 \u0995\u09bf \u09ac\u09b2\u09c7\u09a8 \u09b8\u09ac\u09be\u0987 ", + "output": [ + "Political" + ] + }, + { + "input": "\u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09be \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b2\u09c0\u0997\u09c7\u09b0 \u09a6\u09be\u09b2\u09be\u09b2\u09b0\u09be \u09ac\u09b2\u09c7 \u09a6\u09c7\u09b6\u09c7 \u09a8\u09be \u0995\u09c0 \u0989\u09a8\u09cd\u09a8\u09df\u09a8\u09c7\u09b0 \u099c\u09c1\u09df\u09be\u09b0 \u09ac\u0987\u09a4\u09c7\u099b\u09c7 \u098f\u0997\u09c1\u09b2\u09be\u09b0 \u09a8\u09be\u09ae \u0995\u09bf \u0989\u09a8\u09cd\u09a8\u09df\u09a8", + "output": [ + "Political" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u099a\u09cb\u09b0 \u0986\u09b0 \u09a4\u09be\u09b0\u09c7\u0995 \u099c\u09bf\u09df\u09be \u09ac\u09c0\u09b0", + "output": [ + "Political" + ] + }, + { + "input": "\u0986\u09ae\u09bf \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0 \u09af\u09a6\u09bf \u099b\u09c7\u09b2\u09c7 \u09b9\u09df \u09a4\u09cb\u09b0 \u09ae\u09be\u0995\u09c7 \u099c\u09bf\u0997\u09be\u0987\u09b8 \u09a4\u09cb\u0987 \u0995\u09be\u09b0 \u099b\u09c7\u09b2\u09c7", + "output": [ + "Political" + ] + }, + { + "input": " \u0997\u09be\u099c\u09be \u09ae\u09a6 \u09b9\u09bf\u09b0\u09cb\u0987\u09a8 \u09ae\u09be\u0997\u09c0 \u09ac\u09be\u099c \u099a\u09be\u09a6\u09be \u09ac\u09be\u099c \u099a\u09cb\u09b0 \u09ac\u09be\u099f\u09aa\u09be\u09b0 \u099f\u09c7\u09a8\u09cd\u09a1\u09be\u09b0 \u09ac\u09be\u099c \u09b2\u09cb\u099a\u099b\u09be \u09ad\u09a6\u09ae\u09be\u0987\u09b8 \u09ac\u09be\u0982\u09b2\u09be \u09a6\u09c7\u09b6 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b2\u09c0\u0997 \u0995\u09b0\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": " \u09a4\u09be\u09b0\u09c1\u09a8\u09cd\u09af\u09c7\u09b0 \u0985\u09b9\u0982\u0995\u09be\u09b0 \u0986\u0997\u09be\u09ae\u09c0\u09b0 \u09b0\u09be\u09b7\u099f\u09cd\u09b0 \u09a8\u09be\u09df\u0995 \u09a4\u09be\u09b0\u09c7\u0995 \u099c\u09bf\u09df\u09be\u09b0 \u09a8\u09bf\u09b0\u09cd\u09a6\u09c7\u09b6 \u09ae\u09cb\u09a4\u09be\u09ac\u09c7\u0995 \u0995\u09be\u099c \u0995\u09b0\u09a4\u09c7 \u09b9\u09ac\u09c7 \u09a4\u09be\u09b9\u09b2\u09c7 \u09b8\u09ab\u09b2 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09aa\u09be\u0981\u099a \u09ac\u09be\u09b0 \u09a6\u09c1\u09b0\u09cd\u09a8\u09c0\u09a4\u09bf\u09a4\u09c7 \u09ac\u09bf\u09b6\u09cd\u09ac \u099a\u09cd\u09af\u09be\u09ae\u09cd\u09aa\u09bf\u09df\u09a8 \u09ac\u09bf\u09ae\u09cd\u09aa\u09bf\u09b0 \u09a6\u09be\u09b2\u09be\u09b2 \u09aa\u09be\u09b0\u09cd\u09a5 \u099a\u09cb\u09b0\u09c7\u09b0 \u09ac\u09c7\u099f\u09be", + "output": [ + "Political" + ] + }, + { + "input": " \u0986\u0997\u09be\u09ae\u09c0\u0995\u09be\u09b2 \u09a6\u09b6 \u09ac\u099b\u09b0\u09c7\u09b0 \u09b6\u09bf\u09b6\u09c1\u0995\u09c7 \u09af\u09a6\u09bf \u099c\u09be\u09ae\u09be\u09df\u09be\u09a4\u09c7\u09b0 \u0986\u09ae\u09bf\u09b0 \u09ac\u09be\u09a8\u09be\u0987 \u09a4\u09be\u09b0 \u09ac\u09bf\u09b0\u09c1\u09a6\u09cd\u09a7\u09c7\u0993 \u09af\u09c1\u09a6\u09cd\u09a7\u09be\u09aa\u09b0\u09be\u09a7\u09bf\u09b0 \u09a4\u09a6\u09a8\u09cd\u09a4 \u09b6\u09c1\u09b0\u09c1 \u09b9\u09ac\u09c7 \u098f\u09ac\u0982 \u09aa\u09cd\u09b0\u09ae\u09be\u09a8 \u09b9\u09ac\u09c7 \u09b8\u09c7 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 ", + "output": [ + "Political" + ] + }, + { + "input": " \u09a4\u09ac\u09c7 \u0995\u09bf \u09a6\u09c7\u09b6 \u098f\u0996\u09a8 \u09b0\u09b8\u09be\u09a4\u09b2\u09c7 \u0995\u09cb\u09a8 \u09ae\u09be\u09a8\u09c1\u09b7 \u099c\u09be\u09ae\u09be\u09a4 \u0995\u09b0\u09b2\u09c7\u0987 \u09b8\u09c7 \u0995\u09c7\u09a8 \u09b9\u09ac\u09c7 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u098f\u099f\u09bf \u09a6\u09c7\u09b6 \u09a8\u09be \u098f\u099f\u09be \u099c\u09be\u09b2\u09bf\u09ae \u09a6\u09c7\u09b0 \u0986\u0996\u09b0\u09be \u0995\u09bf \u0986\u09b0 \u09b2\u09bf\u0996\u09ac\u09cb \u09a8\u09be\u0995\u09bf \u09ac\u09b2\u09c7 \u0986\u09ae\u09bf\u0993 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 ", + "output": [ + "Political" + ] + }, + { + "input": "\u0986\u09a8\u09cd\u09a6\u09be\u09b2\u09bf\u09ac \u09ad\u09be\u0987 \u098f\u0987 \u09b6\u09be\u09b2\u09be\u09b0\u09be \u09b8\u09ac \u0986\u0993\u09af\u09bc\u09be\u09ae\u09c0 \u09b2\u09c0\u0997\u09c7\u09b0 \u099a\u09be\u09ae\u099a\u09be \u09aa\u09be-\u099a\u09be\u099f\u09be \u0995\u09c1\u0995\u09c1\u09b0 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b6\u09c7\u0996 \u09ae\u09c1\u099c\u09bf\u09ac \u09a8\u09be \u09a5\u09be\u0995\u09b2\u09c7 \u09a6\u09c7\u09b6 \u09b8\u09cd\u09ac\u09be\u09a7\u09c0\u09a8 \u09a8\u09be \u09b9\u09b2\u09c7 \u099c\u09bf\u09df\u09be \u09a4\u09cb\u09b0 \u09ae\u09be \u0986\u09b0 \u09a4\u09cb\u09b0 \u09ae\u09a4 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b0\u09c7 \u09b8\u09cd\u09ac\u09c0\u0995\u09be\u09b0 \u0995\u09b0\u09a4 \u09a8\u09be", + "output": [ + "Political" + ] + }, + { + "input": "\u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u0993 \u099c\u0999\u09cd\u0997\u09bf \u099c\u09be\u09a8\u09cb\u09df\u09be\u09b0\u09a6\u09c7\u09b0 \u09b8\u09bf\u09a8\u09cd\u09a1\u09bf\u0995\u09c7\u099f \u09a8\u09be\u0995\u09bf \u09b8\u09b0\u09cd\u09ac\u09b6\u0995\u09cd\u09a4\u09bf\u09ae\u09be\u09a8 \u09ae\u09b9\u09be\u09aa\u09cd\u09b0\u09ad\u09c1\u0995\u09c7\u0993 \u0995\u09bf\u09a8\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 \u09a4\u09be\u09b0\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u09ac \u09a4\u09c7 \u09ac\u09bf\u09ae\u09be\u09a8 \u09a4\u09c1\u0987 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09a4\u09c1\u0987 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 ", + "output": [ + "Political" + ] + }, + { + "input": "\u0989 \u0989 \u0993\u0987\u09af\u09c7 \u09a6\u09c7\u0996\u09b2\u09be\u09ae \u09a4\u09cb \u099c\u09be\u09ae\u09be\u09b2\u09aa\u09c1\u09b0\u09c7 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09c7 \u09ae\u09a8\u09cb\u09a8\u09df\u09a8 \u09a6\u09bf\u099b\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": " \u0986\u0993\u09df\u09be\u09ae\u09c0\u09b2\u09c0\u0997 \u0995\u09b0\u09cd\u09ae\u09c0\u09a6\u09c7\u09b0 \u098f\u0987 \u098f\u0995\u099f\u09be \u09aa\u09cd\u09b0\u09ac\u09cd\u09b2\u09c7\u09ae \u09a4\u09be\u09a6\u09c7\u09b0 \u09ac\u09bf\u09b0\u09c1\u09a6\u09cd\u09a7\u09c7 \u0995\u09c7\u0989 \u0995\u09bf\u099b\u09c1 \u09ac\u09b2\u09b2\u09c7\u0987 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09b9\u09df\u09c7 \u09af\u09be\u09df \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c0 \u09b9\u09df\u09c7 \u09af\u09be\u09df ", + "output": [ + "Political" + ] + }, + { + "input": "\u09af\u09c7\u0987 \u09a6\u09b2\u0987\u0987 \u09b9\u09cb\u0995 \u09ae\u09be\u09a8\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u098f\u0995 \u0986\u0993\u09df\u09be\u09ae\u09c0\u09b2\u09c0\u0997 \u0986\u09b0 \u098f\u0995 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b2\u09c0\u0997 \u099b\u09be\u09dc\u09be \u0986\u09b0 \u0986\u099b\u09c7 \u0995\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b8\u09c7\u0995\u09b9\u09be\u099a\u09bf\u09a8\u09be \u098f\u0997\u09c1\u09b2\u09be \u09a6\u09c7\u0996\u09ac\u09c7\u09a8\u09be \u09a6\u09c7\u0996\u09ac\u09c7\u09b6\u09c1\u09a6\u09c1 \u0995\u09a5\u09be \u0995\u09be\u09b0\u09c7\u0995\u09cb\u09a8 \u09ae\u09bf\u09b0\u09be\u099c \u0995\u09a5\u09be\u0995\u09be\u09b0\u09c7 \u0995\u09cb\u09a8 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u0996\u09c7\u09df\u09c7 \u09a6\u09c7\u09df\u09c7 \u0995\u09cb\u09a8\u09cb \u0995\u09be\u099c\u09a8\u09be\u0987", + "output": [ + "Political" + ] + }, + { + "input": "\u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09bf \u099c\u09be\u09a4\u09c0\u09df \u09ac\u09be\u099f\u09aa\u09be\u09b0 ", + "output": [ + "Political" + ] + }, + { + "input": "\u0989\u09a8\u09bf \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u0995\u0996\u09a8 \u09b9\u09b2\u09c7\u09a8 \u099c\u09be\u09ae\u09be\u09af\u09bc\u09be\u09a4\u09c7\u09b0 \u0986\u09ae\u09bf\u09b0 \u09b9\u0993\u09af\u09bc\u09be\u09b0 \u0986\u0997\u09c7 \u098f\u0987 \u0995\u09a5\u09be \u0995\u09c7\u0989 \u09ac\u09b2\u09c7\u09a8\u09a8\u09bf \u09a8\u09be\u099f\u0995\u09c7 \u0993 \u099b\u09bf\u09a8\u09c7\u09ae\u09be\u09a4\u09c7 \u09af\u09c7\u09ac\u09be\u09ac\u09c7 \u099a\u09b0\u09bf\u09a4\u09cd\u09b0 \u09a4\u09c8\u09b0\u09bf \u0995\u09b0\u09be \u09b9\u09df \u098f\u0996\u09be\u09a8\u09c7 \u0993 \u09a4\u09be\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf \u09aa\u09b2\u09a8 \u09a6\u09c7\u0996\u09be \u09af\u09be\u099a\u09cd\u099b\u09c7", + "output": [ + "Political" + ] + }, + { + "input": " \u098f\u0995\u099f\u09be \u09a8\u09be\u09ac\u09be\u09b2\u09cb\u0995 \u0995\u09c7 \u099c\u09be\u09ae\u09be\u09a4\u09c7\u09b0 \u099a\u09c7\u09df\u09be\u09b0\u09c7 \u09ac\u09b8\u09be\u09b2\u09c7\u0993 \u09b8\u09c7 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09b9\u09bf \u09b9\u09bf \u09b9\u09bf \u09ad\u09be\u09b0\u09aa\u09cd\u09b0\u09be\u09aa\u09cd\u09a4 \u09a6\u09be\u09df\u09bf\u09a4\u09cd\u09ac \u09aa\u09be\u09b2\u09a8 \u0995\u09b0\u09b2\u09c7\u09a8 \u09a4\u09bf\u09a8\u09bf \u099b\u09df \u09ac\u099b\u09b0 \u0995\u0987 \u09a4\u0996\u09a8 \u09a4\u09cb \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09be\u09b9\u09b2\u09cb \u09a8\u09be ", + "output": [ + "Political" + ] + }, + { + "input": " \u09ac\u09bf \u098f\u09a8 \u09aa\u09bf \u0993 \u099c\u09be\u09ae\u09be\u09df\u09be\u09a4 \u09b6\u09bf\u09ac\u09bf\u09b0\u09c7\u09b0 \u09b9\u09be\u09a4 \u099b\u09bf\u09b2 \u09ac\u09b2\u09c7 \u09a7\u09be\u09b0\u09a8\u09be \u0995\u09b0\u09be \u09b9\u099a\u09cd\u099b\u09c7 \u09a4\u09a6\u09a8\u09cd\u09a4 \u09b0\u09bf\u09aa\u09cb\u09b0\u09cd\u099f \u09aa\u09cd\u09b0\u0995\u09be\u09b6 \u09aa\u09c7\u09b2\u09c7 \u0986\u09aa\u09a8\u09be\u09b0\u09be \u09b6\u09c1\u09a7\u09c1\u09ae\u09be\u09a4\u09cd\u09b0 \u09ad\u09bf \u099f\u09bf \u09ac\u09bf \u0993 \u099a\u09c1\u09a8\u09cd\u09a8\u09bf \u09b8\u09be\u09b9\u09be\u09b0 \u09ae\u09be\u09a7\u09cd\u09af\u09ae\u09c7 \u099c\u09be\u09a8\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09c7\u09a8 ", + "output": [ + "Political" + ] + }, + { + "input": " \u098f\u0987\u099f\u09be\u09b0 \u09aa\u09bf\u099b\u09a8\u09c7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09b6\u09bf\u09ac\u09bf\u09b0\u09c7\u09b0 \u09b9\u09be\u09a4 \u0986\u099b\u09c7 \u09ae\u09be\u09ae\u09c1 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09ae\u09a8\u09cd\u099c\u09c1 \u099a\u09cb\u09b0\u09c7\u09b0 \u09aa\u09c1\u09b2\u09be \u09aa\u09be\u09b0\u09cd\u09a5 \u09ac\u09bf\u09df\u09be\u09a6\u09aa", + "output": [ + "Political" + ] + }, + { + "input": "\u09b0\u09a8\u09bf \u09b8\u09be\u09b9\u09c7\u09ac \u09ac\u09b2\u099b\u09bf\u09b2 \u0986\u0993\u09df\u09be\u09ae\u09c0\u09b2\u09c0\u0997 \u0995\u09c7 \u099c\u09c1\u09a4\u09be \u09a6\u09bf\u09df\u09be \u09ae\u09be\u09b0\u09b2\u09c7 \u0993 \u09ae\u09be\u09a8 \u09b8\u09a8\u09cd\u09ae\u09be\u09a8 \u09af\u09be\u09df \u09a8\u09be \u098f\u0996\u09a8 \u09a6\u09c7\u0996\u09bf \u09a4\u09be\u09b0 \u09a4\u09be\u0993 \u09af\u09be\u09df \u09a8\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u0986\u09b8\u09b2\u09c7 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09bf\u09b0\u09be \u0995\u09ac\u09c7 \u09ac\u09c1\u099d\u09ac\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0 \u09ad\u09bf\u0995\u09cd\u09b7\u09be\u09b0 \u09ac\u09c2\u09a4\u09cd\u09a4\u09bf \u09a5\u09c7\u0995\u09c7 \u09b6\u09c1\u09b0\u09c1 \u0995\u09b0\u09c7 \u09aa\u09b0\u09cd\u09af\u09a8\u09cd\u09a4 \u099a\u09b2\u09c7 \u098f\u09b8\u09c7\u099b\u09c7 \u09b8\u09c7\u0987 \u09b0\u09c7\u09b8\u09c7\u0987 \u0986\u09ac\u09be\u09b0 \u09b9\u09be\u09a4 \u09aa\u09be\u099a\u09cd\u099b\u09c7 \u0986\u09b8\u09b2\u09c7 \u09b2\u099c\u09cd\u099c\u09be \u09a8\u09be \u09a5\u09be\u0995\u09b2\u09c7 \u098f\u0995\u099f\u09be \u09a6\u09c7\u09b6 \u0995\u09a4 \u09a8\u09bf\u099a\u09c7 \u09a8\u09be\u09ae\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 \u09a4\u09be\u0987 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u0995\u09c1\u0995\u09c1\u09b0\u09b0\u09be \u0986\u09ac\u09be\u09b0 \u09ac\u09cb\u099d\u09be\u09a4\u09c7 \u099a\u09be\u099a\u09cd\u099b\u09c7", + "output": [ + "Political" + ] + }, + { + "input": " \u09ae\u09be\u09df\u09be\u09a8\u09ae\u09be\u09b0\u09c7\u09b0 \u09b8\u09ae\u09b8\u09cd\u09af\u09be\u09df\u0993 \u09b6\u09bf\u09ac\u09bf\u09b0\u09c7\u09b0 \u09b9\u09be\u09a4 \u09a5\u09be\u0995\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": "\u0986\u09ae\u09bf \u09ac\u09c1\u099d\u09bf \u09a8\u09be \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09a6\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u098f\u09a6\u09c7\u09b6\u09c7\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7\u09c7\u09b0 \u098f\u09a4 \u099a\u09c7\u09b2\u09cd\u09b2\u09be \u099a\u09bf\u09b2\u09cd\u09b2\u09bf \u0995\u09cd\u09af\u09be \u0995\u09c7\u0989 \u09ac\u09b2\u09c7 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09b0\u09be \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u099c\u09be\u09a4\u09bf \u09ad\u09be\u0987 \u0995\u09c7\u0989 \u09ac\u09b2\u09c7 \u099c\u09be\u09ae\u09be\u09a4\u09bf \u09ad\u09be\u0987 \u0995\u09c7\u0989 \u09ac\u09b2\u09c7 \u09ac\u09be\u09ae\u09be\u09a4\u09bf \u09ad\u09be\u0987 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u0986\u09ae\u09bf \u09ac\u09b2\u09bf \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09b0\u09be \u0986\u09ae\u09be\u09b0 \u099a\u09c1\u09a6\u09bf\u09b0 \u09ad\u09be\u0987 \u09af\u09c7 \u09b2\u09cb\u0995 \u09a8\u09bf\u099c\u09c7\u09b0 \u09a6\u09c7\u09b6\u09c7\u09b0 \u09a8\u09bf\u09b0\u09cd\u09af\u09be\u09a4\u09bf\u09a4 \u09b8\u09be\u0981\u0993\u09a4\u09be\u09b2\u0997\u09cb\u09b7\u09cd\u09a0\u09c0 \u0995\u09bf\u0982\u09ac\u09be \u09b8\u0982\u0996\u09cd\u09af\u09be\u09b2\u0998\u09c1\u09a6\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09aa\u09cd\u09b0\u09a4\u09bf\u09ac\u09be\u09a6 \u09a8\u09be \u0995\u09b0\u09c7 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09a6\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u099a\u09bf\u09b2\u09cd\u09b2\u09be \u09aa\u09be\u09b2\u09cd\u09b2\u09be \u0995\u09b0\u09c7 \u09b8\u09c7 \u09b9\u0987\u09b2 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0 \u09a6\u09c1\u09a7\u09ad\u09be\u0987 ", + "output": [ + "Political" + ] + }, + { + "input": "\u0986\u09b0\u09c7 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7 \u09ae\u09be\u09a8\u09bf \u09ac\u09c1\u099c\u09b8 \u09a8\u09be\u0995\u09bf \u09a1\u09be\u09a8\u09cd\u09a1\u09bf\u09b0 \u09ac\u09be\u099a\u099a\u09be \u0986\u09ac\u09be\u09b0 \u09ac\u09dc \u09ac\u09dc \u0995\u09a5\u09be \u09ac\u09b2\u099a \u09aa\u09be\u0997\u09b2 \u099a\u09be\u0997\u09b2 \u0995\u09c1\u09a4\u09a4\u09be", + "output": [ + "Political" + ] + }, + { + "input": " \u0986\u09b8\u09c7\u09be\u09b2\u09c7 \u09ac\u09bf\u098f\u09a8\u09aa\u09bf \u098f\u0995\u099f\u09be \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09b8\u09ad\u09be\u09df \u099c\u09c7\u09a8\u09c7 \u0997\u09c7\u099b\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09ae\u09be\u09b9\u09bf \u09ac\u09be\u099c\u09c7\u099a\u09cc\u09a7\u09c1\u09b0\u09c0 \u09ab\u09be\u09b2\u09a4\u09c1 \u09b2\u09cb\u0995 \u09ae\u09be\u09b9\u09bf ", + "output": [ + "Political" + ] + }, + { + "input": "\u0990\u0995\u09cd\u09af\u09ab\u09cd\u09b0\u09a8\u09cd\u099f\u09c7\u09b0 \u09ae\u09be\u09a7\u09cd\u09af\u09ae\u09c7 \u09b8\u09b0\u0995\u09be\u09b0\u09c7\u09b0 \u09aa\u09a4\u09a8 \u09b9\u09ac\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09ae\u09be\u09b9\u09c0 \u09a4\u09c1\u0987 \u098f\u0995\u099f\u09be \u09b9\u09be\u0987\u0993\u09df\u09be\u09a8 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09aa\u09b0\u09bf\u0995\u09b2\u09cd\u09aa\u09bf\u09a4 \u09ad\u09be\u09ac\u09c7 \u09b0\u09c1\u09ac\u09c7\u09b2 \u09a8\u09be\u09b8\u09bf\u09b0 \u098f\u09ac\u0982 \u0986\u09b2 \u0986\u09ae\u09bf\u09a8\u09c7\u09b0 \u0995\u09cd\u09af\u09be\u09b0\u09bf\u09df\u09be\u09b0 \u09a7\u09cd\u09ac\u0982\u09b8 \u0995\u09b0\u09c7 \u09a6\u09bf\u099a\u09cd\u099b\u09c7 \u09aa\u09be\u09aa\u09a8\u09ad\u09be\u099c\u09be \u0986\u09b0 \u09a4\u09be\u09b0 \u0997\u09c3\u09b9\u09aa\u09be\u09b2\u09bf\u09a4 \u09b6\u09df\u09a4\u09be\u09a8 \u0997\u09c1\u09b2\u09cb \u098f\u09b0\u09be\u0993 \u098f\u0995\u09a7\u09b0\u09a8\u09c7\u09b0 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09a6\u09c7\u09b6\u09c7\u09b0 \u09b6\u09a4\u09cd\u09b0\u09c1 \u0995\u09cd\u09b0\u09bf\u0995\u09c7\u099f \u09aa\u09cd\u09b0\u09c7\u09ae\u09c0\u09a6\u09c7\u09b0 \u0995\u09be\u099b\u09c7 \u098f\u09a6\u09c7\u09b0 \u09a8\u09cb\u0982\u09b0\u09be \u09b0\u09be\u099c\u09a8\u09c0\u09a4\u09bf\u09b0 \u09ae\u09c1\u0996\u09cb\u09b6 \u0986\u09b8\u09cd\u09a4\u09c7 \u0986\u09b8\u09cd\u09a4\u09c7 \u0989\u09ae\u09cd\u09ae\u09cb\u099a\u09bf\u09a4 \u09b9\u099a\u09cd\u099b\u09c7 \u0993\u09b0\u09be \u09b9\u09df\u09a4\u09cb \u09ac\u09c1\u099d\u09a4\u09c7 \u09aa\u09be\u09b0\u099b\u09c7\u09a8\u09be \u0986\u09ae\u09b0\u09be \u09ac\u09be\u0999\u09be\u09b2\u09bf\u09b0\u09be \u098f\u09ae\u09a8 \u098f\u0995\u099f\u09be \u099c\u09be\u09a4\u09bf \u09ae\u09be\u09a5\u09be\u09df \u09a4\u09c1\u09b2\u09c7 \u09a8\u09be\u099a\u09a4\u09c7 \u09af\u09c7\u09ae\u09a8 \u09aa\u09be\u09b0\u09bf \u09ae\u09c1\u0996\u09cb\u09b6 \u0996\u09c1\u09b2\u09cd\u09b2\u09c7\u0987 \u099c\u09c1\u09a4\u09cb\u09aa\u09c7\u099f\u09be \u0995\u09b0\u09a4\u09c7\u0993 \u09aa\u09be\u09b0\u09bf ", + "output": [ + "Political" + ] + }, + { + "input": "\u09a4\u09c1\u09b0 \u09ae\u09c1\u0996\u09c7 \u099c\u09c1\u09a4\u09be \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be ", + "output": [ + "Political" + ] + }, + { + "input": " \u0995\u09cb\u09a8 \u09a6\u09bf\u09a8\u09c7 \u0993 \u0986\u09aa\u09a8\u09be\u0995\u09c7 \u09a4\u09be\u09b0\u09c7\u0995 \u099c\u09bf\u09df\u09be\u09b0 \u09ae\u09a4 \u09b9\u0993\u09df\u09be \u09b8\u09ae\u09cd\u09ad\u09ac \u09a8\u09df ", + "output": [ + "Political" + ] + }, + { + "input": "\u099c\u09be\u09a4\u09c0\u09df \u0990\u0995\u09cd\u09af \u09aa\u09cd\u09b0\u0995\u09cd\u09b0\u09bf\u09df\u09be \u09a5\u09c7\u0995\u09c7 \u099b\u09bf\u099f\u0995\u09c7 \u09aa\u09dc\u09c7 \u09ae\u09be\u09b9\u09bf'\u09b0 \u099a\u09c1\u09b2\u0995\u09be\u09a8\u09c0 \u09b6\u09c1\u09b0\u09c1 \u09b9\u09df\u09c7 \u0997\u09c7\u099b\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": "\u0986\u09aa\u09a8\u09be\u09b0 \u0996\u09c1\u09b0\u09be \u09af\u09c1\u0995\u09cd\u09a4\u09bf\u099f\u09be \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09a6\u09c7\u09b0 \u09af\u09c1\u0995\u09cd\u09a4\u09bf\u09b0 \u09ae\u09a4\u09cb \u09ae\u09a8\u09c7 \u09b9\u09df \u098f\u0995\u09be\u09a4\u09cd\u09a4\u09b0\u09c7 \u09ad\u09be\u09b0\u09a4 \u09af\u09a6\u09bf \u098f\u09ae\u09a8 \u09af\u09c1\u0995\u09cd\u09a4\u09bf \u09a6\u09bf\u09a4 \u09a4\u09be\u09b9\u09b2\u09c7 \u0995\u09c7\u09ae\u09a8 \u09b9\u09a4\u09cb \u09ad\u09c7\u09ac\u09c7\u099a\u09c7\u09a8 \u0995\u09bf ", + "output": [ + "Political" + ] + }, + { + "input": " \u09ac\u09bf \u098f\u09a8 \u09aa\u09bf \u09a6\u09c7\u0996\u09c7 \u09ad\u09df \u09aa\u09c7\u09df\u09c7 \u0997\u09c7\u099b\u09c7 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b2\u09c0\u0997 ", + "output": [ + "Political" + ] + }, + { + "input": "\u0986\u09aa\u09a8\u09be\u09b0\u09be \u09a6\u09c7\u09b6\u0995\u09c7 \u09ad\u09be\u09b2\u09ac\u09be\u09b8\u09c7\u09a8 \u09a8\u09be \u0986\u09aa\u09a8\u09be\u09b0\u09be \u0985\u09a8\u0995\u09c7 \u09b2\u09cb\u09ad\u09bf ", + "output": [ + "Political" + ] + }, + { + "input": " \u098f\u0987 \u09ac\u09a6\u09b0\u09c1\u09b2 \u09b8\u09be\u09b2\u09c7 \u0985\u09a5\u09ac\u09be \u099c\u09be\u09a8\u09c1\u09df\u09be\u09b0\u09c0 \u0995\u09b2\u09c7\u099c \u099b\u09be\u09a4\u09cd\u09b0\u09c0 \u0996\u09be\u09a6\u09bf\u099c\u09be \u0986\u0995\u09cd\u09a4\u09be\u09b0 \u09a8\u09be\u09b0\u09cd\u0997\u09bf\u09b8\u0995\u09c7 \u0989\u0995\u09cd\u09a4\u09a4\u09cd\u09af \u0995\u09b0\u09a4\u09c7 \u0997\u09bf\u09df\u09c7 \u09b8\u09bf\u09b2\u09c7\u099f\u09c7\u09b0 \u09b6\u09b9\u09b0\u09a4\u09b2\u09c0\u09b0 \u099c\u09be\u0999\u09cd\u0997\u09be\u0987\u09b2 \u098f\u09b2\u09be\u0995\u09be\u09df \u09b6\u09ab\u09bf\u09b0\u0989\u09a6\u09cd\u09a6\u09bf\u09a8 \u09b9\u09be\u0987 \u09b8\u09cd\u0995\u09c1\u09b2\u09c7\u09b0 \u09b8\u09be\u09ae\u09a8\u09c7 \u09b8\u09cd\u09a5\u09be\u09a8\u09c0\u09df\u09b0\u09be \u09a5\u09be\u0995\u09c7 \u0997\u09a3\u09a7\u09cb\u09b2\u09be\u0987 \u09a6\u09c7\u09df \u09a4\u0996\u09a8\u09cb \u09a4\u09be\u09b0 \u09aa\u09b0\u09bf\u099a\u09df \u099b\u09be\u09a4\u09cd\u09b0\u09b2\u09c0\u0997 \u099b\u09bf\u09b2 \u09a4\u09be\u0987 \u0998\u099f\u09a8\u09be\u09b0 \u09b8\u09be\u09a5\u09c7 \u09b8\u09be\u09a5\u09c7 \u09b8\u09cd\u09a5\u09be\u09a8\u09c0\u09df \u0986\u0993\u09df\u09be\u09ae\u09c0\u09b2\u09c0\u0997 \u09a8\u09c7\u09a4\u09be\u09b0\u09be \u09b0\u09be\u09b8\u09cd\u09a4\u09be \u0985\u09ac\u09b0\u09cb\u09a7 \u0995\u09b0\u09c7 \u09ac\u09bf\u099a\u09be\u09b0 \u099a\u09be\u09a8 \u09a6\u09cb\u09b7 \u099a\u09be\u09aa\u09be\u09a8 \u099b\u09be\u09a4\u09cd\u09b0\u09b6\u09bf\u09ac\u09bf\u09b0\u09c7\u09b0 \u0989\u09aa\u09b0 \u0993\u0987\u09a6\u09bf\u09a8 \u09b0\u09be\u09a4\u09c7\u0987 \u099c\u09a8 \u099c\u09be\u09ae\u09be\u09df\u09be\u09a4 \u0993 \u09b6\u09bf\u09ac\u09bf\u09b0\u09c7\u09b0 \u09a8\u09c7\u09a4\u09be \u0995\u09b0\u09cd\u09ae\u09c0\u0995\u09c7 \u0997\u09cd\u09b0\u09c7\u09ab\u09a4\u09be\u09b0 \u0995\u09b0\u09c7 \u09b0\u09bf\u09ae\u09be\u09a8\u09cd\u09a1\u09c7 \u09a8\u09c7\u09df\u09be \u09b9\u09df \u09a4\u0996\u09a8 \u09aa\u09cd\u09b0\u09a4\u09bf\u099f\u09bf \u09ae\u09bf\u09a1\u09bf\u09df\u09be \u09ac\u09a6\u09b0\u09c1\u09b2\u09c7\u09b0 \u09aa\u0995\u09cd\u09b7\u09c7 \u098f\u0995 \u09a4\u09b0\u09ab\u09be \u09ad\u09be\u09ac\u09c7 \u09b6\u09bf\u09ac\u09bf\u09b0\u0995\u09c7\u0987 \u09a6\u09be\u09df\u09c0 \u0995\u09b0\u09c7 \u09aa\u09cd\u09b0\u09a4\u09bf\u09ac\u09c7\u09a6\u09a8 \u09aa\u09cd\u09b0\u0995\u09be\u09b6 \u0995\u09b0\u09a4\u09c7 \u09a5\u09be\u0995\u09c7 \u0986\u09ae\u09bf\u09b8\u09b9 \u0985\u09a8\u09cd\u09af\u09b0\u09be \u0993\u0987\u09a6 ", + "output": [ + "Political" + ] + }, + { + "input": "\u0997\u09c1\u09a8\u09cd\u09a1\u09be \u09aa\u09be\u09a8\u09cd\u09a1\u09be \u09aa\u09be\u0997\u09b2 \u099b\u09be\u0997\u09b2 \u09a6\u09bf\u09df\u09c7 \u09a6\u09c7\u09b6\u099f\u09be \u09ac\u09b0\u09ac\u09be\u09a6 \u0995\u09b0\u09c7 \u09a6\u09bf\u099a\u09c7 \u09b6\u09be\u09b2\u09be\u09b0\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u09b6\u09b9\u09bf\u09a6 \u09b9\u09b2\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ae\u09be\u09b2\u09c1 \u0995\u09c1\u09a4\u09cd\u09a4\u09be \u0995\u09c7 \u09ae\u09be\u09b0\u09c7 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09ac\u09be\u0999\u09be\u09b2\u09bf \u0995\u09c7 \u09b6\u09b9\u09bf\u09a6 \u0995\u09b0\u09b2\u09c7\u0993 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09ac\u09be\u0995\u09b6\u09be\u09b2 \u09b8\u09b0\u0995\u09be\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf\u09ac\u09be\u09a6 \u099f\u09c1\u0995\u09c1 \u0995\u09b0\u09be\u09b0 \u09b8\u09be\u09b9\u09b6 \u09aa\u09be\u09df\u09a8\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u09ae\u099c\u09bf\u09ac \u098f\u0995\u099c\u09a8 \u09b8\u09cd\u09ac\u09be\u09b0\u09cd\u09a5\u09aa\u09b0 \u0993 \u09aa\u09cd\u09b0\u09a7\u09be\u09a3\u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0 \u09b9\u0993\u09df\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u09b8\u09ac \u0995\u09b0\u099b\u09c7", + "output": [ + "Political" + ] + }, + { + "input": " \u09b6\u09c1\u09a7\u09c1 \u09ae\u09c1\u0996\u09c7\u09b0 \u0986\u09a8\u09cd\u09a6\u09cb\u09b2\u09a8\u09c7 \u0995\u09be\u099c \u09b9\u09ac\u09c7\u09a8\u09be \u099c\u09be\u09ae\u09be\u09df\u09be\u09a4 \u09b6\u09bf\u09ac\u09bf\u09b0\u09c7\u09b0 \u09ae\u09a4 \u099c\u09c0\u09ac\u09a8 \u09ac\u09be\u099c\u09bf \u09b0\u09be\u0996\u09a4\u09c7 \u09b9\u09ac\u09c7 \u09a4\u09ac\u09c7 \u09a4\u09cb \u0995\u09be\u099c \u09b9\u09ac\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": " \u09b8\u09cd\u09ac\u09be\u09ad\u09be\u09ac\u09bf\u0995 \u098f\u0995\u099f\u09be \u09ac\u09cd\u09af\u09aa\u09be\u09b0 \u09a8\u09bf\u09df\u09be \u0995\u09bf\u099b\u09c1 \u09b8\u0982\u0996\u0995 \u09ac\u09cd\u09af\u0995\u09cd\u09a4\u09bf\u09b0\u09be \u09b8\u09c7\u0987 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09a6\u09c7\u09b0 \u09ae\u09a4 \u0995\u09a5\u09be\u09ac\u09be\u09b0\u09cd\u09a4 \u09ac\u09b2\u099b\u09c7 \u09ae\u09be\u09a8\u09c1\u09b7\u09c7\u09b0 \u09b8\u09c7\u0995\u09c7\u09a8\u09cd\u09a1\u09c7\u09b0 \u09ad\u09b0\u09b6\u09be \u09a8\u09c7\u0987 \u0986\u09b0 \u09af\u09a8\u09cd\u09a4\u09cd\u09b0\u09aa\u09a4\u09bf\u09b0 \u09ac\u09cd\u09af\u09aa\u09be\u09b0 \u098f\u099f\u09be \u09a4\u09cb \u09a8\u09b7\u09cd\u099f \u09b9\u09a4\u09c7\u0987 \u09aa\u09be\u09b0\u09c7 \u098f\u099f\u09be \u098f\u09ae\u09a8 \u0995\u09bf \u09ac\u09cd\u09af\u09aa\u09be\u09b0 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09af\u09be\u09b0\u09be \u099c\u09be\u09ae\u09be\u09df\u09be\u09a4 \u0995\u09b0\u09c7 \u09a4\u09be\u09b0\u09be \u09b8\u09ac\u09be\u0987 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u0995\u09bf \u0985\u09a6\u09cd\u09ad\u09c1\u09a4 \u09ac\u09cd\u09af\u09be\u09aa\u09be\u09b0 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09a4\u09cb\u09b0 \u09ae\u09be \u09ad\u09be\u09b2\u09cb \u09a8\u09be \u09a4\u09c1\u0987 \u0986\u09b0 \u0995\u09a4\u099f\u09c1\u0995 \u09ad\u09be\u09b2\u09cb \u09b9\u09ac\u09c7 \u09b6\u09be\u09b2\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u09ae\u09be\u09b9\u09bf \u09aa\u09be\u0997\u09b2 \u09b9\u09df\u09c7\u0997\u09c7\u099b\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b9\u09be\u099b\u09be \u0995\u09a5\u09be \u09b9\u09be\u09a8\u09bf\u09ab \u09a8\u09ac\u09cd\u09af \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09a4\u09c1\u09ae\u09bf \u099c\u09dc\u09bf\u09a4", + "output": [ + "Political" + ] + }, + { + "input": " \u0986\u09ae\u09bf \u09a6\u09c7\u0996\u09c7\u099b\u09bf \u09a8\u09be\u09ae\u09be\u099c \u09a8\u09be \u09aa\u09b0\u09b2\u09c7 \u099b\u09be\u09a4\u09cd\u09b0 \u09b6\u09bf\u09ac\u09bf\u09b0 \u09a5\u09c7\u0995\u09c7 \u09ac\u09be\u09a6 \u09a6\u09c7\u09df\u09be \u09b9\u09df \u09b0\u09cb\u099c\u09be \u09a8\u09be \u09b0\u09be\u0996\u09b2\u09c7 \u09b6\u09bf\u09ac\u09bf\u09b0 \u09a5\u09c7\u0995\u09c7 \u09ac\u09be\u09a6 \u09a6\u09c7\u09df\u09be \u09b9\u09df \u0995\u09c1\u09b0\u0986\u09a8 \u09b9\u09be\u09a6\u09bf\u09b8 \u09aa\u09be\u09a0 \u09a8\u09be \u0995\u09b0\u09b2\u09c7 \u09ac\u09be\u09a6 \u09a6\u09c7\u0993\u09df\u09be \u09b9\u09df \u0987\u09ad\u099f\u09bf\u099c\u09bf\u0982 \u0995\u09b0\u09b2\u09c7 \u09ac\u09be\u09a6 \u09a6\u09c7\u0993\u09df\u09be \u09b9\u09df \u09aa\u09cd\u09b0\u09c7\u09ae \u0995\u09b0\u09b2\u09c7 \u0995\u09df\u09c7\u0995\u09ae\u09be\u09b8\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09ab\u09cb\u09a8 \u09ac\u09dc\u09ad\u09be\u0987\u09b0\u09be \u09a8\u09bf\u09df\u09c7 \u09af\u09be\u09df \u09b6\u09be\u09b8\u09a8 \u0995\u09b0\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u0986\u099c \u09aa\u09b0\u09cd\u09af\u09a8\u09a4\u09cd\u09ae \u0986\u09ae\u09bf \u09a6\u09c7\u0996\u09bf \u09a8\u09be\u0987 \u0995\u09cb\u09a8 \u09b6\u09bf\u09ac\u09bf\u09b0 \u0995\u09b0\u09be \u099b\u09c7\u09b2\u09c7 \u0995\u09cb\u09a8 \u09ae\u09c7\u09df\u09c7\u0995\u09c7 \u09a1\u09bf\u09b8\u099f\u09be\u09b0\u09cd\u09ac \u0995\u09b0\u099b\u09c7 \u0986\u09ae\u09bf \u09a6\u09c7\u0996\u09bf \u09a8\u09be\u0987 \u0995\u09cb\u09a8 \u099a\u09be\u09a6\u09be\u09ac\u09be\u099c\u0981 \u09b6\u09bf\u09ac\u09bf\u09b0 \u0995\u09b0\u099b\u09c7 \u09a6\u09c7\u0996\u09bf \u09a8\u09be\u0987 \u0995\u09cb\u09a8 \u099f\u09c7\u09a8\u09cd\u09a1\u09be\u09b0\u09ac\u09be\u099c\u09bf \u0995\u09b0\u099b\u09c7 \u09a4\u09be\u09b0\u09aa\u09b0\u0993 \u09af\u09a4 \u09a6\u09cb\u09b7 \u09a8\u09a8\u09a6\u09cb \u0998\u09cb\u09b7 \u098f\u09a6\u09c7\u09b6\u09c7 \u0997\u09c1\u09a8\u09bf\u09b0 \u09b8\u09ae\u09be\u09a6\u09b0 \u09a8\u09c7\u0987 \u09a4\u09be\u0987 \u0997\u09c1\u09a8\u09bf \u098f\u09a6\u09c7\u09b6\u09c7 \u099c\u09a8\u09cd\u09ae \u09a8\u09bf\u09df\u09c7\u0993 \u09b2\u09be\u09ad \u09a8\u09c7\u0987 \u09b8\u09ac\u099a\u09c7\u09df\u09c7 \u09ac\u09dc\u0995\u09a5\u09be \u09b9\u099a\u09cd\u099b\u09c7 \u09b8\u09ae\u09be\u099c\u09aa\u09a4\u09bf\u09b0\u09be \u09a8\u09bf\u099c\u09c7\u09a6\u09c7\u09b0 \u09b0\u0995\u09cd\u09b7\u09be \u0995\u09b0 ", + "output": [ + "Political" + ] + }, + { + "input": "\u098f\u0987\u09b8\u09ac \u0990\u0995\u09cd\u09af\u09a7\u09be\u09b0\u09c0\u09b0\u09be \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u098f\u0995\u099f\u09be \u0993\u09df\u09be\u09b0\u09cd\u09a1\u09c7\u09b0 \u099a\u09cc\u0995\u09bf\u09a6\u09be\u09b0 \u09b9\u0993\u09df\u09be\u09b0\u09cb \u09af\u09cb\u0997\u09cd\u09af\u09a4\u09be \u09b0\u09be\u0996\u09c7 \u09a8\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u09a4\u09cb\u09a6\u09c7\u09b0 \u09b8\u0995\u09b2 \u09ac\u09bf\u09ac\u09c7\u0995 \u09ac\u09bf\u09b8\u09b0\u09cd\u099c\u09a8 \u09a6\u09bf\u09df\u09c7 \u0987 \u09a4\u09cb\u09b0\u09be \u09ac\u09bf\u09ac\u09b6\u09cd\u09b0 \u09b2\u09c0\u0997\u09df\u09c7\u0987 \u09aa\u09b0\u09bf\u09a8\u09a4 \u09b9\u09df\u09c7 \u099a\u09bf\u099b \u09b6\u09be\u09b2\u09be \u09b6\u09be\u09b2\u09be \u09ad\u09be\u09a6\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u0986\u09ae\u09b0\u09be \u0995\u09be\u0989\u09b0\u09c7 \u099c\u09be\u09ae\u09be\u09a4\u09c7\u09b0 \u0986\u09ae\u09bf\u09b0 \u09b9\u0987\u09a4\u09c7 \u09a6\u09bf\u09ae\u09c1\u09a8\u09be \u0986\u09ae\u09bf\u09b0 \u09b9\u0987\u09b2\u09c7\u0987 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09ac\u09be\u09a8\u09be\u0987\u09df\u09be \u09a6\u09bf\u09ae\u09c1 \u09a4\u09be\u09b0\u09aa\u09b0 \u09ae\u09c1\u09b9\u09be\u09b9\u09be\u09b9\u09be", + "output": [ + "Political" + ] + }, + { + "input": "\u09a6\u09c7\u09b6\u09c7\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7 \u098f\u0995\u09a6\u09b2\u09c7\u09b0 \u09b6\u09be\u09b8\u09a8\u09c7 \u0985\u09a4\u09bf\u09b7\u09cd\u099f \u09b9\u09df\u09c7 \u0997\u09c7\u099b\u09c7 \u0986\u09b0 \u09ac\u09c7\u09b6\u09cd\u09af\u09c7\u09b0 \u099b\u09c7\u09b2\u09c7 \u09ac\u09cd\u09af\u09ac\u09b8\u09be \u09a0\u09bf\u0995 \u09b0\u09be\u0996\u09be\u09b0 \u099c\u09a8\u09cd\u09af\u09bf \u09b8\u09b0\u0995\u09be\u09b0\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u0986\u09a4\u09be\u09a4 \u0995\u09b0\u09c7 \u09b9\u09bf\u09df\u09be\u09b2\u09c0 \u099a\u09c1\u09a6\u09be\u099a\u09cd\u099b\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b6\u09be\u09b2\u09be \u09a4\u09c1\u0987 \u09b9\u09b2\u09bf \u0996\u09be\u09a0\u09bf \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7 \u0986\u0993\u09b2\u09be\u09a6", + "output": [ + "Political" + ] + }, + { + "input": "\u09ae\u09be\u09b9\u09bf \u09af\u09c7 \u09ac\u09cd\u09af\u0995\u09cd\u09a4\u09bf \u098f\u0995\u099f\u09be \u09ae\u09c7\u09ae\u09cd\u09ac\u09be\u09b0 \u09b9\u0993\u09df\u09be\u09b0 \u09af\u09cb\u0997\u09cd\u09af \u09a8\u09be \u09ac\u09c7\u099f\u09be \u09ac\u09c7\u09b6\u09bf \u09aa\u099f\u09b0 \u09aa\u099f\u09b0 \u0995\u09b0\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09ae\u09be\u09a8\u09cd\u09a8\u09be\u09a6\u09c7\u09b0 \u0986\u09b8\u09b2 \u0989\u09a6\u09cd\u09a6\u09c7\u09b6\u09cd\u09af \u09ab\u09be\u0981\u09b8 \u0995\u09b0\u09c7 \u09a6\u09bf\u09b8\u09c7 \u09a8\u09a4\u09c1\u09a8 \u09aa\u09cd\u09b0\u099c\u09a8\u09cd\u09ae\u09c7\u09b0 \u09ae\u09be\u09b9\u09c0 \u099a\u09cc\u09a7\u09c1\u09b0\u09c0 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b8\u09c7 \u09a4\u09cb \u09ac\u09b0\u09bf\u09b6\u09be\u09b2\u09c7\u09b0 \u099b\u09c7\u09b2\u09c7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u0995\u09c7\u09ae\u09a8 \u0995\u09b0\u09c7 \u09a8\u09bf\u099c\u09c7\u09b0 \u09ac\u09bf\u09ad\u09be\u0997\u0995\u09c7 \u09b9\u09be\u09b0\u09bf\u09df\u09c7 \u09a6\u09bf\u09b2 \u09b8\u09c7 \u09a4\u09cb \u09ac\u09dc \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09b8\u09be\u09ac\u09bf\u09ac\u09b0", + "output": [ + "Political" + ] + }, + { + "input": "\u09ac\u09be\u09aa-\u09ac\u09c7\u099f\u09be \u09a8\u09bf\u099c\u09c7\u09a6\u09c7\u09b0 \u09ac\u09be\u09a6 \u09a6\u09c7\u09df\u09be\u0995\u09c7 \u09b0\u09be\u09b7\u09cd\u099f\u09cd\u09b0\u09ac\u09bf\u09b0\u09c7\u09be\u09a7\u09c0 \u09b7\u09dc\u09af\u09a8\u09cd\u09a4\u09cd\u09b0 \u09ac\u09b2\u099b\u09c7 \u09a8\u09bf\u099c\u09c7\u09a6\u09c7\u09b0\u0987 \u09b0\u09be\u09b7\u09cd\u099f\u09cd\u09b0 \u09ae\u09a8\u09c7 \u0995\u09b0\u09c7 \u09a8\u09be\u0995\u09bf ", + "output": [ + "Political" + ] + }, + { + "input": "\u09ae\u09cd\u09af\u09be\u09b6\u09c7\u09b0 \u0995\u09cd\u09af\u09be\u09aa\u099f\u09c7\u09a8\u09cd\u09b8\u09bf \u09a8\u09bf\u09df\u09c7 \u09af\u09be\u09a6\u09c7\u09b0 \u099a\u09c1\u09b2\u0995\u09be\u09a8\u09c0 \u09a4\u09be\u09b0\u09be \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0", + "output": [ + "Political" + ] + }, + { + "input": "\u09ae\u09be\u09b9\u09bf \u098f\u0995\u099f\u09be \u09ae\u09be\u0997\u09bf\u09b0 \u099a\u09c1\u09a6\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u0986\u09ae\u09bf \u0995\u09bf\u099b\u09c1 \u09ac\u09b2\u09ac\u09cb \u09a8\u09be \u09ac\u09b2\u09b2\u09c7\u0987 \u09a4\u09cb \u0986\u09ac\u09be\u09b0 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09b9\u09df\u09c7 \u09af\u09c7\u09a4\u09c7 \u09aa\u09be\u09b0\u09bf ", + "output": [ + "Political" + ] + }, + { + "input": " \u0986\u09ae\u09be\u09b0 \u09ae\u09a8\u09c7 \u09b9\u099a\u09cd\u099b\u09c7 \u09aa\u09c3\u09a5\u09bf\u09ac\u09c0\u099f\u09be \u0995\u099f\u09cd\u099f\u09b0 \u09b9\u09df\u09c7 \u09af\u09be\u099a\u09cd\u099b\u09c7 \u09ad\u09bf\u09a8\u09cd\u09a8\u09ae\u09a4 \u09ad\u09bf\u09a8\u09cd\u09a8 \u09a7\u09b0\u09cd\u09ae\u09c7\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7\u09c7\u09b0 \u0995\u09cb\u09a8 \u099c\u09be\u09df\u0997\u09be \u09a8\u09be\u0987 \u09ad\u09be\u09b0\u09a4 \u099a\u09c0\u09a8 \u09ab\u09cd\u09b0\u09be\u09a8\u09cd\u09b8\u09b8\u09b9 \u0985\u09a8\u09c7\u0995 \u09a6\u09c7\u09b6 \u09a4\u09be\u09b0 \u09aa\u09cd\u09b0\u09ae\u09be\u09a3 \u09b8\u09b0\u09cd\u09ac\u09b6\u09c7\u09b7 \u0986\u09ae\u09c7\u09b0\u09bf\u0995\u09be \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09af\u09a6\u09bf \u09b8\u09c1\u09b7\u09cd\u09a0\u09c1 \u09a8\u09bf\u09b0\u09cd\u09ac\u09be\u099a\u09a8 \u09b9\u09df \u0986\u09ae\u09be\u09b0 \u09ae\u09a8\u09c7 \u09b9\u09df \u0995\u099f\u09cd\u099f\u09b0 \u099c\u09be\u09ae\u09be\u09a4 \u09b6\u09bf\u09ac\u09bf\u09b0 \u0995\u09cd\u09b7\u09ae\u09a4\u09be\u09df \u0986\u09b8\u09ac\u09c7 \u0985\u09a5\u09ac\u09be \u0985\u09a8\u09cd\u09af\u0995\u09cb\u09a8 \u0995\u099f\u09cd\u099f\u09b0\u09aa\u09a8\u09cd\u09a5\u09c0 \u09a6\u09b2 \u09ae\u09c1\u0996\u09c7 \u09af\u09be\u0987 \u09ac\u09b2\u09c1\u0995 \u09ae\u09a8\u09c7 \u09ae\u09a8\u09c7 \u0985\u09a7\u09bf\u0995\u09be\u0982\u09b6\u0987 \u09b8\u09be\u09ae\u09cd\u09aa\u09cd\u09b0\u09a6\u09be\u09df\u09bf\u0995 \u0986\u09b0 \u09b8\u09c1\u09af\u09cb\u0997 \u09aa\u09c7\u09b2\u09c7\u0987 \u09a4\u09be\u09b0 \u09ac\u09b9\u09bf\u0983\u09aa\u09cd\u09b0\u0995\u09be\u09b6 \u0998\u099f\u09be\u09ac\u09c7 \u09aa\u09c3\u09a5\u09bf\u09ac\u09c0 \u099c\u09c1\u09dc\u09c7 \u09b8\u09be\u09ae\u09cd\u09aa\u09cd\u09b0\u09a6\u09be\u09df\u09bf\u0995 \u0989\u0997\u09cd\u09b0\u09aa\u09a8\u09cd\u09a5\u09c0 \u098f\u09ac\u0982 \u0989\u0997\u09cd\u09b0 \u099c\u09be\u09a4\u09c0\u09df\u09a4\u09be\u09ac\u09be\u09a6\u09c0 \u09b6\u0995\u09cd\u09a4\u09bf \u09ae\u09be\u09a5\u09be\u099a\u09be\u09dc\u09be \u09a6\u09bf\u09df\u09c7 \u0989\u09a0\u099b\u09c7 \u098f\u0997\u09c1\u09b2\u09cb \u0986\u09b8\u09b2\u09c7 \u0995\u09bf\u09b8\u09c7\u09b0 \u09b2\u0995\u09cd\u09b7\u09a3 \u09a4\u09a5\u09be\u0995\u09a5\u09bf\u09a4 \u09b8\u09ad\u09cd\u09af \u099c\u09be\u09a4\u09bf \u0986\u09ae\u09c7\u09b0\u09bf\u0995\u09be\u09a8 \u09ac\u09cd\u09b0\u09bf\u099f\u09bf\u09b6\u09b0\u09be\u0993 \u09a4\u09be\u09b0 \u09ac\u09cd\u09af\u09a4\u09bf\u0995\u09cd\u09b0\u09ae \u09a8\u09df \u09aa\u09cd\u09b0\u09ae\u09be\u09a3\u09bf ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09a6\u09c7\u09b0 \u098f\u0995 \u09ab\u09cb\u099f\u09be \u099c\u09b2 \u09a6\u09c7\u0993\u09df\u09be \u09af\u09be\u09ac\u09c7 \u09a8\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u09ae\u09be\u09b9\u09bf \u0993 \u09ac\u09bf \u099a\u09cc\u09a7\u09c1\u09b0\u09c0 \u0995\u09be\u09a6\u09be\u09aa\u09be\u09a8\u09bf\u09a4\u09c7 \u0986\u099f\u0995\u09c7 \u0997\u09c7\u099b\u09c7\u09a8 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09a4\u09be\u09b0\u09c7\u0995\u09c7\u09b0 \u09ae\u09cb\u0996\u09c7\u09b0 \u09ad\u09be\u09b7\u09be \u09a0\u09bf\u0995 \u09a8\u09be\u0987 \u098f\u0995\u099f\u09be \u09b8\u09a8\u09cd\u09a4\u09cd\u09b0\u09be\u09b8\u09c0\u09b0 \u0996\u09c1\u09a8\u09bf\u09b0 \u099a\u09be\u0981\u09a6\u09be \u09ac\u09be\u099c \u09a6\u09c7\u09b0 \u0997\u099f\u09aa\u09be\u09a6\u09be\u09b0 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09a8\u09bf\u09b0\u09cd\u09ac\u09be\u099a\u09a8 \u0995\u09ae\u09bf\u09b6\u09a8 \u09a4\u09cb \u09a8\u09bf\u099c\u09c7\u09b0\u09be\u0987 \u09ac\u09bf\u09ad\u0995\u09cd\u09a4 \u09b9\u09df\u09c7 \u09aa\u09dc\u09c7\u099b\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": " \u09b8\u09ae\u09df \u098f\u0995\u09a6\u09bf\u09a8 \u0986\u09b8\u09ac\u09c7 \u0985\u09aa\u09c7\u0995\u09cd\u09b7\u09be\u09df \u0986\u099b\u09c7 \u09aa\u09c1\u09b0\u09cb \u099c\u09be\u09a4\u09bf \u09ac\u09be\u0982\u09b2\u09be\u09b0 \u099c\u09ae\u09c0\u09a8\u09c7 \u098f\u0995\u09a6\u09bf\u09a8 \u09b8\u09a4\u09cd\u09af\u09bf\u0995\u09be\u09b0\u09c7\u09b0 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09a6\u09c7\u09b0 \u09ac\u09bf\u099a\u09be\u09b0 \u09b9\u09ac\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0 \u09a8\u09be \u09aa\u09c7\u09b2\u09c7 \u09af\u09be\u09b0\u09be \u09a4\u09be\u09a6\u09c7\u09b0 \u0989\u09a4\u09cd\u09a4\u09b0\u09b8\u09c2\u09b0\u09bf \u09a5\u09be\u0995\u09ac\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0\u0995\u09c7 \u09ac\u09bf\u099a\u09be\u09b0 \u0995\u09b0\u09be \u09b9\u09ac\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": " \u09a4\u09be\u09b0\u09c7\u0995 \u099c\u09bf\u09df\u09be\u09b0 \u099c\u09a8\u09cd\u09ae\u09a6\u09bf\u09a8 \u0989\u09aa\u09b2\u0995\u09cd\u09b7\u09c7 \u09aa\u09cb\u09b7\u09cd\u099f\u09c7 \u0995\u09bf\u099b\u09c1 \u09b2\u09cb\u0995 \u09af\u09be\u09b0\u09be \u0986\u09b8\u09b2\u09c7 \u09a6\u09b2\u0995\u09be\u09a8\u09be \u09a4\u09be\u09b0\u09be \u09af\u09c7\u09ad\u09be\u09b7\u09be\u09df \u09ae\u09a8\u09cd\u09a4\u09ac\u09cd\u09af \u09a6\u09bf\u099a\u09cd\u099b\u09c7 \u09a4\u09be\u09a4\u09c7 \u09ac\u09c1\u099d\u09be \u09af\u09be\u09df \u098f\u09b8\u0995\u09b2 \u09b2\u09cb\u0995 \u09b9\u09df \u0986\u0993\u09df\u09be\u09ae\u09c0 \u0998\u09b0\u09a8\u09be\u09b0 \u09a8\u09be \u09b9\u09df \u0986\u09ac\u09be\u09b2 \u0995\u09be\u09b0\u09a8 \u098f\u0995\u099c\u09a8 \u09b2\u09cb\u0995 \u0995\u09c7 \u099a\u09cb\u09b0 \u09ac\u09b2\u09a4\u09c7 \u09b9\u09b2\u09c7 \u09aa\u09cd\u09b0\u09ae\u09be\u09a8 \u09aa\u09cd\u09b0\u09cb\u09df\u099c\u09a8 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u098f\u09b0\u09be\u0995\u09cb\u09a8 \u09aa\u09cd\u09b0\u09ae\u09be\u09a8 \u099b\u09be\u09b0\u09be\u0987 \u09af\u09be \u09ae\u09a8\u09c7\u09b9\u09df \u09ac\u09b2\u09c7 \u09af\u09be\u09df \u09a4\u09be\u09b0\u09c7\u0995 \u09af\u09a6\u09bf \u099a\u09cb\u09b0 \u09b9\u09a4 \u09a4\u09be\u09b9\u09b2\u09c7 \u098f\u0987 \u0986\u0993\u09df\u09be\u09ae\u09c0 \u09b8\u09b0\u0995\u09be\u09b0 \u098f\u09a4 \u09a6\u09bf\u09a8\u09c7 \u09a4\u09be\u0995\u09c7 \u09ab\u09be\u09b8\u09c0 \u09a8\u09be\u09a6\u09c0\u09b2\u0993 \u0995\u09ae\u0995\u09b0\u09c7 \u09ac\u099b\u09b0 \u098f\u09b0 \u09b8\u09be\u099c\u09be \u09a6\u09c0\u09df\u09c7 \u099b\u09c7\u09b0\u09c7 \u09a6\u09bf\u09a4 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b6\u09be\u09b2\u09be \u09ae\u09be\u09a6\u09be\u09b0 \u099a\u09cb\u09a6 \u0996\u09be\u09a8\u09cd\u0995\u09bf\u09b0 \u099b\u09c7\u09b2\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": " \u09b8\u09b0\u0995\u09be\u09b0\u09b0\u09c7 \u0986\u09b8\u09b2\u09c7 \u09ac\u09b2\u09a6\u09c7 \u099a\u09c1\u09a6\u09c7 \u09a4\u09be\u0987 \u098f\u09ae\u09a8 \u0986\u0995\u09be\u09ae \u0995\u09c1 \u0995\u09be\u09ae \u09b6\u09c1\u09b0\u09c1 \u0995\u09b0\u099b\u09c7 \u098f\u09a4\u09cb\u09a6\u09bf\u09a8 \u09b6\u09c1\u09a8\u09b2\u09be\u09ae \u09a8\u09be \u09a4\u09be\u09b0 \u09a8\u09be\u09ae \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7 \u0986\u099b\u09c7 \u098f\u0996\u09a8 \u09ac\u09c7\u099f\u09be \u09ae\u09be\u09a4\u09cd\u09b0 \u09ac\u09b8\u09b2\u09cb \u099a\u09c7\u09df\u09be\u09b0\u09c7 \u0986\u09b0 \u09b6\u09c1\u09b0\u09c1 \u09b9\u09b2\u09cb \u09a4\u09a6\u09a8\u09cd\u09a4 ", + "output": [ + "Political" + ] + }, + { + "input": "\u098f\u0987 \u09b8\u09a4\u09cd\u09af \u0995\u09a5\u09be \u09ac\u09b2\u09be\u09b0 \u0995\u09be\u09b0\u09a3\u09c7 \u0986\u09aa\u09a8\u09be\u0995\u09c7 \u0986\u0993\u09df\u09be\u09ae\u09c0\u09b2\u09c0\u0997 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09ac\u09b2\u09b2\u09c7 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u0995\u09bf\u099b\u09c1\u0987 \u0995\u09b0\u09be\u09b0 \u09a8\u09c7\u0987 \u09b8\u09cd\u09af\u09be\u09b0", + "output": [ + "Political" + ] + }, + { + "input": "\u09b8\u09cd\u09ac\u09be\u09a7\u09c0\u09a8\u09a4\u09be\u09b0 \u0998\u09cb\u09b6\u09a8\u09be \u0995\u09c7 \u09a6\u09bf\u09df\u09c7\u099b\u09bf\u09b2\u09cb \u09a4\u09cb\u09b0 \u09ac\u09be\u09aa \u09a4\u09be\u09b9\u09b2\u09c7 \u09a4\u09c1\u0987\u09a4\u09cb \u09a4\u09cb\u09b0 \u09ac\u09be\u09aa\u09c7\u09b0 \u09b8\u09cd\u09a4\u09be\u09a8 \u09a8\u09be \u09b0\u09c7 \u09b8\u09be\u09b2\u09be", + "output": [ + "Political" + ] + }, + { + "input": "\u0985\u09cd\u09af\u09be\u099f\u09a8\u09bf \u099c\u09c7\u09a8\u09be\u09b0\u09c7\u09b2 \u09aa\u09a6\u09a4\u09cd\u09af\u09be\u0997 \u0995\u09b0\u09b2\u09c7 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09a6\u09c7\u09b0 \u09ab\u09be\u09b8\u09bf \u09a6\u09c7\u09ac\u09c7 \u0995\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": " \u09ac\u09be\u0982\u09b2\u09a6\u09c7\u09b6\u09c7 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09a6\u09c7\u09b0 \u09b8\u09ac \u0995\u09bf\u099b\u09c1 \u0997\u09c1\u0981\u09dc\u09bf\u09df\u09c7 \u09a8\u09bf\u099a\u09bf\u09b9\u09cd\u09a8 \u0995\u09b0\u09c7 \u09a6\u09c7\u09b6\u0995\u09c7 \u0985\u09ad\u09bf\u09b8\u09be\u09ab \u09ae\u09c1\u0995\u09cd\u09a4 \u0995\u09b0\u09be \u098f\u0996\u09a8 \u09b8\u09ae\u09df\u09c7\u09b0 \u09a6\u09be\u09ac\u09bf ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b8\u09c7\u0993 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0 \u0995\u09ae\u09be\u09a8\u09cd\u09a1\u09be\u09b0 \u098f\u099f\u09be\u0987 \u098f\u0996\u09a8 \u099b\u09b2\u099b\u09c7 \u0995\u09bf\u099b\u09c1\u0987 \u0995\u09b0\u09be\u09b0 \u09a8\u09c7\u0987 \u09ac\u09bf\u099a\u09be\u09b0\u09c7\u09b0 \u09ae\u09be\u09b2\u09bf\u0995", + "output": [ + "Political" + ] + }, + { + "input": " \u09b9\u09bf\u09b2\u09be\u09b0\u09c0\u09b0 \u09b8\u09be\u09a5\u09c7 \u099c\u09be\u09ae\u09be\u09a4 \u09b6\u09bf\u09ac\u09bf\u09b0\u09c7\u09b0 \u0995\u09bf \u09b8\u09ae\u09aa\u09b0\u0995 ", + "output": [ + "Political" + ] + }, + { + "input": "\u099c\u09be\u09ae\u09be\u09a4 \u0995\u09bf \u09a4\u09cb\u09b0 \u09ae\u09be \u09ac\u09cb\u09a8\u09b0\u09c7 \u099a\u09c1\u09a6\u099b\u09c7 \u09ae\u09be\u09a6\u09be\u09b0 \u099a\u09cb\u09a6 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b6\u09be\u09b2\u09be \u09b6\u09c1\u09af\u09bc\u09cb\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0 \u0985\u09ac\u09b8\u09cd\u09a5\u09be \u09a6\u09c7\u0996 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09c1\u09a4 \u099c\u09be\u09b0\u099c \u09b8\u09a8\u09cd\u09a4\u09be\u09a8 \u09a4\u09b0 \u09ae\u09be \u09a7\u09b0\u09cd\u09b7\u09bf\u09a4\u09be \u0993 \u09ae\u09c2\u09b0\u09cd\u0996 \u09a4\u09c1\u0987 \u0993 \u09ae\u09c2\u09b0\u09cd\u0996 \u09ac\u09c7\u09af\u09bc\u09be\u09a6\u09ac\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09ac\u09c7\u09af\u09bc\u09be\u09a6\u09ac ", + "output": [ + "Political" + ] + }, + { + "input": "\u09aa\u09be\u09b0\u09cd\u09a5 \u09b0\u09b9\u09ae\u09be\u09a8 \u09aa\u09c1\u09b0\u09cb\u09aa\u09c1\u09b0\u09bf \u09ac\u09bf \u098f\u09a8 \u09aa\u09bf\u09b0 \u09a6\u09be\u09b2\u09be\u09b2 \u09b9\u09df\u09c7 \u0997\u09bf\u09df\u09be\u099b\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09a6\u09c7\u09b0 \u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0 \u09ac\u09be\u09a8\u09be\u09a8\u09cb\u09b0 \u09a6\u09be\u09df\u09c7 \u09a4\u09be\u09b0 \u0986\u09b0\u0993 \u0995\u09a0\u09bf\u09a8 \u09ac\u09bf\u099a\u09be\u09b0 \u09ac\u09be\u0995\u09bf \u0986\u099b\u09c7", + "output": [ + "Political" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u09b6\u09be\u09b2\u09be \u0986\u0993\u09df\u09be\u09ae\u09c0\u09b2\u09c0\u0997 \u09a6\u09be\u09b2\u09be\u09b2 ", + "output": [ + "Political" + ] + }, + { + "input": " \u09a6\u09c7\u09b6\u09c7 \u098f\u0996\u09a8 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0 \u09a0\u09be\u0981\u0987 \u09a8\u09be\u0987 \u09a4\u09be\u0987 \u09a8\u09bf\u09b0\u09cd\u09ac\u09be\u099a\u09a8 \u0995\u09b0\u09b2\u09c7 \u09ad\u09cb\u099f \u0993 \u09aa\u09be\u09ac\u09c7 \u09a8\u09be \u0990\u099a\u09cb\u09b0\u09c7\u09b0 \u09ae\u09be \u0996\u09be\u09b2\u09c7\u09a6\u09be ", + "output": [ + "Political" + ] + }, + { + "input": "\u09ae\u09be\u09b9\u09c0 \u09a4\u09c1\u0987 \u09ae\u09be\u0997\u09c0\u09b0 \u099b\u09c7\u09b2\u09c7 \u099c\u09be\u09b0\u099c ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b8\u09bf\u0987\u09b8\u09bf\u09b0 \u098f\u0996\u09a4\u09bf\u09df\u09be\u09b0\u099f\u09be \u0995\u09c0 \u0986\u0993\u09df\u09be\u09ae\u09c0 \u09b2\u09c0\u0997\u0995\u09c7 \u0995\u09cd\u09b7\u09ae\u09a4\u09be\u09df \u09ac\u09b8\u09bf\u09df\u09c7 \u09a6\u09c7\u0993\u09df\u09be \u09a4\u09be\u0981\u09b0 (\u09b8\u09bf\u0987\u09b8\u09bf) \u098f\u0996\u09a4\u09bf\u09df\u09be\u09b0 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u09a4\u09cb \u098f\u0995\u099f\u09be \u09a6\u09c7\u09b6\u09c7\u09b0 \u0995\u09c1\u09b2\u0999\u09cd\u0997\u09be\u09b0 \u0986\u09b0 \u09af\u09be\u09b0\u09c7 \u09a8\u09bf\u09af\u09bc\u09c7 \u09a4\u09c1\u0987 \u0995\u09a5\u09be \u09ac\u09b2\u099b\u09bf\u09b8 \u09b8\u09c7 \u09a4\u09be\u09b0 \u09ac\u09be\u09aa\u09c7\u09b0 \u0993 \u09ac\u09be\u09aa ", + "output": [ + "Political" + ] + }, + { + "input": "\u098f\u09b0 \u09b9\u09b2\u09c7\u09be \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u0986\u09b2 \u09ac\u09a6\u09b0 \u09ac\u09be\u09b9\u09bf\u09a8\u09c0 \u09ae\u09c1\u0996\u09c7\u09b0 \u09b2\u09be\u0997\u09be\u09ae \u09a8\u09be\u0987", + "output": [ + "Political" + ] + }, + { + "input": " \u09b8\u09be\u09b2\u09be \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b2\u09c0\u0997\u09c7\u09b0 \u09a6\u09be\u09b2\u09be\u09b2 \u09b8\u09ae\u09df\u09c7\u09b0 \u0995\u09a8\u09cd\u09a0\u09b8\u09b0 ", + "output": [ + "Political" + ] + }, + { + "input": " \u0986\u09ae\u09be\u09b0 \u09a8\u09df \u098f\u09ac\u09be\u09b0 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09b8\u09ae\u09df \u0995\u09be\u099b\u09c7 \u098f\u09b8\u09c7 \u09aa\u09dc\u09c7\u099b\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7 \u09af\u09be\u0993\u09df\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u09b0\u09c7\u09a1\u09bf \u09b9\u09df\u09c7 \u09af\u09be \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u0995\u09be\u0982\u0995\u09bf \u09b9\u09be\u09b8\u09bf\u09a8\u09be\u0995\u09c7 \u09ac\u09b2\u09c7\u09a6\u09bf\u099b \u09af\u09c7\u09a8 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b2\u09c0\u0997\u09c7\u09b0 \u09a6\u09be\u09b2\u09be\u09b2\u09a6\u09c7\u09b0 \u0995\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09a5\u09c7\u0995\u09c7 \u09b8\u09be\u09a5\u09c7 \u0995\u09b0\u09c7 \u09a8\u09bf\u09df\u09c7 \u09af\u09be\u09df ", + "output": [ + "Political" + ] + }, + { + "input": " \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09b8\u09b0\u0995\u09be\u09b0\u09c7\u09b0 \u0995\u09be\u099b\u09c7 \u0986\u09ae\u09be\u09b0 \u098f\u0995\u099f\u09be \u09aa\u09cd\u09b0\u09b6\u09cd\u09a8 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u0995\u09c7\u0987 \u099c\u09be\u09ae\u09be\u09a4\u09c7\u09b0 \u0986\u09ae\u09bf\u09b0 \u09b9\u09b2\u09c7\u0987 \u0995\u09c0\u09b8\u09c7\u0987 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u09a4\u09be\u09b9\u09b2\u09c7 \u09b6\u09c1\u09a8\u09c7 \u09b0\u09be\u0996\u09c1\u09a8 \u098f\u09b0 \u09aa\u09b0\u09bf\u09a8\u09bf\u09a4\u09bf \u09ac\u09be\u09b2\u09cb \u09b9\u09ac\u09c7\u09a8\u09be \u0986\u09ae\u09be\u09b0 \u0986\u09b0\u0993 \u098f\u0995\u099f\u09be \u09aa\u09cd\u09b0\u09b6\u09cd\u09a8 \u098f\u0996\u09a8 \u09af\u09a6\u09bf \u09b8\u09be\u09b2\u09c7 \u099c\u09a8\u09cd\u09ae\u0997\u09b9\u09a8 \u0995\u09be\u09b0\u09bf \u0995\u09c7\u0987 \u099c\u09be\u09ae\u09be\u09a4\u09c7\u09b0 \u0986\u09ae\u09bf\u09b0 \u09b9\u09df \u09a4\u09be\u09b9\u09b2\u09c7\u0993 \u0995\u09bf \u09b8\u09c7\u0993 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 ", + "output": [ + "Political" + ] + }, + { + "input": " \u09af\u09be\u09b0 \u0997\u09b0\u09c7 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09c7\u09b0 \u09ac\u09b8\u09ac\u09be\u09b8 \u09b8\u09c7\u0987\u09af\u09c7 \u0995\u09bf\u09a8\u09be \u09ac\u09b2\u09c7\u09ad\u09a8\u09cd\u09a1 \u09b2\u09c0\u0997 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09ae\u09c1\u0996\u09c7 \u09a4\u09cb \u0997\u09be\u09b2\u09be\u0997\u09be\u09b2\u09bf \u099b\u09be\u09a1\u09bc\u09be \u0995\u09bf\u099b\u09c1 \u0987 \u09a8\u09c7\u0987 \u0986\u09ae\u09be\u09b0 \u0995\u09ae\u09c7\u09a8\u09cd\u099f\u09b8 \u099f\u09be \u0986\u09b0 \u098f\u0995\u09ac\u09be\u09b0 \u09aa\u09dc\u09cd \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u0995\u09c7 \u09a4\u09cb \u09ae\u09be\u09a8\u09bf\u09b8\u09cd \u09a8\u09be \u099c\u09be\u09a4\u09c0\u09af\u09bc \u09b8\u0982\u0997\u09c0\u09a4 \u0995\u09b0\u09bf\u09b8\u09cd \u09a8\u09be \u0986\u09b0 \u09b2\u09c7\u0996\u09be\u09aa\u09a1\u09bc\u09be \u09a4\u09cb \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09b6\u09bf\u0995\u09cd\u09b7\u09be \u09ac\u09cd\u09af\u09ac\u09b8\u09cd\u09a5\u09be \u09df \u0995\u09b0\u09bf\u09b8\u09cd \u09a8\u09bf \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0 \u0995\u09cb\u09a5\u09be\u0995\u09be\u09b0 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b6\u09a4 \u099a\u09c7\u09b7\u09cd\u099f\u09be \u0995\u09b0\u09c7 \u09a4\u09c1\u09ae\u09bf \u09ac\u09cd\u09af\u09be\u0982\u0995 \u09a1\u09be\u0995\u09be\u09a4 \u09b9\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09c7 \u09a4\u09ac\u09c7 \u09a4\u09be\u09b0\u09c7\u0995 \u099c\u09bf\u09df\u09be \u09b9\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09c7 \u09a8\u09be ", + "output": [ + "Political" + ] + }, + { + "input": " \u09b6\u09bf\u09ac\u09bf\u09b0 \u09b6\u09c7\u09b7 \u098f\u09ac\u09be\u09b0 \u09b2\u09c0\u0997\u09c7\u09b0 \u09aa\u09be\u09b2\u09be \u09b6\u09c1\u09b0\u09c1 ", + "output": [ + "Political" + ] + }, + { + "input": " \u09a4\u09be\u09b9\u09b2\u09c7 \u09ae\u09a8\u09c7 \u09b9\u09df \u09b6\u09bf\u09ac\u09bf\u09b0 \u09b9\u09ac\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09ae\u09be\u09b9\u09bf\u09b0 \u09ae\u09a4\u09cb \u0997\u09be\u09a6\u09be \u09a8\u09be \u09a5\u09be\u0995\u09b2\u09c7 \u0990\u0995\u09cd\u09af\u09c7\u09b0 \u0995\u09cb\u09a8 \u09b8\u09ae\u09b8\u09cd\u09af\u09be \u09b9\u09ac\u09c7 \u09a8\u09be ", + "output": [ + "Political" + ] + }, + { + "input": " \u098f\u09b0 \u09aa\u09bf\u099b\u09a8\u09c7 \u09a8\u09bf\u09b6\u09cd\u099a\u09df \u099c\u09be\u09ae\u09be\u09a4 \u09b6\u09bf\u09ac\u09bf\u09b0 \u099c\u09dc\u09bf\u09a4 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09a6\u09be\u09b2\u09be\u09b2 \u0995\u09c7\u09be\u09a5\u09be\u0995\u09be\u09b0 \u09a4\u09b0 \u09af \u09a6\u09bf \u09b2\u099c\u09cd\u099c\u09be \u09a5\u09be \u0995\u09c7 \u0990\u0995\u09cd\u09af\u09c7\u09b0 \u09ac\u09c7\u09aa\u09be \u09b0\u09c7 \u098f\u0995\u099f\u09be \u0995\u09a5\u09be \u09ac\u09b2 \u09ac\u09bf \u09a8\u09be ", + "output": [ + "Political" + ] + }, + { + "input": " \u09a4\u09be\u09a6\u09c7\u09b0 \u0995\u09c7 \u09b8\u09be\u09ae\u09df\u09bf\u0995 \u0986\u09b6\u09cd\u09b0\u09df \u09b6\u09bf\u09ac\u09bf\u09b0\u09c7 \u09b0\u09be\u0996\u09be \u09b9\u09cb\u0995 \u09b8\u09be\u09a5\u09c7 \u09b8\u09be\u09a5\u09c7 \u09ae\u09bf\u09df\u09be\u09a8\u09ae\u09be\u09b0 \u09b8\u09b0\u0995\u09be\u09b0 \u0995\u09c7 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u0997\u09a3\u09b9\u09a4\u09cd\u09af\u09be \u09ac\u09a8\u09cd\u09a7\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u0986\u09a8\u09cd\u09a4\u09b0\u09cd\u099c\u09be\u09a4\u09bf\u0995 \u09ad\u09be\u09ac\u09c7 \u099a\u09be\u09aa \u09aa\u09cd\u09b0\u09df\u09cb\u0997 \u0995\u09b0\u09be \u09b9\u09cb\u0995 \u09a4\u09ac\u09c7\u0987 \u09a4\u09be\u09b0\u09be \u09b8\u09cd\u09ac\u09a6\u09c7\u09b6\u09c7 \u09aa\u09cd\u09b0\u09a4\u09cd\u09af\u09be\u09ac\u09b0\u09cd\u09a4\u09a8 \u0995\u09b0\u09be\u09b0 \u09aa\u09a5 \u09a6\u09cd\u09b0\u09c1\u09a4 \u09b8\u09c1\u0997\u09ae \u09b9\u09ac\u09c7 \u09b6\u09be\u09a8\u09cd\u09a4\u09bf \u09aa\u09cd\u09b0\u09a4\u09bf\u09b7\u09cd\u09a0\u09be \u09b8\u09b9\u099c \u09b9\u09ac\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u0989\u09aa\u09b0 \u09a4\u09be\u09b0\u09be \u09ac\u09cb\u099d\u09be \u09b9\u09ac\u09c7 \u09a8\u09be \u098f\u09a4\u09cb \u0997\u09c7\u09b2 \u09b8\u09cd\u09ac\u09b2\u09cd\u09aa \u09ae\u09c7\u09df\u09be\u09a6\u09c0 \u09aa\u09a6\u0995\u09cd\u09b7\u09c7\u09aa \u09a6\u09cd\u09ac\u09c0\u09b0\u09cd\u0997 \u09ae\u09c7\u09df\u09be\u09a6\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0 \u0995\u09c7 \u09aa\u09be\u09b9\u09be\u09dc\u09c0 \u099c\u09c1\u09ae \u09b2\u09cd\u09af\u09be\u09a8\u09cd\u09a1\u09c7 \u099a\u09be\u09b7\u09be\u09ac\u09be\u09a6 \u0995\u09b0\u09c7 \u0996\u09be\u0993\u09df\u09be\u09b0 \u0985\u09a8\u09c1\u09ae\u09a4\u09bf \u09a6\u09c7\u0993\u09df\u09be \u09af\u09c7\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 \u09a4\u09ac\u09c7 \u09b8\u09b0\u09cd\u09ac\u09be\u09ac\u09b8\u09cd\u09a5\u09be\u09df \u09a4\u09be\u09b0\u09be \u09af\u09c7 \u0985\u09b8\u09cd\u09a5\u09be\u09df\u09c0 \u09ac\u09bf\u09b7\u09df \u099f\u09be \u09b8\u09cd\u09ac\u0995\u09cd\u09b0\u09c0\u09df \u09ac\u09bf\u09ac\u09c7\u099a\u09a8\u09be\u09df \u09a8\u09bf\u09a4\u09c7 \u09b9\u09ac\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09b6\u09bf\u09ac\u09bf\u09b0 \u09ac\u09be \u099b\u09be\u09a4\u09cd\u09b0\u09a6\u09b2 \u09b9\u09b2\u09c7 \u09b6\u09bf\u09ac\u09bf\u09b0 \u09b8\u09a8\u09cd\u09a4\u09cd\u09b0\u09be\u09b8\u09c0 \u09ac\u09b2\u09c7 \u09b9\u09c7\u09a1\u09bf\u0982 \u09b9\u09a4\u09cb ", + "output": [ + "Political" + ] + }, + { + "input": "\u098f\u0995\u099c\u09a8 \u09ae\u09c7\u09ae\u09cd\u09ac\u09be\u09b0\u09c7\u09b0 \u09af\u09cb\u0997\u09cd\u09af\u09a4\u09be \u09af\u09be\u09b0 \u09a8\u09be\u0987 \u0985\u09a5\u099a \u0995\u09a4\u09cd\u09a5\u09be \u09ac\u09b2\u09c7 \u0987\u099a\u09b0\u09c7 \u09aa\u09be\u0995\u09be\u09b0 \u09ae\u09a4\u09cb ", + "output": [ + "Political" + ] + }, + { + "input": " \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09b0\u09cb\u09b9\u09bf\u0982\u0997\u09be\u09b0 \u09b8\u0982\u0996\u09be \u0995\u09a4 \u0986\u09b6\u09cd\u09b0\u09df \u09b6\u09bf\u09ac\u09bf\u09b0\u09c7 \u09ac\u09c8\u09a7 \u09aa\u09cd\u09b0\u09be\u09df \u09b9\u09be\u099c\u09be\u09b0 \u09a6\u09c7\u09b6 \u09b8\u09cd\u09ac\u09be\u09a7\u09bf\u09a8\u09a4\u09be\u09b0 \u09aa\u09b0 \u09a5\u09c7\u0995\u09c7 \u0985\u09ac\u09c8\u09a7 \u09aa\u09cd\u09b0\u09be\u09df \u09b2\u09be\u0996 \u09b0\u09cb\u09b9\u09bf\u0982\u0997\u09be \u09a5\u09be\u0995\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09a4\u09a5\u09cd\u09af \u09b8\u0982\u0997\u09c3\u09b9\u09bf\u09a4\u09cb ", + "output": [ + "Political" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u09a4\u09be\u09b0\u09c7\u0995 \u09ac\u09be\u0982\u09b2\u09be\u09df \u0986\u09df \u09a4\u09cb\u09b0 \u09a6\u09b2\u09c7\u09b0 \u09b2\u09cb\u0995 \u09b0\u09be\u0987 \u09a4\u09cb\u09b0\u09c7 \u09aa\u09be\u09df\u09be\u09b0 \u0987\u09b8\u0995\u099f\u09c7 \u09a6\u09bf\u09ac\u09c7 ", + "output": [ + "Political" + ] + }, + { + "input": "\u09a4\u09be\u09b0\u09c7\u0995 \u099a\u09cb\u09b0\u09be\u0995\u09c7 \u09a6\u09c7\u09b6\u09c7 \u09ab\u09bf\u09b0\u09be\u09a8\u09cb\u09b0 \u09ae\u09a4 \u099c\u09cb\u09a1\u09bc \u098f\u0996\u09a8 \u09b8\u09cd\u09ac\u09be\u09a7\u09c0\u09a8\u09a4\u09be \u09ac\u09bf\u09b0\u09cb\u09a7\u09c0 \u09b0\u09be\u099c\u09be\u0995\u09be\u09b0\u09a6\u09c7\u09b0 \u0986\u099b\u09c7 \u09ac\u09b2\u09c7\u09a4\u09cb \u09ae\u09a8\u09c7 \u09b9\u09df \u09a8\u09be \u0995\u09be\u09b0\u09a3 \u09a6\u09c7\u09b6\u09c7\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7\u09c7\u09b0 \u0995\u09be\u099b\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0 \u09ae\u09c1\u0996\u09cb\u09b6\u09a4\u09cb \u0996\u09c1\u09b2\u09c7 \u0997\u09c7\u099b\u09c7 \u09af\u09c7 \u09a4\u09be\u09b0 \u09ac\u09be\u09aa \u099b\u09bf\u09b2 \u09aa\u09be\u0995\u09bf\u09a6\u09c7\u09b0 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c0 \u098f\u099c\u09c7\u09a8\u09cd\u099f", + "output": [ + "Political" + ] + }, + { + "input": "\u098f \u09ae\u09be\u0997\u09bf\u09b0 \u09aa\u09c1\u09b2\u09be \u09a4\u09c1\u0987 \u099a\u09c1\u09b0 \u0995\u09bf\u09b8\u09c7\u09b0 \u09a6\u09c7\u09b6 \u09a8\u09be\u09df\u0995 \u09a4\u09c1\u09b0 \u09ae\u09be\u09b0\u09c7 \u099a\u09c1\u09a6\u09b2 \u09aa\u09be\u0995\u09bf\u099b\u09a4\u09be\u09a8\u09bf\u09b0\u09be \u09a4\u09c1\u0987\u0986\u09ac\u09be\u09b0 \u09ac\u09dc \u09ac\u09dc \u0995\u09a5\u09be \u09ac\u09b2\u09bf\u09b8", + "output": [ + "Political" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09be\u0989\u09a8\u09b0\u09be \u09a4\u09cb \u09b8\u09be\u09a8\u09bf \u09b2\u09bf\u0993\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be", + "output": [ + "Religious" + ] + }, + { + "input": "\u09b6\u09be\u09b2\u09be \u09a4\u09c1\u0987 \u0995\u099f\u09cd\u099f\u09b0\u09aa\u09a8\u09cd\u09a5\u09c0 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1", + "output": [ + "Religious" + ] + }, + { + "input": " \u098f\u09a6\u09c7\u09b6 \u0986\u0993\u09df\u09be\u09ae\u09c0 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09a6\u09c7\u09b0 \u09a6\u0996\u09b2\u09c7 \u098f\u09a6\u09c7\u09b6 \u09aa\u09b0\u09be\u09a7\u09c0\u09a8 \u09b9\u09a4\u09c7 \u0986\u09b0 \u09ac\u09c7\u09b6\u09bf \u09a6\u09c7\u09b0\u09bf \u09a8\u09be\u0987 \u09af\u09be\u09b0\u09be \u098f\u0996\u09a8\u09cb \u09ac\u09c1\u099d \u09a8\u09be\u0987 \u09a4\u09be\u09b0\u09be\u0993 \u09ac\u09c1\u099d\u09ac\u09c7 \u0996\u09c1\u09ac \u09a4\u09be\u09b0\u09be \u09a4\u09be\u09b0\u09bf \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u09b9\u0987\u09df\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09a8\u09bf\u09b0\u09cd\u09ac\u09be\u099a\u09a8 \u0995\u09b0 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7 \u09aa\u0995\u09cd\u09b7\u09c7 \u099c\u09c0\u09ac\u09a8 \u0989\u09ce\u09b8\u09b0\u09cd\u0997 \u0995\u09b0 \u0986\u0993\u09df\u09be\u09ae\u09c0\u09b2\u09c0\u0997 \u09a4\u09cb\u09ae\u0997\u09b0\u09c7 \u0997\u09cb\u09b2\u09be\u09ae \u09ac\u09be\u09a8\u09be\u0987\u09df\u09be \u099b\u09be\u09dc\u09ac\u09c7 \u09a6\u09c7\u0996\u09c7 \u09a8\u09bf\u0993 \u09ac\u09b2\u09c7 \u0997\u09c7\u09b2\u09be\u09ae ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a8\u09bf\u099a\u09c7 \u099c\u09be\u09b0\u099c \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09b0 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09a6\u09c7\u09b0 \u0995\u09ae\u09c7\u09a8\u09cd\u099f \u09a6\u09c7\u0996\u09c7 \u0996\u09c1\u09ac \u09b9\u09be\u09b8\u09bf \u09aa\u09be\u099a\u09cd\u099b\u09c7 \u0995\u09bf\u099b\u09c1 \u09a8\u09be \u09aa\u09be\u0987\u09b0\u09be \u09b8\u09be\u0982\u09ac\u09be\u09a6\u09bf\u0995\u09a6\u09c7\u09b0 \u09ac\u0995\u099b\u09c7 \u0990 \u09ae\u09be\u09a6\u09be\u09b0\u099a\u09cb\u09a6 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09be \u09b8\u09be\u0982\u09ac\u09be\u09a6\u09bf\u0995 \u09a6\u09c7\u09b0 \u0995\u09be\u099c \u09a8\u09bf\u0989\u099c \u0995\u09b0\u09be \u09ae\u09be\u09b2\u09c1\u09a6\u09c7\u09b0 \u09b6\u09b0\u09c0\u09b0 \u099c\u09b2\u09c7 \u0995\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ec\u09e6-\u09ed\u09e6 \u09ac\u099b\u09b0\u09c7\u09b0 \u09ae\u09be\u09a8\u09b8\u09bf\u0995 \u09ac\u09bf\u0995\u09be\u09b0\u0997\u09cd\u09b0\u09b8\u09cd\u09a4 \u09a7\u09b0\u09cd\u09b7\u0995 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09b0\u09be \u09ec-\u09ed \u09ac\u099b\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09ae\u09c7\u09df\u09c7\u09a6\u09c7\u09b0 \u09ac\u09bf\u099b\u09be\u09a8\u09be\u09df \u09a8\u09bf\u09a4\u09c7 \u09aa\u09be\u0997\u09b2 \u09b9\u09df\u09c7 \u09a5\u09be\u0995\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09b8\u09be\u09a8\u09bf \u09a4\u09c1\u09ae\u09bf\u09a4\u09cb \u09ac\u09b2\u09b2\u09c7 \u0995\u09cb\u09a8 \u09a7\u09b0\u09cd\u09ae \u09ac\u09bf\u09b0\u09c1\u09a7\u09c0 \u09a8\u09be \u09a4\u09be\u09b9\u09b2\u09c7 \u09a6\u09c7\u0996\u09a4\u09c7 \u09aa\u09be\u099a\u09cd\u099b\u09bf \u0995\u09c1\u0996\u09cd\u09af\u09be\u09a4 \u098f\u0995\u099f\u09be \u0987\u09b8\u09b2\u09be\u09ae \u09ac\u09bf\u09b0\u09c1\u09a7\u09c0 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09a4\u09c1\u0987 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u099a\u09cd\u099a\u09be \u09b6\u09be\u09b2\u09be \u09a6\u09be\u09b2\u09be\u09b2 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u098f\u0987 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u098f\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09df \u098f\u09ae\u09cd\u09a8\u09c7\u0987 \u09ae\u09b0\u09ac\u09cb", + "output": [ + "Religious" + ] + }, + { + "input": " \u099a\u09be\u0995\u09b0\u09bf \u09af\u09c7\u09ae\u09a8 \u09a6\u09bf\u099b\u09c7 \u09a4\u09b2\u09c7 \u09a4\u09b2\u09c7 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u0997\u09cb \u09a4\u09bf\u09a8 \u09b9\u09be\u09a4 \u09ad\u09b0\u09c7 \u0993 \u09a6\u09bf\u099b\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a4\u09cb\u09b0\u09be \u09a4 \u09b8\u09ac \u099c\u09be\u09a8\u09a4\u09be \u0985\u09a4\u0987 \u099c\u09be\u09a8\u09a4\u09be \u09a4 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09a6\u09c7\u09b0 \u0995\u09c7\u09a8 \u09a4\u09be\u09b0\u09be\u099b\u09bf\u09b8 \u09b8\u09be\u09b2\u09be \u09ae\u09cb\u09b2\u09cd\u09b2\u09be", + "output": [ + "Religious" + ] + }, + { + "input": " \u09b9\u09be \u09b9\u09be \u09b9\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09b0\u09be \u09ac\u09a1\u09cd\u09a1 \u09ac\u09be\u09dc\u09be\u09ac\u09be\u09dc\u09bf \u0995\u09b0\u099b\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u099f\u09c7\u09a8\u09cd\u09a1\u09c1 \u0997\u09be\u0999\u09cd\u0997\u09c1 \u09a7\u09a8\u09bf \u0995\u09b2\u09bf \u09b0\u09b9\u09bf\u09a4 \u09aa\u09c1\u09b0\u09cb \u09ad\u09be\u09b0\u09cb\u09a4 \u098f\u09b8\u09c7 \u09aa\u09b0 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u0996\u09c7\u09b2\u09be \u09b9\u09ac\u09c7 \u09a6\u09c7\u0996\u09bf \u09a4\u09cb\u09b0\u09be \u0995\u09a4\u09cb \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09bf\u09b8 \u09aa\u09b0\u09c7 \u09a6\u09c7\u0996\u09be \u099c\u09be\u09ac\u09c7 \u09b6\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u09af\u09a6\u09bf \u0995\u09cb\u09a8\u09cb \u09ae\u09be\u09df\u09c7\u09b0\u09b0 \u0997\u09b0\u09cd\u09ad\u09c7 \u099c\u09a8\u09cd\u09ae \u09b9\u0987\u09a4\u09c7 \u09a4\u09be\u09b9\u09b2\u09c7 \u098f\u09b8\u09ac \u0995\u09a5\u09be\u09ac\u09b2\u09a4\u09bf \u09a8\u09be \u0986\u09b8\u09b2\u09c7 \u09a4\u09c1\u0987 \u098f\u0995\u099f\u09be \u09a8\u09b7\u09cd\u099f\u09be \u0986\u09b0 \u09af\u09be\u09b0\u09be \u09a8\u09b7\u09cd\u099f\u099f\u09be \u09a4\u09be\u09a6\u09c7\u09b0 \u0995\u09c7 \u09a8\u09b7\u09cd\u099f\u09b0\u09be \u099a\u09cb\u09a6\u09c7 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09ae\u09a4 \u09ae\u09be\u09a8\u09c1\u09b7 \u09a8\u09be \u0986\u09b0 \u09a4\u09b0\u09c7 \u0995\u09bf \u099a\u09cb\u09a6\u09ac\u09cb \u09a4\u09c1\u0987 \u09a4\u09cb \u09b9\u09bf\u099c\u09b0\u09be \u09b8\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09a4\u09b0 \u09ae\u09be\u09b0\u09c7 \u099a\u09cb\u09a6\u09ac\u09cb \u09a4\u09b0 \u09ac\u09cb\u09a8\u09b0\u09c7 \u099a\u09cb\u09a6\u09ac\u09cb \u09a4\u09b0\u09c7 \u09ab\u09c1\u099f\u0995\u09bf \u09ae\u09be\u09b0\u09ac\u09cb \u09ae\u09be\u0997\u09bf\u09b0 \u09ab\u09c1\u09a4 \u0997\u09a3\u09c7\u09b6 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ac\u09be\u09b2\u09c7\u09b0 \u09aa\u09c1\u099c\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a4\u09cb\u09b0 \u09ac\u09be\u09a1\u09bc\u09bf\u09a4\u09c7 \u0985\u09aa\u09b0\u09bf\u099a\u09bf\u09a4 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09a2\u09c1\u0995\u09c7 \u09aa\u09a1\u09bc\u09b2\u09c7 \u09a4\u09c1\u0987 \u0995\u09bf \u0995\u09b0\u09ac\u09bf \u09ae\u09cb\u09a6\u09c0 \u09b6\u09c7\u099f\u09be\u0987 \u0995\u09b0\u099a\u09cd\u099b\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u098f\u09b8\u09ac \u09a6\u09c7\u0996\u09be\u09b0 \u09b8\u09ae\u09df \u09a8\u09be\u0987 \u09a4\u09be\u09b0\u09be \u098f\u0996\u09a8 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09ac\u09b2\u09be \u0985\u09aa\u09b0\u09be\u09a7\u09bf \u0996\u09cb\u099c\u09be\u09df \u09ac\u09c7\u09b8\u09a4\u09cb ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09be\u0989\u09a8 \u098f\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09a4\u09c1\u0987 \u0995\u09bf \u099c\u09be\u09a8\u09cb\u099b \u09a4\u09c1\u0987 \u09ac\u09be\u0982\u09b2\u09be \u099b\u09be\u0987\u09b0\u09be \u09a4\u09cb\u09b0 \u09ae\u09c1\u09a6\u09bf \u09ac\u09be\u09ac\u09be\u09b0 \u0995\u09be\u099b\u09c7 \u09af\u09be \u09ae\u09be\u09a6\u09be\u09b0\u099a\u09c1\u09a6 \u0995\u09a8\u09c7 \u0995\u09be\u09b0", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u099c\u09a6\u09bf \u09b9\u09bf\u09a8\u09a6\u09c7\u09b0 \u0993\u09aa\u09b0 \u0985\u09a4\u09be\u099a\u09be\u09b0 \u0995\u09b0\u09c7 \u09a4\u09be\u09b9\u09b2\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u098f\u09a4 \u09b9\u09bf\u09a8\u09a6\u09c1 \u099c\u09be\u09df\u0997\u09be \u09aa\u09c7\u09a4\u09cb \u09a8\u09be \u09b9\u09be\u09b2\u09be \u09ae\u09be\u09a6\u09be\u09b0 \u099a\u09c1\u09a6 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4 \u0995\u09cb\u09a8 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u09a4\u09be\u09dc\u09be\u099a\u09cd\u099b\u09c7 \u09a8\u09be \u09a4\u09be\u09dc\u09be\u099a\u09cd\u099b\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u099c\u09c7\u09b9\u09be\u09a6\u09bf \u09ae\u09cb\u09b2\u09cd\u09b2\u09be\u09a6\u09c7\u09b0 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09b9\u09be\u09df\u09b0\u09c7 \u09ae\u09be\u09b2\u09c1 \u0986\u09b0\u09cb \u0995\u09a4\u0995\u09bf\u099b\u09c1 \u0995\u09b0\u09ac\u09bf \u09a4\u09cb\u09b0\u09be \u09a4\u09be\u09b0\u09be\u09a4\u09be\u09b0\u09bf \u0997\u099c\u09ac \u0986\u09b8\u09ac\u09c7 \u09ae\u09a8\u09c7 \u09b9\u09df \u09a4\u09cb\u09a6\u09c7\u09b0 \u0989\u09aa\u09b0 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09af\u09c7 \u09b6\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09ac\u09b2\u09c7\u099b\u09c7 \u0993 \u09ac\u09cb\u09a8\u09c7\u09b0\u09c7 \u099a\u09c1\u09a6\u09bf \u09a4\u09cb\u09ae\u09be\u09a6\u09c7\u09b0 \u09ae\u09c1\u0996\u09c7 \u09a6\u09be\u09b0\u09bf \u09ae\u09be\u09a5\u09be\u09df \u09a0\u09c1\u09aa\u09bf \u09b0\u09c7\u0996\u09c7 \u09ad\u09a8\u09cd\u09a1\u09be\u09ae\u09c0 \u0995\u09b0 \u09a4\u09cb\u09ae\u09b0\u09be \u099c\u0982\u0997\u09c0 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09b8\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u0995\u09be\u09a6\u09c7\u09b0 \u09a7\u09b0\u09cd\u09ae \u098f\u09b0 \u09b8\u09ac\u09be\u0987 \u09af\u09be\u09a8\u09c7 \u09a4\u09cb\u0997\u09cb \u09a7\u09b0\u09cd\u09ae \u09a8\u09c7\u09a4\u09be \u0995\u09c3\u09b7\u09cd\u09a8 \u0990 \u09ae\u09be\u0997\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be\u09df \u09a4\u09cb \u099c\u09be\u09a4\u09c0\u09df \u099a\u09c1\u099a\u09cd\u099a\u09be \u0986\u09ac\u09be\u09b0 \u09a4\u09cb\u09b0\u09be \u0995\u09b0\u09b8 \u09af\u09cc\u09a8 \u09aa\u09c2\u099c\u09be \u09a4\u09cb\u0997 \u09a7\u09b0\u09cd\u09ae \u09a8\u09c7\u09a4\u09be\u09b0\u09be \u09ac\u09b2\u09c7 \u09a8\u09be\u09b0\u09c0 \u09b9\u099a\u09cd\u099b\u09c7 \u09ad\u09cb\u0997\u09c7\u09b0 \u09ac\u09b8\u09cd\u09a4\u09c1 \u09a4\u09be\u09b0 \u09ae\u09be\u09a8\u09c7 \u09a4\u09cb\u09b0 \u09ae\u09be \u09ac\u09cb\u09a8\u09a6\u09c7\u09b0 \u099c\u09be\u09df\u0997\u09be \u09ab\u09be\u0995 \u09b8\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0995\u09be\u09b0\u09cd\u09a4\u09bf\u0995 \u0995\u09c7 \u09a6\u09c7\u0996\u09a4\u09c7 \u09aa\u09c7\u09df\u09c7 \u09ae\u09be \u09a6\u09c2\u09b0\u09cd\u0997\u09be \u09a6\u09cc\u09dc\u09c7 \u0995\u09be\u099b\u09c7 \u0997\u09bf\u09df\u09c7 \u09ac\u09b2\u09b2\u09cb \u0993 \u0986\u09ae\u09be\u09b0 \u09ac\u09bf\u09b0 \u0995\u09be\u09b0\u09cd\u09a4\u09bf\u0995 \u09a6\u09df\u09be \u0995\u09b0\u09c7 \u09a4\u09c1\u09ae\u09bf \u0986\u09ae\u09be\u09b0 \u0997\u09c1\u09a6 \u099f\u09bf \u09ab\u09be\u099f\u09bf\u09df\u09c7 \u09a6\u09bf\u09df\u09c7 \u09af\u09be\u0993", + "output": [ + "Religious" + ] + }, + { + "input": " \u09ae\u09be\u09df\u09be\u09a8\u09ae\u09be\u09b0 \u098f \u09b6\u09a4\u09c7 \u09b6\u09a4\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09b9\u09a4\u09cd\u09af\u09be\u09df \u0993\u09a8\u09be\u09b0 \u09a6\u09c1\u0996\u09cd\u09af\u09cb \u09b9\u09df\u09a8\u09be \u09b9\u09ac\u09c7 \u0995\u09bf \u0995\u09b0\u09c7 \u0993\u09b0\u09be \u09af\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u099f\u09cd\u09b0\u09a8 \u09a6\u09c2\u09b0\u0998\u099f\u09a8\u09be\u09df \u09ae\u09be\u09b0\u09be \u0997\u09c7\u099b\u09c7 \u0993\u09b0\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09b9\u09be\u099b\u09bf\u09a8\u09be\u09b0 \u09ac\u0982\u09b6 \u09a6\u09b0 \u0993\u09a8\u09be\u09b0 \u09a4\u09cb \u09b0\u09be\u09a4\u09c7 \u0997\u09c1\u09ae \u09b9\u0993\u09df\u09be\u09b0 \u0995\u09a5\u09be\u09a8\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u098f\u0987 \u09b6\u09be\u09b2\u09be \u0995\u09c7 \u0995\u09bf \u0995\u09c1\u09a4\u09cd\u09a4\u09be \u09aa\u09df\u09a6\u09be \u0995\u09b0\u099b\u09bf\u09b2 \u09a8\u09be\u0995\u09bf \u09b6\u09df\u09a4\u09be\u09a8 \u09aa\u09df\u09a6\u09be \u0995\u09b0\u099b\u09bf\u09b2 \u09b8\u09be\u09b2\u09be\u09df \u0995\u09df \u0995\u09bf", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u0995\u09cb\u09a8 \u09ae\u09be\u0997\u09bf\u09b0 \u09ac\u09be\u099a\u099b\u09be \u09b0\u09c7 \u0997\u09b0\u09c1\u09b0 \u09ae\u09b2 \u0993 \u09ae\u09c1\u09a4 \u0996\u09cd\u09af\u09be\u0995\u09cd\u09af\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09af\u09a6\u09bf \u0995\u09c1\u09b0\u0986\u09a8\u09c7\u09b0 \u098f\u0995\u099f\u09bf \u09ac\u09b0\u09cd\u09a3 \u09ad\u09c1\u09b2 \u09aa\u09be\u09b8 \u09a4\u09be\u09b9\u09b2\u09c7 \u09ae\u09a8\u09c7 \u0995\u09b0 \u09a4\u09c1\u0987 \u09ae\u09be\u09b2\u09be\u0989\u09a8", + "output": [ + "Religious" + ] + }, + { + "input": "\u09b9\u09af\u09b0\u09a4 \u09ac\u09cc\u09a6\u09cd\u09a7 \u09b6\u09be\u09b2\u09be \u099b\u09be\u0997\u09b2 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u098f\u0987 \u099c\u09be\u09b0\u099c\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09aa\u09a4\u09cd\u09b0\u09bf\u0995\u09be \u09b8\u09ae\u09df\u09c7\u09b0 \u0995\u09a8\u09cd\u09a0\u09b7\u09cd\u09af\u09b0 \u09af\u0996\u09a8 \u09ad\u09be\u09b0\u09a4 \u09a5\u09c7\u0995\u09c7 \u098f\u0995\u099f\u09be \u09ac\u09a8\u09cd\u09af \u09b9\u09be\u09a4\u09bf \u0986\u09b8\u09b2\u09cb \u09a4\u0996\u09a8 \u0990\u099f\u09be \u0995\u09c7 \u09a8\u09bf\u09df\u09c7 \u0995\u09a4 \u09ae\u09be\u09a4\u09be\u09ae\u09be\u09a4\u09bf \u0986\u09b0 \u098f\u0996\u09a8 \u0995\u09bf\u099b\u09c1 \u0985\u09b8\u09b9\u09be\u09df \u09ae\u09be\u09a8\u09c1\u09b7\u09a6\u09c7\u09b0 \u09ac\u09c7\u09b2\u09be\u09df \u09ac\u09cb\u09b2\u099b\u09c7 \u098f\u09b0\u09be \u0985\u09ac\u09c8\u09a7 \u0985\u09a8\u09c1\u09aa\u09cd\u09b0\u09ac\u09c7\u09b6\u0995\u09be\u09b0\u09c0 \u09b6\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0986\u09b0\u09ac\u09c7\u09b0 \u09ae\u09c7\u09df\u09c7\u09a6\u09c7\u09b0 \u09ed-\u09ee \u09ac\u099b\u09b0 \u09ac\u09df\u09b8\u09c7 \u09ae\u09be\u09b8\u09bf\u0995 \u09b9\u09df \u09a4\u09be\u09b9\u09b2\u09c7 \u09a4\u09cb \u0997\u09be\u09df\u09c7-\u0997\u09a4\u09b0\u09c7 \u0985\u09a8\u09c7\u0995 \u09b6\u0995\u09cd\u09a4\u09bf\u09b6\u09be\u09b2\u09c0 \u09b9\u09ac\u09be\u09b0 \u0995\u09a5\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u099a\u09be\u09b2\u09c1 \u09b9\u09df\u09c7 \u09af\u09be\u0995 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u0989\u09aa\u09b0 \u09ae\u09be\u0987\u09b0 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u098f\u0996\u09be\u09a8\u09c7 \u09af\u09a4 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u0986\u099b\u09c7 \u09b8\u09ac\u09be\u09b0 \u09ae\u09be \u09ac\u09cb\u09a8 \u09a6\u09c7\u09b0 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09bf\u09b0\u09be \u099a\u09cb\u09a6\u09c7 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u099c\u09bf\u09a8\u09cd\u09a6\u09be\u09ac\u09be\u09a6", + "output": [ + "Religious" + ] + }, + { + "input": " \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09ae\u09be\u09a6\u09be\u09b0 \u099a\u09cb\u09a6 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u099c\u09bf\u09a8\u09cd\u09a6\u09be\u09ac\u09be\u09a6 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09b6\u09c1\u09a8 \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be \u09b9\u09b2\u09cb \u09ac\u09c7\u09b6\u09cd\u09af\u09be\u09b0 \u09a6\u09c7\u09b6 \u09af\u09be \u099c\u09be\u09a4\u09bf\u09b8\u0982\u0998\u09c7\u09b0 \u09a6\u09cd\u09ac\u09be\u09b0\u09be \u09b8\u09cd\u09ac\u09c0\u0995\u09c3\u09a4 \u09aa\u09be\u099f \u0995\u09cd\u09b7\u09c7\u09a4\u09c7\u09b0 \u09ac\u09cd\u09af\u09be\u09aa\u09be\u09b0\u09c7 \u09a4\u09cb\u09b0 \u0985\u09ad\u09bf\u099c\u09cd\u099e\u09a4\u09be \u09a4\u09cb \u09a6\u09c7\u0996\u09bf \u09a6\u09be\u09b0\u09c1\u09a8 \u09a4\u09cb\u09b0 \u09ae\u09be \u0995\u09c0 \u09aa\u09be\u099f \u0995\u09cd\u09b7\u09c7\u09a4\u09c7 \u09ad\u09cb\u09a6\u09be \u09ac\u09bf\u09b2\u09be\u09df \u09a8\u09be\u0995\u09bf \u09a8\u09be\u0995\u09bf \u09a4\u09cb\u09b0 \u09ae\u09be\u0995\u09c7 \u09aa\u09be\u099f \u09a8\u09bf\u09df\u09c7 \u099a\u09c1\u09a6\u09c7\u099b\u09bf\u09b2\u09be\u09ae \u09b8\u09c7\u0987 \u09ad\u09bf\u09a1\u09bf\u0993 \u09a6\u09c7\u0996\u09c7 \u099a\u099f\u09c7 \u0997\u09c7\u099b\u09bf\u09b8 \u0993\u09b0\u09c7 \u09ae\u09be\u0997\u09c0\u09b0 \u09aa\u09cb\u09b2\u09be \u0987\u09b0\u09be\u09a8\u09c7\u09b0 \u0995\u09be\u099b\u09c7 \u09a4\u09cb\u09b0\u09be \u09b6\u09a4 \u0995\u09cb\u099f\u09bf \u09a1\u09b2\u09be\u09b0 \u098b\u09a8\u09c0 \u09b9\u09df\u09c7 \u0986\u099b\u09bf\u09b8 \u0986\u09b0 \u09ae\u09cb\u0987\u09a6\u09cd\u09a6\u09be \u099b\u09bf\u09a8\u09be\u09b2\u09c7\u09b0 \u09ac\u09c7\u099f\u09be \u0987\u09b0\u09be\u09a8\u09bf \u09aa\u09cd\u09b0\u09c7\u09b8\u09bf\u09a1\u09c7\u09a8\u09cd\u099f\u09b0 \u09aa\u09be \u09a7\u09b0\u09c7 \u09b8\u09ae\u09df \u09ac\u09be\u09dc\u09bf\u09df\u09c7 \u098f\u09a8\u09c7\u099b\u09c7 \u09ac\u09be\u09aa \u09ae\u09c7\u09df\u09c7\u0995\u09c7 \u099a\u09cb\u09a6\u09c7 \u0986\u09b0 \u09ae\u09be \u09ac\u09be\u0987\u09b0\u09c7 \u09a5\u09c7\u0995\u09c7 \u09aa\u09be\u09b9\u09be\u09b0\u09be \u09a6\u09c7\u09df \u09b8\u09cd\u0995\u09c1\u09b2\u09c7 \u0997\u09bf\u09df\u09c7 \u09b0\u099a\u09a8\u09be\u09df \u09b8\u09c7\u0987 \u099a\u09cb\u09a6\u09be\u099a\u09c1\u09a6\u09bf\u09b0 \u0995\u09be\u09b9\u09bf\u09a8\u09c0 \u09b2\u09bf\u0996\u09c7 \u09a6\u09c7\u09df \u09b9\u09be\u0997\u09bf\u09b8 \u09a4\u09cb \u0996\u09cb\u09b2\u09be \u09ae\u09be\u09a0\u09c7 \u09b8\u09c7\u09a6\u09bf\u09a8 \u09a6\u09c7\u0996\u09b2\u09be\u09ae \u098f\u0995 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u098f\u0987\u09b8\u09ac \u0986\u09a4\u0999\u09cd\u0995\u09ac\u09be\u09a6\u09c0 \u0987\u09b8\u09b2\u09be\u09ae \u09a7\u09b0\u09cd\u09ae \u09b8\u09ae\u09cd\u09aa\u09b0\u09cd\u0995\u09c7 \u0995\u09bf\u099b\u09c1\u0987 \u09ac\u09b2\u09be\u09b0 \u09a8\u09c7\u0987", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09cb\u09a6\u09c0 \u09ac\u09bf\u09b6\u09cd\u09ac\u09c7\u09b0 \u09a6\u09b6 \u09a8\u09be\u09ae\u09cd\u09ac\u09be\u09b0 \u0995\u09c1\u0996\u09cd\u09af\u09be\u09a4 \u09b8\u09a8\u09cd\u09a4\u09cd\u09b0\u09be\u09b8\u09bf \u09a4\u09be\u09b0 \u09ae\u09c1\u0996\u09c7 \u0990 \u09b0\u0995\u09ae \u09a8\u09cb\u0982\u09b0\u09be \u0995\u09a5\u09be\u0987 \u0986\u09b8\u09ac\u09c7 \u09a4\u09cb\u09b0\u09be \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u09a6\u09c7\u09b0 \u09b9\u09bf\u0982\u09b8\u09be \u0995\u09b0\u09bf\u099b \u0985\u09a4\u099b \u09b2\u0995\u09cd\u09b7 \u09b2\u0995\u09cd\u09b7 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u09a6\u09c7\u09b6 \u0997\u09c1\u09b2\u09be\u09a4\u09c7 \u09af\u09be\u0987\u09df\u09be \u0995\u09be\u099c \u0995\u09be\u09ae \u0995\u09b0\u09bf\u09af\u09bc\u09be \u099c\u09c0\u09ac\u09a8 \u09ac\u09be\u099a\u09be\u0987 \u098f\u0995\u099f\u09c1 \u09b2\u099c\u09cd\u099c\u09be \u09b8\u09b0\u09ae \u09a5\u09be\u0995\u09be \u0989\u099a\u09bf\u09a4", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09a8\u09bf\u09df\u09c7 \u0986\u09ae\u09bf \u0995\u09a5\u09be \u09ac\u09b2\u09a4\u09c7 \u099a\u09be\u0987\u09a8\u09be", + "output": [ + "Religious" + ] + }, + { + "input": " \u09b8\u09be\u09ac\u09cd\u09ac\u09be\u09b8 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09a6\u09c7\u09b0 \u09a6\u0982\u09b8 \u0995\u09b0\u09c7 \u09a6\u09bf\u09a4\u09c7 \u09b9\u09ac\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u098f\u0995\u099f\u09be \u09b8\u09c1\u09ac\u09bf\u09a7\u09be\u09ac\u09be\u09a6\u09bf \u09a4\u09c1\u0987 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u0993 \u09a8\u09be \u0986\u09ac\u09be\u09b0 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u0993 \u09a8\u09be \u09a4\u09c1\u0987 \u098f\u0995\u099f\u09be \u09a8\u09be\u09b8\u09cd\u09a4\u09bf\u0995 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09aa\u09c7\u099a\u09ac\u09c1\u0995\u09c7 \u0987 \u0995\u09a5\u09be \u09ac\u09b2\u09bf\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09b8\u09be\u09ae\u09a8\u09c7 \u09b9\u09bf\u099c\u09b0\u09be\u09b0 \u09ae\u09a4 \u09a5\u09be\u0995\u09c7 \u098f\u0987 \u09b0\u0995\u09ae \u09a6\u09c1\u0987 \u098f\u0995\u099f\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u0995\u09be\u09b0\u09a8\u09c7 \u0985\u09a8\u09cd\u09af \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7 \u09ae\u09be\u09b0\u0996\u09be\u09df \u09ac\u09be\u09dc\u09bf \u0998\u09b0 \u09b9\u09be\u09b0\u09be\u09df \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09b9\u09c1\u09b8\u09bf\u09df\u09be\u09b0 \u09a4\u09cb\u09b0 \u0995\u09be\u09c7\u09a8\u09c7 \u09a4\u09cb\u09b0 \u099c\u09be\u09a4 \u09ac\u09be\u0987\u09b0\u09be \u09ae\u09b0\u09bf\u09ac\u09c7 \u09ae\u09cb\u09b8\u09b2\u09ae\u09be\u09a8\u09a6\u09c7\u09b0 \u09ac\u09c1\u0995\u09c7 \u09a8\u09bf\u099a\u09c7 \u09a5\u09be\u0995\u09bf \u09ae\u09cb\u09b8\u09b2 \u09ae\u09be\u09a8\u09a6\u09c7\u09b0 \u0997\u09be\u09b2\u09bf \u09a6\u09c7\u09b8 \u09ac\u09be\u0987\u09a8\u099a\u09cb\u09a6 \u098f\u09b0 \u09aa\u09b0\u09bf\u09a8\u09be\u09ae \u0995\u09bf \u09b9\u09df \u09a6\u0996\u09b8\u09a8\u09be \u09a4\u09c1\u0987 \u09a0\u09bf\u0995 \u09b9\u09df\u09c7\u09af\u09be\u09df \u09ac\u09be\u099a\u09bf\u09a4\u09c7 \u09aa\u09be\u09b0\u09bf\u09ac\u09bf", + "output": [ + "Religious" + ] + }, + { + "input": "\u09b8\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09a4\u09b0\u09cd\u0995 \u09a8\u09be \u0995\u09b0\u09c7 \u09af\u09be \u09b2\u09a4\u09be \u09aa\u09be\u09a4\u09be \u09a6\u09bf\u09df\u09c7 \u0998\u09c7\u09b0 \u09a6\u09bf\u09df\u09c7 \u099f\u09df\u09b2\u09c7\u099f \u09ac\u09be\u09a8\u09be \u09a4\u09cb\u09b0\u09be\u09a4\u09cb \u09ac\u09c7\u09b6\u09bf\u09b0\u09ad\u09be\u0997 \u09ae\u09be\u09a8\u09c1\u09b7 \u099f\u09df\u09b2\u09c7\u099f\u09c7\u09b0 \u0985\u09ad\u09be\u09ac\u09c7 \u0996\u09cb\u09b2\u09be \u099c\u09be\u09df\u0997\u09be\u09df \u09aa\u09be\u09df\u0996\u09be\u09a8\u09be \u0995\u09b0\u09cb\u099b ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09b6\u09c1\u09a7\u09c1 \u0997\u09be\u09b2\u09bf \u09a6\u09bf\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 \u09ae\u09be\u09b0\u09be\u09ae\u09be\u09b0\u09bf \u0995\u09be\u099f\u09be\u0995\u09be\u099f\u09bf \u0995\u09b0\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09b8\u09c7 \u0997\u09a8\u09cd\u09a7 \u09a8\u09c7\u0993\u09df\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09b0\u09be \u09a6\u09cc\u09b0\u09c7", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09be\u09b0 \u09b8\u09be\u09b2\u09be\u09b0 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u0995\u09bf\u099b\u09c1 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u0989\u09b8\u0995\u09be\u09a8\u09bf \u09ae\u09c1\u09b2\u09c1\u0995 \u0995\u09a5\u09be \u09ac\u09b2\u09c7\u099b\u09c7 \u0986\u09b0 \u0995\u09bf\u099b\u09c1 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u09a8\u09be\u09ae \u09a6\u09be\u09b0\u09bf \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u09a6\u09c7\u09b0 \u0986\u09aa\u09a8 \u09ad\u09be\u09ac\u09c7 \u09a8\u09be \u09a4\u09be\u09b0\u09be \u09ae\u09b0\u09c7 \u09af\u09be\u0995 \u09a4\u09be\u09a4\u09c7 \u0995\u09bf \u0986\u09b8\u09c7 \u09af\u09be\u09af\u09bc \u09a4\u09be\u09a6\u09c7\u09b0 \u09ad\u09be\u09ac \u09a6\u09be\u09b0\u09be \u098f\u09ae\u09a8\u09bf \u09ae\u09a8\u09c7 \u09b9\u09af\u09bc ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09b6\u09c1\u09df\u09cb\u09b0 \u0997\u09c1\u09b2\u09cb \u0995\u09be\u09a6\u09be \u09ae\u09df\u09b2\u09be\u09b0 \u09b8\u09ae\u09be\u09a8 \u0995\u09cb\u09b0\u09be\u09a8 \u099b\u09be\u09dc\u09be \u0995\u09bf\u099b\u09c1\u0987 \u09ac\u09cb\u099d\u09c7 \u09a8\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0995\u09be\u099f\u09ae\u09cb\u09b2\u09cd\u09b2\u09be\u09a6\u09c7\u09b0 \u09a4\u09be\u09a6\u09c7\u09b0 \u09a7\u09b0\u09cd\u09ae \u09ac\u09cd\u09af\u09ac\u09b8\u09be\u09df \u09ac\u09a8\u09cd\u09a7 \u09b9\u09df\u09c7 \u0997\u09c7\u099b\u09c7 \u09a4\u09be\u0987 \u09a4\u09be\u09b0 \u0989\u09aa\u09b0 \u0996\u09c1\u09ac \u09b0\u09be\u0997 \u0986\u09b0\u09c7 \u09ad\u09be\u0987 \u09b8\u09a4\u09cd\u09af \u099a\u09bf\u09b0\u09a8\u09cd\u09a4\u09b0 \u09ae\u09bf\u09a5\u09cd\u09af\u09be \u09b8\u09be\u09ae\u09df\u09bf\u0995", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09be\u0989\u09a8\u0995\u09be \u09ac\u09be\u099a\u09cd\u099a\u09be \u0995\u09ac\u09bf \u09a8\u09bf\u09b9\u09bf \u09b9\u09cb\u0997\u09be \u0986\u099a\u09cd\u099b\u09be \u09a4\u09c1\u0987 \u09a8\u09bf\u099c\u09c7\u09b0 \u09ac\u09b0\u09cd\u09a1\u09be\u09b0\u09c7 \u09aa\u09cd\u09b0\u09a4\u09bf\u09a6\u09bf\u09a8 \u09b9\u09a4\u09cd\u09af\u09be \u0995\u09b0\u09a4\u09c7\u099b\u09bf\u09b8 \u09a8\u09bf\u09b0\u09b9 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09bf\u09a6\u09c7\u09b0 \u0986\u09b0 \u09a4\u09c1\u0987\u0995\u09bf\u09a8\u09be \u09ac\u09b2\u09bf\u09b6 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09ae\u09bf\u09df\u09be\u09a8\u09ae\u09be\u09b0\u09c7\u09b0 \u09ac\u09b0\u09cd\u09a1\u09be\u09b0\u09c7 \u09b6\u09be\u09a8\u09cd\u09a4\u09bf \u099a\u09be\u0993\u09df\u09be\u09b0 \u09ae\u09be\u09a8\u09bf \u09b9\u09df\u09a8\u09be \u0986\u0997\u09c7 \u09ad\u09be\u09b0\u09a4 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09ac\u09b0\u09cd\u09a1\u09be\u09b0\u09c7\u09b0 \u09b6\u09be\u09a8\u09cd\u09a4\u09bf \u09ab\u09bf\u09df\u09c7 \u09a6\u09c7", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09be\u09a6\u09be\u09b0\u099a\u09cb\u09a6 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09b0\u09be \u09ad\u09df\u09c7 \u0987\u09a8\u09cd\u09a1\u09bf\u09df\u09be \u09a4\u09c7 \u09aa\u09be\u09b2\u09bf\u09df\u09c7 \u09a8\u09be \u098f\u09b8\u09c7 \u0989\u099a\u09bf\u09ce \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u0995\u099a\u09c1\u0995\u09be\u099f\u09be \u0995\u09b0\u09c7 \u09a6\u09c1\u09a8\u09bf\u09df\u09be \u09a5\u09c7\u0995\u09c7 \u09a8\u09bf\u09b0\u09cd\u09ae\u09c2\u09b2 \u0995\u09b0\u09c7 \u09a6\u09c7\u0993\u09df\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u098f\u09a1\u09ae\u09bf\u09a8 \u09af\u09c7 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09a4\u09be \u0986\u0997\u09c7\u09b0 \u0985\u09a8\u09c7\u0995 \u09aa\u09cb\u09b7\u09cd\u099f\u09c7 \u09aa\u09cd\u09b0\u09ae\u09be\u09a8 \u09aa\u09c7\u09df\u09c7\u099b\u09bf ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a6\u09c7\u09b6\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u0986\u09aa\u09a8\u09be\u09b0 \u0995\u09a4\u099f\u09c1\u0995\u09c1 \u09a4\u09cd\u09af\u09be\u0997 \u0986\u099b\u09c7 \u0986\u09aa\u09a8\u09be\u09b0 \u09ad\u09be\u09b7\u09be\u09df \u0997\u09cb\u099f\u09be \u09aa\u09be\u0981\u099a\u09c7\u0995 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09a8\u09be\u09ae \u09aa\u09cd\u09b0\u0995\u09be\u09b6 \u0995\u09b0\u09b2\u09be\u09ae \u09a4\u09be\u0981\u09b0\u09be \u09b9\u09b2\u09c7\u09a8 \u099a\u09bf\u09a4\u09cd\u09a4 \u09b0\u099e\u09cd\u099c\u09a8 \u09a6\u09a4\u09cd\u09a4 \u09b8\u09bf\u0986\u09b0 \u09a6\u09a4\u09cd\u09a4 \u09ac\u09c0\u09b0 \u0989\u09a4\u09cd\u09a4\u09ae \u09a8\u09bf\u09b2 \u09ae\u09a8\u09bf \u09b8\u09b0\u0995\u09be\u09b0 \u09ac\u09c0\u09b0 \u09ac\u09bf\u0995\u09cd\u09b0\u09ae \u099c\u0997\u09a4 \u099c\u09cd\u09af\u09cb\u09a4\u09bf \u09a6\u09be\u09b8 \u09ac\u09c0\u09b0 \u09ac\u09bf\u0995\u09cd\u09b0\u09ae \u0985\u09b2\u09c0\u0995 \u0995\u09c1\u09ae\u09be\u09b0 \u0997\u09c1\u09aa\u09cd\u09a4 \u09ac\u09c0\u09b0 \u09aa\u09cd\u09b0\u09a4\u09c0\u0995 \u09a6\u09c7\u09ac\u09a6\u09be\u09b8 \u09ac\u09bf\u09b6\u09cd\u09ac\u09be\u09b8 \u0996\u09cb\u0995\u09a8 \u09ac\u09c0\u09b0 \u09ac\u09bf\u0995\u09cd\u09b0\u09ae \u09aa\u09be\u09b0\u09b2\u09c7 \u0996\u09c7\u09a4\u09be\u09ac \u099b\u09be\u09dc\u09be \u09b8\u09cd\u09ac\u09b8\u09b8\u09cd\u09a4\u09cd\u09b0 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09af\u09cb\u09a6\u09cd\u09a7\u09be \u098f\u09ac\u0982 \u09b6\u09b9\u09c0\u09a6 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u09b9\u09bf\u09b8\u09be\u09ac \u099c\u09c7\u09a8\u09c7 \u09a8\u09bf\u09df\u09c7\u09a8 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09b6\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09ae\u09b0\u09a8 \u0995\u09c7 \u09b8\u09b0\u09a8 \u0995\u09b0\u09c7 \u09a4\u0993\u09ac\u09be \u09aa\u09b0\u09c7 \u09a8\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09b9\u09df\u09c7 \u09b8\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u09b8\u09c7\u099c\u09c7 \u0995\u09a5\u09be \u09ac\u09b2\u09bf\u09b8 \u09a4\u09b0 \u09ae\u09be \u0997\u09b0\u09c1\u09b0 \u099a\u09c1\u09a6\u09be \u0996\u09c7\u09df\u09c7 \u09a4\u09cb\u0995\u09c7 \u099c\u09a8\u09cd\u09ae \u09a6\u09bf\u099b\u09c7 \u098f\u099f\u09be \u09b8\u09a4\u09cd\u09af \u09a8\u09be \u0995\u09bf \u09ae\u09bf\u09a5\u09cd\u09af\u09c7 \u0986\u0997\u09c7 \u09ac\u09b2 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09bf \u09b8\u09c7\u09a8\u09be\u09b0\u09be \u0988\u09ae\u09be\u09a8\u09bf \u09b6\u0995\u09cd\u09a4\u09bf \u09a8\u09bf\u09df\u09c7 \u09af\u09c1\u09a6\u09cd\u09a7 \u0995\u09b0\u09c7 \u0986\u09b0 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09b0\u09be \u09a6\u09c2\u09a8\u09bf\u09df\u09be\u09ac\u09c0 \u09b6\u0995\u09cd\u09a4\u09bf \u09a8\u09bf\u09df\u09c7 \u09af\u09c1\u09a6\u09cd\u09a7 \u0995\u09b0\u09c7 \u0995\u09be\u099c\u09c7\u0987 \u0988\u09ae\u09be\u09a8\u09bf \u09b6\u0995\u09cd\u09a4\u09bf\u09b0 \u09b8\u09be\u09a5\u09c7 \u09a6\u09c2\u09a8\u09bf\u09df\u09be\u09ac\u09c0 \u09b6\u0995\u09cd\u09a4\u09bf \u0995\u09cb\u09a8\u09a6\u09bf\u09a8\u0987 \u09aa\u09be\u09b0\u09ac\u09c7 \u09a8\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09b8\u09ac \u0987\u09b9\u09c1\u09a6\u09bf\u0995\u09c7 \u098f\u0995\u09ac\u09be\u09b0\u09c7 \u09b9\u09a4\u09be \u0995\u09b0\u09b2\u09c7 \u09ad\u09be\u09b2\u09cb \u09b9\u09a4\u09cb", + "output": [ + "Religious" + ] + }, + { + "input": "\u098f\u0987 \u09b8\u09ac \u09b0\u0995\u09ae \u09ac\u09be\u09b2\u09c7\u09b0 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u09af\u09c7\u0996\u09be\u09a8\u09c7 \u09ac\u09bf\u09aa\u09a6 \u09b8\u09c7\u0996\u09be\u09a8\u09c7\u0987 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09a4\u09b0 \u09ac\u09be\u09ac\u09be\u09b0 \u099f\u09be\u0995\u09be \u09a6\u09bf\u09b6 \u09b9\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u0986\u09b0 \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09a4\u09c7 \u0995\u09cb\u09a8\u09cb \u09a8\u09be\u09b0\u09c0 \u09a8\u09bf\u09b0\u09cd\u09af\u09be\u09a4\u09a8 \u09b9\u09df \u09a8\u09be \u0986\u09ac\u09be\u09b2 \u09ae\u09be\u09b2\u09be\u0989\u09a8 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09a4\u09be\u09b9\u09b2\u09c7 \u09ad\u09b0\u09b0\u09b0\u09b0\u09a4 \u0995\u09c7 \u0998\u09cb\u09b7\u09a3\u09be \u0995\u09b0\u09be \u09b9\u0989\u0995 \u09a7\u09b0\u09cd\u09b7\u09a3\u09c7\u09b0 \u09a6\u09c7\u09b6 \u09a8\u09b8\u09cd\u099f \u099c\u09be\u09a4\u09bf \u099a\u09cb\u09b0\u09c7\u09b0 \u099c\u09be\u09a4\u09bf \u09ac\u09c7\u099c\u09a8\u09cd\u09ae\u09be\u09a6\u09c7\u09b0 \u099c\u09be\u09a4\u09bf \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u099c\u09be\u09a4\u09bf ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09ae\u09c1\u09a8\u09bf\u09b0 \u09a4\u09c1\u09ae\u09bf \u09ac\u09dc\u0987\u0987 \u099a\u09be\u09b2\u09be\u0995 \u0986\u09b0 \u09ac\u09c1\u09a6\u09cd\u09a7\u09bf\u09ae\u09be\u09a8 \u09a4\u09be\u0987\u09a8\u09be \u09a4\u09c1\u09ae\u09be\u09b0 \u09ad\u09bf\u09a4\u09b0\u09c7 \u09ae\u09a8\u09c1\u09b8\u09a4\u09cd\u09a4 \u09ac\u09b2\u09c7 \u0995\u09bf\u099b\u09c1 \u0986\u09ae\u09bf \u09a4\u09be \u09ac\u09bf\u09b6\u09ac\u09be\u09b8 \u0995\u09b0\u09bf\u09a8\u09be \u0986\u09b0 \u09a4\u09c1\u09ae\u09bf \u098f\u0995\u099c\u09a8 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u0986\u09ae\u09bf \u09a4\u09be\u0993 \u09ac\u09bf\u09a7\u09ac\u09be\u09b8 \u0995\u09b0\u09bf\u09a8\u09be \u0995\u09be\u09b0\u09a8 \u098f\u0995\u099c\u09a8 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u098f\u09b0 \u0995\u09b8\u09cd\u099f\u09c7 \u09a6\u09c2\u09b0\u09a6\u09a6\u09b6\u09df \u099c\u09be\u09b0 \u09ae\u09a8 \u0985\u09a8\u09cd\u09a4\u09b0 \u0995\u09be\u09a6\u09c7\u09a8\u09be \u0995\u09c7 \u09ac\u09b2\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09a4\u09be\u09b0\u09c7 \u09b8\u09c7 \u09b9\u09b2 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09ab\u09c7\u09b0\u09be\u0989\u09a8 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09b9\u09bf\u099c\u09b2\u09be \u09a6\u09c7\u09b0 \u09ae\u09be\u09b0\u09be \u0989\u099a\u09bf\u09ce", + "output": [ + "Religious" + ] + }, + { + "input": "\u0996\u09be\u09a8\u0995\u09bf\u09b0 \u09aa\u09cb\u09b2\u09be \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u09a7\u09b0\u09cd\u09ae\u09c7\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf \u09a6\u09b0\u09a6 \u09a8\u09be\u0987 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09c7\u09b0 \u0986\u099b\u09c7 \u09a4\u09c1\u0987 \u09a7\u09b0\u09cd\u09ae\u09c7\u09b0 \u0995\u09bf \u09ac\u09c1\u099c\u09b8", + "output": [ + "Religious" + ] + }, + { + "input": "\u0986\u099a\u09cd\u099b\u09be \u09ac\u09c1\u099d\u09b2\u09be\u09ae \u09a4\u09cb\u09b0 \u09b8\u09c3\u09b8\u09cd\u099f\u09bf\u0995\u09b0\u09cd\u09a4\u09be \u0995\u09c7 \u09a4\u09c1\u0987 \u0986\u09b0 \u0995\u09bf \u0995\u09b0\u09ac\u09bf \u09a4\u09c1\u0987 \u09ae\u09c1\u09ab\u09be\u09b0 \u09b8\u09be\u09a5\u09c7 \u099a\u09c1 \u099a\u09c1 \u0995\u09b0 \u09ae\u09c1\u09ab\u09be \u09ac\u09be\u09a8\u09cd\u09a6\u09b0\u09c7\u09b0 \u099c\u09a8\u09cd\u09ae\u09a6\u09bf\u09a8\u09c7 \u0997\u09be\u09a8 \u09b6\u09c1\u09a8\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09af\u09a4 \u09b8\u09ac \u09ae\u09c1\u09b0\u09cd\u0996 \u09a8\u09be\u09b8\u09cd\u09a4\u09bf\u0995 \u0987\u09b8\u09b2\u09be\u09ae\u09c7\u09b0 \u0995\u09cb\u09a8 \u099c\u09cd\u099e\u09be\u09a8 \u09a8\u09be\u0987 \u098f\u0995 \u09b2\u09be\u0987\u09a8 \u099c\u09c7\u09a8\u09c7 \u09ae\u09be\u09a8\u09b8\u09bf\u0995 \u09b0\u09cb\u0997\u09c0\u09b0 \u09ae\u09a4\u09cb \u0985\u09a8\u09b2\u09be\u0987\u09a8 \u098f \u098f\u09b8\u09c7 \u09b2\u09be\u09ab\u09be\u09b2\u09be\u09ab\u09bf \u0995\u09b0\u09bf\u09b8 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09a4\u09cb \u09ac\u09bf\u099c\u09cd\u099e\u09be\u09a8\u09c7\u09b0 \u0993 \u0995\u09cb\u09a8 \u099c\u09cd\u099e\u09be\u09a8 \u09a8\u09c7\u0987 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09b6\u09c1\u09a7\u09c1 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09ac\u09b2\u09b2\u09c7\u0987 \u09b8\u09ae\u09cd\u09aa\u09cd\u09b0\u09a6\u09be\u09df\u09c0\u0995 \u0989\u09b7\u09cd\u0995\u09be\u09a8\u09bf \u09ac\u09b2\u09c7 \u09ad\u09bf\u09a8\u09a6\u09c7\u09b6\u09bf\u09b0\u09be \u09b9\u09be\u0989 \u09b9\u09be\u0989 \u0995\u09b0\u09c7 \u09ae\u09bf\u09a1\u09bf\u09df\u09be \u0995\u09be\u0989 \u0995\u09be\u0989 \u0995\u09b0\u09c7 \u0986\u09b0 \u098f\u0996\u09a8 \u0995\u09bf\u099b\u09c1 \u09ac\u09b2\u09ac\u09c7\u09a8\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u099c\u09be\u0995\u09bf\u09b0 \u09a8\u09be\u09df\u09c7\u0995 \u09a7\u09b0\u09cd\u09ae \u09ac\u09cd\u09af\u09ac\u09b8\u09be \u09ac\u09a8\u09cd\u09a7 \u0995\u09b0\u09c7 \u09a6\u09c7\u0993\u09df\u09be\u09a4\u09c7 \u098f\u09a6\u09c7\u09b0 \u0998\u09c1\u09ae \u09b9\u09be\u09b0\u09be\u09ae \u09b9\u09df\u09c7 \u0997\u09c7\u099b\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09b8\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u098f\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u0995\u09c7 \u0986\u09ae\u09bf ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09b0\u09be \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09bf\u09a6\u09c7\u09b0 \u09ac\u09be\u09ac\u09be \u09ac\u09b2\u09c7 \u09a1\u09be\u0995\u09c7 \u0995\u09c7\u09a8 \u0995\u09c7\u0989 \u0995\u09bf \u09ac\u09b2\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7\u09a8 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u098f\u0996\u09a8 \u09ad\u09be\u0997 \u0995\u09b2\u0995\u09be\u09a4\u09be\u09b0 \u09b0\u09be\u09b8\u09cd\u09a4\u09be\u09b0 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b0\u09be \u09b6\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u0987\u09a8\u09cd\u09a1\u09bf\u09af\u09bc\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09a6\u09c7\u09b0 \u09ae\u09c1\u0996\u09c7 \u098f\u0987 \u098f\u0995\u099f\u09be \u09ac\u09c1\u09b2\u09bf \u099b\u09be\u09a1\u09bc\u09be \u0986\u09b0 \u0995\u09cb\u09a8\u09cb \u0995\u09a5\u09be \u09a8\u09be\u0987 \u09b6\u09be\u09b2\u09be \u09a4\u09cb\u09b0\u09be \u098f\u0987 \u09b8\u09be\u09b9\u09be\u09af\u09cd\u09af \u0995\u09b0\u099b\u09bf\u09b2\u09bf \u09a4\u09cb\u09a6\u09c7\u09b0 \u09a8\u09bf\u099c\u09c7\u09a6\u09c7\u09b0 \u09b8\u09be\u09b0\u09a5\u09c7 \u0995\u09be\u09b0\u09a3 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09a6\u09c1\u0987\u09a6\u09bf\u0995\u09c7 \u099b\u09bf\u09b2 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u0986\u09b0 \u09a4\u09cb\u09b0\u09be \u09a8\u09be \u09b8\u09be\u09b9\u09be\u09af\u09cd\u09af \u0995\u09b0\u09b2\u09c7\u0993 \u0986\u09ae\u09b0\u09be \u09b8\u09be\u09a7\u09c0\u09a8 \u09b9\u09a4\u09be\u09ae \u09b9\u09af\u09bc\u09a4 \u098f\u0995\u099f\u09c1 \u09b8\u09ae\u09af\u09bc \u09b2\u09be\u0997\u09a4 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u098f\u09b0 \u09ac\u09bf\u09a8\u09bf\u09ae\u09af\u09bc\u09c7 \u09a4\u09cb\u09b0\u09be \u098f\u0987\u09a6\u09c7\u09b6 \u09a5\u09c7\u0995\u09c7 \u09af\u09c7 \u09aa\u09b0\u09bf\u09ae\u09be\u09a3 \u09b8\u09ae\u09cd\u09aa\u09a6 \u09a8\u09bf\u099b\u09b8 \u09a4\u09be \u09a6\u09bf\u09af\u09bc\u09c7 \u09a4\u09cb\u09a6\u09c7\u09b0 \u098b\u09a3 \u09b6\u09cb\u09a7 \u09b9\u09af\u09bc\u09c7 \u0986\u09b0\u0993 \u09ac\u09c7\u09b6\u09bf \u09b9\u09af\u09bc\u09c7 \u0997\u09c7\u099b\u09c7 \u09a4\u09be\u09b0\u09aa\u09b0 \u0993 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09ae\u09c1\u0996\u09c7 \u098f\u0987 \u098f\u0995 \u09ac\u09c1\u09b2\u09bf \u09ae\u09be\u09a8\u09be\u09af\u09bc \u09a8\u09be \u09ac\u09b0\u0982 \u09b8\u09c7\u0987 \u098f\u09b0 \u09a6\u09bf\u0995\u09c7 \u09a4\u09be\u0995\u09be \u09a4\u09cb\u09a6\u09c7\u09b0 \u09b8\u09be\u09a7\u09c0\u09a8\u09a4\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u09a8\u09bf\u0983\u09b8\u09be\u09b0\u09cd\u09a5 \u09ad\u09be\u09ac\u09c7 \u0995\u09be\u099c \u0995\u09b0\u099b\u09c7 \u098f\u09a6\u09c7\u09b6\u09c7\u09b0 \u098f \u0995\u09c7 \u09ab\u099c\u09b2\u09c1\u09b2 \u09b9\u0995 \u09b8\u09c2\u09b0\u09cd\u09af\u09b8 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u09a4\u09cb \u09a8\u09be\u09b8\u09cd\u09a4\u09bf\u0995\u09c7\u09b0 \u09b0\u09be\u09a4\u09c7\u09b0 \u0996\u09be\u09ac\u09be\u09b0", + "output": [ + "Religious" + ] + }, + { + "input": " \u098f\u0987 \u09a8\u09be \u09b9\u09b2\u09c7 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b0 \u099c\u09be\u09a4 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ac\u09c7\u099c\u09a8\u09cd\u09ae\u09be\u09ae\u09bf\u09a1\u09bf\u09df\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09aa\u0995\u09cd\u09b7 \u09a8\u09bf\u09df\u09be \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u09ac\u09be\u09b2\u0993 \u099b\u09bf\u09dc\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09c7\u09a8\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09b0\u09be \u09ae\u09c1\u09a4 \u0996\u09be\u0993\u09df\u09be\u09b0 \u099c\u09be\u09a4 \u09ae\u09c1\u09a4\u09c7\u09b0 \u0995\u09cb\u09a8\u09cb \u09ad\u09bf\u099f\u09be\u09ae\u09bf\u09a8 \u09a8\u09be\u0987 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ac\u09be\u099a\u09cd\u099a\u09be \u09ae\u09c7\u09df\u09c7\u099f\u09be\u09b0 \u099c\u09c0\u09ac\u09a8 \u09a7\u09cd\u09ac\u0982\u09b8 \u0995\u09b0\u09c7\u099b\u09c7 \u09ae\u09c1\u09b9\u09ae\u09cd\u09ae\u09a6 \u09af\u09be\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf\u09b6\u09cb\u09a7 \u09b9\u09bf\u09b8\u09c7\u09ac\u09c7 \u0986\u09df\u09c7\u09b6\u09be \u09ae\u09c1\u09b9\u09ae\u09cd\u09ae\u09a6\u0995\u09c7 \u09ac\u09bf\u09b7 \u0996\u09be\u0987\u09df\u09c7 \u09b9\u09a4\u09cd\u09af\u09be \u0995\u09b0\u09c7\u099b\u09c7", + "output": [ + "Religious" + ] + }, + { + "input": " \u09aa\u09c3\u09a5\u09bf\u09ac\u09c0\u09b0 \u09b8\u09ac\u099a\u09c7\u09df \u0985\u09b8\u09ad\u09cd\u09af\u099c\u09be\u09a4 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09ae\u09be\u09b2\u09cd\u09b2\u09c1 \u09ae\u09be\u09b2\u09c1 \u099a\u09bf\u09b0 \u0985\u09ad\u09bf\u09b6\u09aa\u09cd\u09a4 \u098f\u09a6\u09c7\u09b0 \u0995\u09be\u09b0\u09a3\u09c7 \u0989\u09aa\u09ae\u09b9\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u0995\u09c7\u0989 \u09b6\u09be\u09a8\u09cd\u09a4\u09bf\u09a4\u09c7 \u09a8\u09c7\u0987 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ac\u09cd\u09af\u09aa\u09be\u09b0\u099f\u09be \u098f\u09ae\u09a8 \u09a8\u09df \u09ac\u0999\u09cd\u0997\u09c7\u09b0 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09b0\u09be \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09ac\u09b2\u09c7 \u09b8\u09ae\u09cd\u09ac\u09cb\u09a7\u09a8 \u0995\u09b0\u09c7 \u09a8\u09be \u09ac\u09b0\u099e\u09cd\u099a \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf \u099a\u09b0\u09ae \u09ae\u09be\u09a4\u09cd\u09b0\u09be\u09b0 \u09ac\u09bf\u09a6\u09cd\u09ac\u09c7\u09b7 \u09a8\u09bf\u09df\u09c7 \u09ac\u09dc \u09b9\u09df \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09b0\u09be \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0\u0995\u09c7 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u0987 \u09a1\u09be\u0995\u09c7 \u09b6\u09c1\u09a7\u09c1 \u09ae\u09c1\u0996 \u09a6\u09bf\u09df\u09c7 \u09aa\u09cd\u09b0\u0995\u09be\u09b6 \u0995\u09b0\u09c7 \u09a8\u09be \u0985\u09b8\u09ad\u09cd\u09af\u09a4\u09be \u09b9\u09df\u09c7 \u09af\u09be\u09ac\u09c7 \u09ac\u09b2\u09c7 \u0985\u09a7\u09bf\u0995\u09be\u0982\u09b6 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u09ae\u09a8\u09c7 \u0995\u09b0\u09c7 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09b0\u09be \u0986\u09b8\u09b2\u09c7\u0987 \u09ac\u09be\u09dc\u09be\u09ac\u09be\u09dc\u09bf \u0995\u09b0\u099b\u09c7 \u098f\u09b0\u09be \u09ac\u09cd\u09b0\u09be\u09b9\u09cd\u09ae\u09a8\u09ac\u09be\u09dc\u09bf\u09df\u09be \u09b9\u09be\u09ae\u09b2\u09be\u0995\u09c7 \u099c\u09be\u09b8\u09cd\u099f\u09bf\u09ab\u09be\u0987 \u0995\u09b0\u09a4\u09c7 \u099a\u09be\u09df \u0995\u09cd\u09ac\u09be\u09ac\u09be\u09b0 \u0989\u09aa\u09b0\u09c7 \u09b6\u09bf\u09ac\u09c7\u09b0 \u099b\u09ac\u09bf\u099f\u09be \u09a6\u09bf\u09df\u09c7 \u09aa\u09b6\u09c1\u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0\u0995\u09c7 \u09af\u09be\u09b0\u09be \u099c\u09be\u09a8\u09cb\u09df\u09be\u09b0 \u0995\u09bf\u0982\u09ac\u09be \u09aa\u09b6\u09c1 \u09a8\u09be\u09ae\u09c7 \u09a1\u09be\u0995\u099b\u09a8\u09c7 \u09a4\u09be\u09b0\u09be \u09ad\u09c7\u09ac\u09c7 \u09ac\u09b2\u09c7\u09a8 \u09a4\u09cb \u0986\u09a6\u09a4\u09c7 \u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09bf \u0995\u09bf \u0995\u09cb\u09a8 \u09ad\u09c1\u09b2 \u0995\u09a5\u09be \u09ac\u09b2\u09c7\u099b\u09c7\u09a8 \u098f\u099f\u09be \u09a4\u09cb \u09b8\u0995\u09b2 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09c7\u09b0 \u09ae\u09a8\u09c7\u09b0 \u0995\u09a5\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09a6\u09c7\u09b0 \u09ad\u09be\u09b0\u09a4 \u09aa\u09be\u099f\u09be\u09a4\u09c7 \u09b9\u09ac\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09be\u0989\u09a8 \u0995\u09c0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u0995\u09be\u09ad\u09bf \u09a8\u09c7\u09b9\u09bf \u0986\u099a\u09cd\u099b\u09be \u099c\u09cb \u09ad\u09bf \u0986\u099a\u09cd\u099b\u09be \u0993 \u09b6\u09c1\u09df\u09cb\u09b0 \u0995\u09bf \u09ac\u09be\u099a\u09cd\u099b\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09a6\u09c7\u09b0 \u09ac\u09c7\u09b6\u09bf \u0995\u09b0\u09c7 \u09ae\u09be\u09b0\u09c1\u09a8", + "output": [ + "Religious" + ] + }, + { + "input": "\u0986\u09ae\u09be\u09b0 \u09a7\u09a8\u09c7\u09b0\u09be \u09b8\u09be\u09b0\u09cd\u09ac\u099c\u09a8\u09c0\u09a8 \u099a\u09cb\u09a6\u09be\u0993 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09be\u09a8\u09ac\u09a4\u09be \u099a\u09c1\u09a6\u09be\u099b \u0995\u09bf \u09ac\u09be\u09b2\u09c7\u09b0 \u09aa\u09dc\u09be\u09b6\u09c1\u09a8\u09be \u0995\u09b0\u099b\u099a \u09a4\u09c1 \u09af\u09a6\u09bf \u09b9\u09c7\u09a1\u09be\u09ae \u09a5\u09be\u0995\u09c7 \u099c\u09be\u0995\u09bf\u09b0 \u09a8\u09be\u09df\u09c7\u0995 \u098f\u09b0 \u09b8\u09be\u09a5\u09c7 \u09ac\u09b8\u09bf\u099b \u09a4\u09c1\u09b0 \u09b9\u09c7\u09a1\u09be\u09a4\u09c7 \u0995\u09a4 \u09b0\u09b8 \u0986\u099b\u09c7 \u09a6\u09c7\u0996\u09ae\u09c1 \u099a\u09bf \u09a4\u09c1\u09b0 \u09ae\u09be \u09ac\u09be\u09ac\u09be\u09b0 \u09aa\u09be\u09aa\u09c7\u09b0 \u09ab\u09b8\u09b2 \u09a4\u09c1\u0987 \u09ae\u09be\u0997\u09bf ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09b9\u099c\u09ae \u09b8\u0995\u09cd\u09a4\u09bf \u09a8\u09be\u0987 \u09ac\u09c7\u099f\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u0986\u09aa\u09a8\u09be\u09b0 \u09ae\u09a4 \u0985\u09a8\u09c7\u0995 \u09ae\u09be\u09b0\u0996\u09c7\u09df\u09c7 \u09ae\u09b0\u09a4\u099b\u09c7 \u09ac\u09be\u0997\u09cd\u0997\u09bf\u09b8 \u09a6\u09c1\u09a6\u09c1\u0995 \u09a8\u09bf\u09b0\u09be\u09aa\u09cd\u09a4\u09be \u09a6\u09bf\u099b\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u09ae\u09be\u09a8\u09c7\u0987 \u099c\u09bf\u09b9\u09be\u09a6\u09c0 \u099c\u0999\u09cd\u0997\u09bf\u09ac\u09be\u09a6", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u09a4\u09c1\u09b0 \u09a6\u09c7\u09b6\u09c7\u09b0 \u09a8\u09be \u09ae\u09be \u098f\u09b0 \u09a8\u09df \u09a4\u09c1\u0987 \u09a8\u09df \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09b0 \u09a8\u09df \u09ae\u09cb\u09b8\u09b2\u09bf\u09ae\u09c7\u09b0 \u09a4\u09c1\u0987 \u09b9\u09b2\u09bf \u09b6\u09df\u09a4\u09be\u09a8\u09c7\u09b0 \u09b6\u09c1\u09a7\u09c1 \u09b6\u09df\u09a4\u09be\u09a8\u09c7\u09b0 \u09b9\u09be\u09b0\u09be\u09ae\u09af\u09be\u09a6\u09be \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099b\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": " \u098f\u09ae\u09a8 \u09ae\u09be\u09df\u09be \u0995\u09be\u09a8\u09cd\u09a8\u09be \u0995\u09b0\u09bf\u09b8 \u09a8\u09be \u09b8\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0\u09be \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u098f\u09a4\u09cb \u0998\u09a8 \u0998\u09a8 \u0995\u09c7\u09a8\u09cb \u0986\u09b8\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0985\u09ac\u09c8\u09a7 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09a6\u09c7\u09b0 \u09b2\u09be\u09a5 \u09ae\u09c7\u09b0\u09c7 \u09a4\u09be\u0981\u09a1\u09bc\u09be\u09a8\u09cb \u09b9\u09cb\u0995", + "output": [ + "Religious" + ] + }, + { + "input": "\u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09a6\u09c7\u09b0 \u0987\u09a4\u09bf\u09b9\u09be\u09b8 \u0986\u0997\u09c7 \u09aa\u09dc\u09c7 \u09a6\u09c7\u0996 \u09a4\u09be\u09b0\u09aa\u09b0 \u09ac\u09b2\u09bf\u09b8 \u0993\u09b0\u09be \u09b8\u09cd\u09ac\u09be\u09a7\u09bf\u09a8 \u099b\u09bf\u09b2 \u0995\u09bf\u09a8\u09be \u09a4\u09be\u09b0\u09aa\u09b0 \u09aa\u09be\u0995 \u09ad\u09be\u09b0\u09a4 \u0986\u09b2\u09be\u09a6\u09be\u09b0 \u09b8\u09ae\u09df \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09b0\u09be \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09af\u09c1\u0995\u09cd\u09a4 \u09b9\u09a4\u09c7 \u099a\u09c7\u09df\u09c7\u099b\u09bf\u09b2 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u099c\u09bf\u09a8\u09cd\u09a8\u09be\u09b9 \u09a8\u09c7\u09a8\u09a8\u09bf \u09aa\u09b0\u09c7 \u09ae\u09be\u09df\u09be\u09a8\u09ae\u09be\u09b0\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09af\u09c1\u0995\u09cd\u09a4 \u09b9\u09df \u09a4\u0996\u09a8 \u0993 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09a6\u09c7\u09b0 \u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0 \u0993 \u099b\u09bf\u09b2 \u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0 \u09b8\u09ad\u09be\u09df \u09b8\u09be\u09ae\u09b0\u09bf\u0995 \u09b6\u09be\u09b8\u09a8 \u09b6\u09c1\u09b0\u09c1\u09b0 \u09aa\u09b0 \u0986\u09ac\u09be\u09b0 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u09a6\u09c7\u09b0 \u09a6\u09c1\u09b0\u09cd\u0997\u09a4\u09bf \u09b6\u09c1\u09b0\u09c1 \u09b9\u09df \u09a4\u09c1\u0987 \u09a4\u09cb \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09a4\u09be\u0987 \u09a4\u09cb\u09b0\u09be \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09ae\u09b0\u09bf\u09b2\u09c7 \u0996\u09c1\u09b6\u09c0 \u09b9\u09b8 \u09ad\u09be\u09b0\u09a4\u09c7 \u0993 \u09ac\u09bf\u09a8\u09be \u0985\u09aa\u09b0\u09be\u09a7\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09b9\u09a4\u09cd\u09af\u09be \u0995\u09b0\u09bf\u09b8 \u0986\u09b0 \u0986\u09b0 \u098f\u0996\u09be\u09a8\u09c7 \u09ac\u09cd\u09b0\u09c7\u0987\u09a8 \u09a6\u09c7\u0996\u09be\u09b8 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u09aa\u09c7\u099f\u09c7 \u09a6\u09be\u0981\u09a4 \u098f\u09ae\u09a8\u09bf \u09ac\u09b2\u09be \u09b9\u09df\u09a8\u09be \u0986\u09b0 \u099a\u09c0\u09a8 \u0993 \u09a4\u09bf\u09a8 \u09b9\u09be\u099c\u09be\u09b0 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be\u0995\u09c7 \u0986\u09b6\u09cd\u09b0\u09df \u09a6\u09bf\u09df\u09c7\u099b\u09c7 \u0986\u09b0 \u0986\u09ae\u09bf \u0995\u09bf \u09b2\u09c7\u0996\u09c7\u099b\u09bf \u09ad\u09be\u09b2 \u0995\u09b0\u09c7 \u09af\u09a6", + "output": [ + "Religious" + ] + }, + { + "input": " \u0986\u09b0\u09c7 \u09b6\u09be\u09b2\u09be\u09b0\u09be \u09ae\u09c1\u09b6\u09b2\u09bf\u09ae\u09b0\u09be \u09aa\u09b6\u09c1 \u09a8\u09df \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09b0\u09be\u0987 \u09aa\u09b6\u09c1 \u09ac\u09cc\u09a6\u09cd\u09a7\u09b0\u09be \u0995\u09c7\u09a8 \u09a4\u09ac\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0\u0995\u09c7 \u09ae\u09be\u09b0\u099b\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0986\u09b8\u09be\u09ae\u09c7\u09b0 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09a6\u09c7\u09b0 \u09a4\u09be\u09b0\u09bf\u09df\u09c7 \u09a6\u09c7\u0993\u09af\u09bc\u09be \u09b9\u09cb\u0995 \u0995\u09be\u09b0\u09a3 \u098f\u09b0\u09be \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7 \u09a8\u09df ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09b8\u09a4\u09cd\u09af\u09bf \u09af\u09a6\u09bf \u099c\u09a8\u0995\u09c7 \u09b6\u09b9\u09c0\u09a6 \u0995\u09b0\u09be \u09b9\u09df \u098f\u09b0 \u09ac\u09a6\u09b2\u09c7 \u09a4\u09be\u09b0\u09a4\u09c0\u09df \u099c\u09a8 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u0995\u09c7 \u099c\u09be\u09b9\u09be\u09a8\u09cd\u09a8\u09be\u09ae\u09c7 \u09aa\u09be\u09a0\u09a8\u09cb \u09b9\u09ac\u09c7 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09b0\u09be \u09b0\u09c7\u09a1\u09bf \u09a5\u09be\u0995 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09be\u0989\u09a8\u0995\u09c7 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09ac\u09b2\u09b2\u09c7 \u09a4\u09cb\u09ae\u09be\u09a6\u09c7\u09b0 \u0997\u09be\u09df\u09c7 \u09b2\u09be\u0997\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a8\u09a6\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09af\u0996\u09a8 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0\u09be \u0985\u09ae\u09be\u09a8\u09ac\u09bf\u0995 \u09a8\u09bf\u09b0\u09cd\u09af\u09be\u09a4\u09a8 \u0995\u09b0\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09ac\u09b2\u09be\u09b0 \u09b8\u09be\u09a5\u09c7 \u09b8\u09be\u09a5\u09c7 \u09a6\u09c7\u09b6\u09c7\u09b0 \u09a5\u09c7\u0995\u09c7 \u09b8\u09b0\u0995\u09be\u09b0 \u09b8\u09ac\u09be\u0987 \u09aa\u09cd\u09b0\u09a4\u09bf\u09ac\u09be\u09a6 \u09ae\u09c1\u0996\u09b0 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0986\u09ae\u09bf \u09b8\u09a4\u09cd\u09af\u09bf\u0987 \u09ac\u09b2\u099b\u09bf \u098f\u0987 \u0995\u09be\u099c\u099f\u09bf \u09ad\u09b0\u09b0\u09b0\u09a4\u09c0\u09df \u0997\u09cb\u09df\u09c7\u09a8\u09cd\u09a6\u09be \u09b8\u0982\u09b8\u09cd\u09a5\u09be \u09b0 \u0993 \u09b8\u09a8\u09cd\u09a4\u09cd\u09b0\u09be\u09b8 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09a6\u09c7\u09b0 \u0995\u09be\u099c \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8 \u0993 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u0986\u09ae\u09b0\u09be \u09b8\u09ac\u09be\u0987 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c0 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09ae\u09a7\u09cd\u09af \u099d\u09be\u09ae\u09c7\u09b2\u09be \u09a8\u09be\u0987 \u09ad\u09b0\u09b0\u09b0\u09a4 \u09b8\u09c7\u099f\u09be \u09aa\u099b\u09a8\u09cd\u09a6 \u0995\u09b0\u09c7\u09a8\u09be \u09ac\u09b2\u09c7\u0987 \u0986\u09ae\u09be\u09b0 \u09a6\u09c7\u09b6\u09c7\u09b0 \u099d\u09be\u09ae\u09c7\u09b2\u09be \u0995\u09b0\u09a4\u09c7 \u099a\u09be\u09df", + "output": [ + "Religious" + ] + }, + { + "input": "\u098f\u0996\u09a8 \u09b2\u09be\u0997\u09bf\u09a4\u09c7\u099b\u09c7 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09a6\u09c7\u09b0 \u09ac\u09be\u09dc\u09bf \u0998\u09b0 \u09aa\u09c1\u09dc\u09bf\u09df\u09c7 \u0996\u09c1\u0989\u09ac \u0986\u09b0\u09be\u09ae \u09aa\u09c7\u09df\u09c7\u099b\u09bf\u09b2", + "output": [ + "Religious" + ] + }, + { + "input": "\u09b6\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u0986\u09ac\u09be\u09b0 \u09b6\u09cd\u09b0\u09c7\u09b7\u09cd\u09a0 \u09b6\u09bf\u0995\u09cd\u09b7\u0995", + "output": [ + "Religious" + ] + }, + { + "input": " \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09a4\u09cb\u09a6\u09c7\u09b0\u0995\u09c7 \u098f\u0987 \u099c\u09a8\u09cd\u09af\u0987 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09ac\u09b2\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a4\u09c1\u09b0 \u099f\u09be\u0987\u09ae\u09b2\u09be\u0987\u09a8\u09c7 \u0995\u09bf\u099b\u09c1 \u09a8\u09be\u0987 \u09a4\u09c1\u0987 \u09b8\u09be\u09b2\u09be \u0986\u09b8\u09b2\u09c7 \u09ae\u09be\u09b2\u09be\u0989\u09a8 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09b8\u09be\u09ae\u09cd\u09aa\u09cd\u09b0\u09a6\u09be\u09df\u09bf\u0995 \u09a6\u09c7\u09b6 \u09b8\u09be\u09ae\u09a8\u09c7 \u0986\u09df \u09a4\u09cb\u09b0 \u09b8\u09be\u09ae\u09cd\u09aa\u09cd\u09b0\u09a6\u09be\u09df\u09bf\u0995\u09a4\u09be \u09a4\u09cb\u09b0 \u09ae\u09be\u09df\u09c7\u09b0", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u099c\u09be\u09a4 \u09a1\u09be\u09a8\u09cd\u09a1\u09bf \u09ae\u09be\u09a8\u09c7\u0987 \u09ad\u09c0\u09a4\u09c1 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0995\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09a6\u09ae \u0986\u099b\u09c7 \u09a4\u09cb \u09ad\u09be\u09b0\u09a4\u09c7 \u0995\u09b0\u09c7 \u09a6\u09c7\u0996\u09be \u09a4\u09cb\u09a6\u09c7\u09b0 \u0997\u09be\u09a1\u09bc \u09ab\u09be\u099f\u09bf\u09af\u09bc\u09c7 \u09a6\u09c7\u09ac ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09ae\u09b0\u09b2\u09c7 \u0986\u09a8\u09a8\u09cd\u09a6 \u09aa\u09be\u09af\u09bc\u09a8\u09be \u09af\u09c7 \u099c\u09a8 \u0995\u09c7 \u09ac\u09b2\u09c7 \u09ae\u09be\u09a8\u09c1\u09b7 \u09a4\u09be\u09b0\u09c7 \u0986\u09ae\u09cd\u09b2\u09bf\u0997 \u09b8\u09c7 \u099c\u09a8 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09a4\u09b0 \u09ae\u09be\u0995\u09c7 \u099a\u09cb\u09a6\u09be \u09b6\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099b\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0987\u09b9\u09c1\u09a6\u09c0\u09b0\u09be \u09ae\u09be\u09a8\u09c1\u09b7 \u0996\u09be\u09b0\u09be\u09aa", + "output": [ + "Religious" + ] + }, + { + "input": "\u0987\u09a8\u09cd\u09a1\u09bf\u09af\u09bc\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u0997\u09cb\u09b7\u09cd\u09a0\u09c0 \u09ac\u09c7\u09b6\u09bf \u09b8\u09c7 \u099c\u09a8\u09cd\u09af \u0986\u09b9 \u0995\u09be\u09ae \u0995\u09c1\u0995\u09be\u09ae \u0995\u09b0\u09c7 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09b0\u09be \u0987\u09a8\u09cd\u09a1\u09bf\u09af\u09bc\u09be \u0997\u09c7\u099b\u09c7 \u0990 \u09ae\u09be\u09b2\u09be\u0989\u09a6\u09c7\u09b0 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u0995\u09be\u099b\u09c7 \u09a6\u09b0\u09bf \u09a6\u09c7 \u09b0\u09be\u09ae \u09a6\u09cb\u09b2\u09be\u0987 \u09a6\u09bf\u09af\u09bc\u09c7 \u09a6\u09bf\u09ac\u09cb", + "output": [ + "Religious" + ] + }, + { + "input": "\u0987\u09b8\u09b2\u09be\u09ae \u09ae\u09be\u09a8\u09c7 \u0985\u09b6\u09be\u09a8\u09cd\u09a4\u09bf \u09a7\u09b0\u09cd\u09ae ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09af\u09c7 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u0995\u09be\u09b0\u09a3\u09c7 \u098f\u0987 \u0998\u099f\u09a8\u09be \u09a4\u09be\u09b0 \u0996\u09ac\u09b0 \u0995\u09bf \u09a4\u09be\u09b0 \u09a4\u09be\u09a6\u09c7\u09b0 \u09b6\u09be\u09b8\u09cd\u09a4\u09bf \u09b9\u09ac\u09c7 \u09a4\u09cb ", + "output": [ + "Religious" + ] + }, + { + "input": " \u098f \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ae\u09c1\u0996\u09c7 \u099c\u09c1\u09a4\u09be \u09ae\u09be\u09b0\u09c7\u09a8 \u09b8\u09ac\u09be\u0987 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u0995\u09be\u09a6\u09be \u099b\u09dc\u09be \u099b\u09c1\u09dc\u09bf \u09b6\u09c1\u09b0\u09c1 \u09b0\u09be\u099c\u09a8\u09c8\u09a4\u09bf\u0995 \u09ad\u09be\u09ac\u09c7 \u0995\u09c7 \u0995\u09a4\u099f\u09be \u09b2\u09be\u09ad\u09ac\u09be\u09a8 \u09b9\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 \u09a4\u09be\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf\u09af\u09cb\u0997\u09c0\u09a4\u09be \u09b6\u09c1\u09b0\u09c1 \u09ab\u09b2\u09be\u09ab\u09b2 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u0996\u09c7\u09df\u09c7 \u0997\u09c7\u09b2\u09cb \u099c\u0982\u0997\u09bf\u09ac\u09be\u09a6\u09bf \u09ae\u09cc\u09b2\u09ac\u09be\u09a6\u09bf\u09b0 \u099c\u09df \u09b9\u09b2\u09cb ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09af\u09c7 \u0995\u09cb\u09a8\u09cb \u09ad\u09be\u09ac\u09c7 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u0986\u09ae\u09a6\u09be\u09a8\u09bf \u0995\u09b0\u09c7", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a4\u09b0 \u09ae\u09be \u0995\u09c7 \u099a\u09cb\u09a6\u09c0 \u09b6\u09be\u09b2\u09bf \u09a6\u09c7\u09b9 \u09ac\u09cd\u09af\u09ac\u09b8\u09be\u09df\u09c0 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09b8\u09ac \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09ae\u09c7\u09df\u09c7\u09b0\u09be \u0998\u09b0\u09c7 \u0998\u09b0\u09c7 \u0987\u09ae\u09c1 \u09b8\u09c7\u0995\u09cd\u09b8 \u0995\u09b0\u09c7 \u09b0\u09cb\u099c\u0997\u09be\u09b0 \u0995\u09b0\u09c7 \u09ad\u09be\u09a4 \u0996\u09be\u09df", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a4\u09c1\u09b0 \u09ae\u09a4\u09cb \u09a8\u09be\u09b8\u09cd\u09a4\u09bf\u0995\u09b0\u09be \u09b8\u09a4\u09cd\u09af \u0986\u09b0 \u09ae\u09bf\u09a5\u09cd\u09af\u09be\u09b0 \u09aa\u09be\u09b0\u09cd\u09a5\u0995\u09cd\u09af \u0995\u09bf \u09ac\u09c1\u099d\u09ac\u09bf ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09c3\u09a4\u09cd\u09af\u09c1 \u09aa\u09b0\u09cd\u09af\u09a8\u09cd\u09a4 \u0985\u09aa\u09c7\u0995\u09cd\u09b7\u09be \u0995\u09b0 \u09a4\u0996\u09a8 \u09ac\u09c1\u099d\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09bf \u0986\u09b8\u09cd\u09a4\u09bf\u0995 \u09a8\u09be\u0995\u09bf \u09a8\u09be\u09b8\u09cd\u09a4\u09bf\u0995 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09a4\u09b0 \u09ae\u09bf\u099f\u09bf\u09df\u09be\u09c0 \u0997\u09c1\u09b8\u099f\u09bf \u099a\u09c1\u09a6\u09bf \u09a4\u09b0\u09c7 \u0995\u09c7 \u09ac\u09b2\u099b\u09c7 \u09ac\u09a1\u09be\u09b0\u09c7 \u0997\u09bf\u09df\u09c7 \u09b8\u09ac\u09be\u09a6 \u09b9\u099b\u09be\u09b0 \u0995\u09b0\u09be\u09b0 \u099c\u09a8 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099b\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0987\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09a8 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u0997\u09c1\u09b2\u09be \u0986\u09b8\u09cd\u09a4 \u09ac\u09c7\u09df\u09be\u09a6\u09ac \u0989\u0997\u09cd\u09b0 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09a7\u09c1\u09b0 \u09b6\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09ae\u09be\u09a6\u09be\u09b0\u099a\u09c1\u09a6\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09be\u0989\u09a8\u09a6\u09c7\u09b0 \u09b8\u09cd\u09ac\u09ad\u09be\u09ac \u098f\u099f\u09be \u0995\u09be\u09b0 \u099f\u09be\u0995\u09be \u0995\u09cb\u09a8 \u09a6\u09bf\u0995\u09c7 \u0996\u09be\u09ac\u09c7 \u098f\u0987 \u0995\u09be\u099c \u09a4\u09be\u09a6\u09c7\u09b0 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09c7\u09b6\u09c7\u09b0 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09a6\u09c7\u09b0 \u0998\u09be\u09dc \u09a7\u09be\u0995\u09cd\u0995\u09be \u09a6\u09bf\u09df\u09c7 \u09a6\u09c7\u09b6 \u09a5\u09c7\u0995\u09c7 \u09ac\u09c7\u09b0 \u0995\u09b0\u09c7 \u09a6\u09c7\u0993\u09df\u09be \u0989\u099a\u09bf\u09a4", + "output": [ + "Religious" + ] + }, + { + "input": " \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09ae\u09bf\u09a1\u09bf\u09df\u09be \u098f\u0996\u09a8 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09a6\u09c7\u09b6\u09c7\u09b0 \u0996\u09ac\u09b0 \u09aa\u09cd\u09b0\u099a\u09be\u09b0 \u0995\u09b0\u09c7\u09a8\u09be \u0995\u09c7\u09a8 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09a4\u09cb\u09a6\u09c7\u09b0\u0995\u09c7\u0993 \u09af\u09ac\u09be\u0987 \u0995\u09b0\u09c7 \u09ae\u09be\u09b0\u09be \u0989\u099b\u09bf\u09a4 \u09b6\u09b2\u09be \u09b9\u09be\u09b0\u09be\u09ae\u09bf\u09b0\u09ad\u09be\u099a\u099b\u09be \u09a8\u09be\u099b\u09a5\u09bf\u0995 \u099c\u09be\u09a8\u09cb\u09af\u09bc\u09be\u09b0 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u0995\u09c1\u09b2\u09be\u0982\u0997\u09be\u09b0 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0987\u09b8\u09b2\u09be\u09ae\u09c7 \u09ae\u09be\u09b0\u09c7 \u099a\u09c1\u09a6\u09c7\u099b\u09c7 \u0987\u09b8\u09b2\u09be\u09ae\u09c7 \u09ae\u09be\u09b0\u09c7 \u09a8\u09be\u09ad\u09bf \u099a\u09c1\u09a6\u09be \u09ad\u09cb\u09a6\u09be \u09a6\u09c1\u09a6\u09c1 \u09ad\u09cb\u09a6\u09be \u09a6\u09c1\u09a6\u09c1 \u099a\u09c1\u09a6\u09bf \u09a4\u09cb\u09a6\u09c7\u09b0 \u09ae\u09be\u09b9\u09bf\u09b2\u09be\u09a6\u09c7\u09b0 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u0995\u09bf \u09ac\u09b2\u09c7 \u099c\u09c1\u09a4\u09be \u09ae\u09be\u09b0\u09c7\u09a8 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09be\u0997\u09c0\u099a\u09c1\u09a6\u09be \u09a8\u09be\u09b8\u09cd\u09a4\u09bf\u0995 \u09a4\u09b0\u09ae\u09be\u09b0\u09c7 \u099a\u09c1\u0987\u09a6\u09be \u09aa\u09cd\u09b0\u09ae\u09be\u09a8 \u0995\u09b0 \u09a4\u09c1\u0987 \u09b8\u09a4\u09cd\u09a4\u09bf\u0995\u09be\u09b0\u09c7\u09b0 \u09a8\u09be\u09b8\u09cd\u09a4\u09bf\u0995", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ac\u09dc \u09ac\u09be\u09b2 \u09ab\u09be\u09b2\u09be\u0987\u099b\u09c7 \u0995\u09c7\u09a8 \u0995\u09bf\u09a8\u09b2\u09c7\u09ac\u09be \u0995\u09bf \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u098f\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09b0\u09be \u098f\u0996\u09a8\u09cb \u09ac\u09c7\u09b9\u09c7\u09b6\u09a4\u09c7 \u0986\u099b\u09c7 \u09a4\u09c1\u0987 \u0995\u09bf \u099c\u09be\u09a8\u09bf\u09b8 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u099c\u09a8\u0997\u09a8\u09c7\u09b0 \u09b8\u09be\u09ae\u09a8\u09c7 \u09a4\u09cb\u09b0 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09ac\u09be\u09ac\u09be\u09a6\u09c7\u09b0 \u09b8\u09be\u09ae\u09a8\u09c7 \u0993\u09aa\u09c7\u09a8 \u099a\u09cd\u09af\u09be\u09b2\u09c7\u099e\u09cd\u099c \u09b9\u09ac\u09c7 \u09ae\u09be\u09a6\u09be\u09b0\u099a\u09c1\u09a6", + "output": [ + "Religious" + ] + }, + { + "input": "\u09aa\u09c3\u09a5\u09bf\u09ac\u09c0\u09b0 \u09b8\u09ac\u09a5\u09c7\u0995\u09c7 \u09ae\u09bf\u09a5\u09cd\u09af\u09be\u09ac\u09be\u09a6\u09c0 \u09a7\u09b0\u09cd\u09ae \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a4\u09cd\u09b0 \u09b2\u09be\u0987\u0995\u09be\u09b0 \u09ac\u09df \u09b8\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09ac\u09c7\u09b6\u09bf \u09aa\u0995\u09aa\u0995 \u0995\u09b0\u09ac\u09bf \u09aa\u09be\u099b\u09be\u09df \u09b2\u09be\u09a5\u09bf \u09ae\u09c7\u09b0\u09c7 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09b8\u09cd\u09a5\u09be\u09a8 \u09aa\u09be\u09a0\u09bf\u09df\u09c7 \u09a6\u09c7\u09ac \u0993\u0996\u09be\u09a8\u0995\u09be\u09b0 \u09ae\u09be\u09b2\u09c1\u09b0\u09be \u09a4\u09cb\u0995\u09c7 \u09aa\u09c1\u09b0\u09bf\u09df\u09c7 \u09a8\u09c7\u09ac\u09c7 \u09b8\u09be\u09b2\u09be \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09aa\u0995\u09aa\u0995 \u0995\u09b0\u09cb\u099b", + "output": [ + "Religious" + ] + }, + { + "input": "\u09b8\u09ae\u09df \u099f\u09bf\u09ad\u09bf\u09b0 \u09ae\u09be\u09b2\u09bf\u0995 \u09af\u09c7 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u09ac\u0982\u09b6\u09a7\u09b0 \u098f\u099f\u09be \u09b8\u09ac\u09be\u0987 \u099c\u09be\u09a8\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u09b9\u09be\u09b2\u09be \u09a6\u09be\u09b2\u09be\u09b2 \u09a4\u09cb\u09b0 \u09b9\u09bf\u09a8\u09a6\u09c1 \u09ac\u09be\u09aa\u09c7\u09b0\u09be \u09ad\u09be\u09b0\u09a4\u09c7 \u09ae\u09c1\u09b8\u09b2 \u09ae\u09be\u09a8\u09a6\u09c7\u09b0 \u0993\u09aa\u09b0 \u0995\u09bf \u09ad\u09be\u09ac\u09c7 \u0985\u09a4\u09be\u099a\u09be\u09b0 \u0995\u09b0\u09bf\u099b\u09c7", + "output": [ + "Religious" + ] + }, + { + "input": "\u098f\u09a8 \u099c\u09bf \u0993 \u09ac\u09a8\u09cd\u09a7 \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0 \u09aa\u09bf\u09b8 \u099f\u09bf\u09ad\u09bf \u09ac\u09a8\u09cd\u09a7 \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09cb \u0995\u09bf\u09a8\u09cd\u09a4 \u09b8\u09a4\u09cd\u09af\u0995\u09c7 \u09b2\u09c1\u0995\u09be\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09c7\u09a8\u09be \u09b8\u09a4\u09cd\u09af \u09aa\u09cd\u09b0\u0995\u09be\u09b6\u09bf\u09a4 \u09b9\u09ac\u09c7\u0987 \u09b8\u09a4\u09cd\u09af \u09aa\u09cd\u09b0\u099a\u09be\u09b0 \u0987\u09b8\u09b2\u09be\u09ae \u09aa\u09cd\u09b0\u099a\u09be\u09b0 \u0993 \u09aa\u09cd\u09b0\u09b8\u09be\u09b0 \u0985\u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u09b8\u09be\u0997\u09cd\u09b0\u09b9\u09c7 \u0987\u09b8\u09b2\u09be\u09ae \u0997\u09cd\u09b0\u09b9\u09a3 \u09ae\u09be\u09b2\u09c1\u09b0\u09be \u09b9\u09bf\u0982\u09b8\u09be\u09df \u09aa\u09c1\u09dc\u09c7 \u09ac\u09bf\u09a8\u09be \u0985\u09aa\u09b0\u09be\u09a7\u09c7 \u09aa\u09bf\u09b8 \u099f\u09bf\u09ad\u09bf \u0993 \u0986\u0987 \u0986\u09b0 \u098f\u09ab \u098f\u09b0 \u0989\u09aa\u09b0 \u09a8\u09bf\u09b7\u09c7\u09a7\u09be\u099c\u09cd\u099e\u09be \u099c\u09be\u09b0\u09bf \u0995\u09b0\u09b2 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09ac\u09bf\u09a6\u09cd\u09ac\u09c7\u09b7\u09c0 \u09ac\u0995\u09cd\u09a4\u09ac\u09cd\u09af\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09a1\u09cb\u09a8\u09be\u09b2\u09cd\u09a1 \u099f\u09cd\u09b0\u09be\u09ae\u09cd\u09aa \u0995\u09c7 \u09b8\u09ae\u09b0\u09cd\u09a5\u09a8 \u0993 \u09ac\u09bf\u09a8\u09be \u0995\u09be\u09b0\u09a8\u09c7 \u09ac\u09a8\u09cd\u09a7 \u0995\u09b0\u09be\u09df \u0986\u099c\u0995\u09c7 \u09ae\u09a8\u09c7 \u09aa\u09cd\u09b0\u09be\u09a3\u09c7 \u09ac\u09bf\u09b6\u09cd\u09ac\u09be\u09b8 \u0995\u09b0\u09bf \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u0995\u09be \u09ac\u09be\u099a\u09cd\u099a\u09be \u0995\u09be\u09ad\u09bf \u09a8\u09be\u09b9\u09bf \u0986\u099a\u09cd\u099b\u09be", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09be \u098f\u09ac\u09be\u09b0 \u09ac\u09c1\u099c \u09a0\u09c7\u09b2\u09be \u0995\u09be\u09b0\u09c7 \u0995\u09df", + "output": [ + "Religious" + ] + }, + { + "input": " \u09a4\u09b0 \u09aa\u09cd\u09b0\u09ab\u09be\u0987\u09b2 \u09a8\u09c7\u0987\u09ae \u099f\u09be \u0986\u09ae\u09bf \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09b9\u09bf\u099c\u09b0\u09be \u09b2\u09bf\u0996\u09be \u0989\u099a\u09bf\u09ce \u099b\u09bf\u09b2 \u09a4\u09c1\u0987 \u09ac\u09c7\u09b7\u09cd\u09af\u09be \u09ae\u09be\u0997\u09bf\u09b0 \u09aa\u09c1\u09a4 \u09a8\u09c7\u0982\u099f\u09bf \u09a6\u09be\u09a4\u09c1 \u099a\u09c1\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u099a\u09be \u09a4\u09b0 \u09ae\u09be \u09a4\u09b0 \u099a\u09be\u099a\u09be \u099c\u09c7\u09a0\u09be \u09ae\u09be\u09ae\u09be \u0996\u09be\u09b2\u09c1 \u09b8\u09ac\u09be\u09b0 \u09b8\u09be\u09a5\u09c7 \u099a\u09c1\u09a6\u09be \u09a6\u09bf\u09df\u09be \u09a4\u09b0\u09c7 \u09b8\u0982\u09ae\u09bf\u09b8\u09c3\u09a4 \u09b8\u09a8\u09cd\u09a4\u09be\u09a8 \u09aa\u09df\u09a6\u09be \u0995\u09b0\u099b\u09c7 \u09a4\u09b0 \u09ae\u09be\u09b0\u09c7 \u099a\u09c1\u09a6\u09bf \u09a6\u09be\u09a4\u09c1 \u099a\u09bf\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u099a\u09be \u09a4\u09b0 \u09ae\u0989\u09a4 \u09ae\u09cb\u09b8\u09b2\u09ae\u09be\u09a8\u09c7\u09b0 \u09b9\u09be\u09a4\u09c7 \u09ae\u09a8\u09c7\u09b0\u09be\u0996\u09bf\u09b8 \u0987\u09a8\u09b8\u09be \u0986\u09b2\u09cd\u09b2\u09be\u09b9 \u09a4\u09cb\u09b0 \u0986\u09b8\u09c7\u09aa\u09be\u09b8\u09c7\u0987 \u0995\u09cb\u09a8 \u0988\u09ae\u09be\u09a8\u09a6\u09be\u09b0 \u09a4\u09cb\u0995\u09c7 \u09a8\u099c\u09b0\u09c7 \u09b0\u09be\u0996\u099b\u09c7 \u0995\u09be\u09ab\u09c7\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u099a\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": " \u099c\u09a8\u09c7\u09b0 \u09aa\u09b0\u09bf\u09ac\u09b0\u09cd\u09a4\u09c7 \u099c\u09a8 \u09ad\u09be\u09b0\u09a4\u09bf\u0993 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u0995\u09c7 \u0998\u09a8\u09cd\u099f\u09be\u09b0 \u09ad\u09bf\u09a4\u09b0 \u09b9\u09a4\u09cd\u09af\u09be \u0995\u09b0\u09be \u09b9\u09cb\u0989\u0995 \u0986\u09b0 \u0986\u09ae\u09bf \u099c\u09be\u09a8\u09bf \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09a4\u09cb\u09ae\u09b0\u09be \u09b8\u09c7\u099f\u09be \u09aa\u09be\u09b0\u09ac\u09c7 \u098f\u09ac\u0982 \u0995\u09b0\u09ac\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u098f\u0995\u099f\u09be \u09aa\u09c7\u099c\u09c7 \u099b\u09be\u0997\u09c1\u09b0\u09be \u09a4\u09b0\u09cd\u0995 \u0995\u09b0\u099b\u09c7 \u098f\u0995 \u099b\u09be\u0997\u0989 \u09ac\u09b2\u099b\u09c7 \u09ac\u09cb\u09b0\u0996\u09be \u099f\u09be\u0987\u099f \u09b9\u09b2\u09c7 \u09b0\u09c7\u09aa \u09b9\u09ac\u09c7\u0987 \u098f\u0995\u099f\u09be \u09b9\u09be\u09b0\u09be\u09ae\u09c0 \u099b\u09be\u0997\u09c1 \u09ac\u09b2\u099b\u09c7 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09a6\u09c7\u09b6 \u09ad\u09be\u09b0\u09a4\u09c7 \u09b8\u09ac\u09a5\u09c7\u0995\u09c7 \u09ac\u09c7\u09b6\u09bf \u09b0\u09c7\u09aa \u09b9\u09df \u098f\u0995\u099f\u09be \u09ae\u09be\u09a5\u09be\u09ae\u09cb\u099f\u09be \u0997\u09b0\u09cd\u09a7\u09ad \u099b\u09be\u0997\u09c1 \u09ac\u09b2\u09c7\u099b\u09c7 \u0987\u09b8\u09b2\u09be\u09ae\u09bf\u0995 \u09b6\u09be\u09b8\u09a8\u09c7 \u09a7\u09b0\u09cd\u09b7\u09a3 \u098f\u0995\u09a6\u09ae \u09b9\u09df \u09a8\u09be \u09a4\u09be\u09a6\u09c7\u09b0 \u09af\u09c7\u0987 \u09aa\u09b0\u09bf\u09b8\u0999\u09cd\u0998\u0996\u09a8 \u09a6\u09bf\u09df\u09c7 \u09ac\u09cb\u099d\u09be\u09a8\u09cb \u09b9\u09b2 \u09aa\u09cd\u09b0\u09a4\u09bf \u09b9\u09be\u099c\u09be\u09b0\u09c7 \u09a6\u09c7\u0996\u09b2\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09ac\u09be \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09a5\u09c7\u0995\u09c7 \u0985\u09a8\u09c7\u0995 \u09ac\u09c7\u09b6\u09bf \u09b0\u09c7\u09aa \u09b9\u09df \u0986\u09b0 \u0987\u09b8\u09b2\u09be\u09ae\u09bf\u0995 \u09a6\u09c7\u09b6\u09c7 \u099a\u09be\u09b0\u099f\u09c7 \u09b8\u09cd\u09ac\u09be\u0995\u09cd\u09b7\u09bf\u09b0 \u0985\u09ad\u09be\u09ac\u09c7 \u0985\u09a8\u09c7\u0995 \u09ae\u09c7\u09df\u09c7 \u09b0\u09c7\u09aa\u09c7\u09b0 \u09b0\u09bf\u09aa\u09b0\u099f \u0995\u09b0\u09c7 \u09a8\u09be \u09a4\u09be\u099b\u09be\u09dc \u0987\u09b8\u09b2\u09be\u09ae\u09bf\u0995 \u09b6\u09be\u09b8\u09a8\u09c7 \u09a5\u09c7\u0995\u09c7\u0993 \u09b8\u0989\u09a6\u09bf\u09b0 \u09b6\u09c7\u0996\u09b0\u09be \u09ac\u09be\u0982\u09b2\u09df\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09a6\u09be\u09b8\u09c0\u09a6\u09c7\u09b0 \u09b0\u09c7\u09aa \u0995\u09b0\u099b\u09c7 \u09b8\u0999\u09cd\u0997\u09c7 \u09b8\u0999\u09cd\u0997\u09c7 \u09b8\u09ac \u0995\u099f\u09be \u09b6\u09c1\u09df\u09be\u09b0 \u09b8\u09c7\u0987 \u09aa\u09c7\u099c \u09a5\u09c7\u0995\u09c7 \u09aa\u09be\u09b2\u09be\u09b2\u09cb \u0995\u09c7\u09a8 \u09ac\u09b2\u09c1\u09a8 \u09a4\u09cb ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09b2\u09cb\u0995\u09c7\u09b0\u09be \u09ae\u09be\u09a8\u09c1\u09b7 \u09a8\u09be \u09b8\u09ac \u0995\u09c1\u0995\u09c1\u09b0 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u098f\u0997\u09c1\u09b2\u09cb \u09ad\u09c1\u09af\u09bc\u09be \u0996\u09ac\u09b0 \u09af\u09be\u09b0\u09be \u09aa\u09cd\u09b0\u09a4\u09bf\u09a6\u09bf\u09a8 \u09b9\u09c1\u09ae\u0995\u09bf \u09a7\u09ae\u0995\u09bf \u09a6\u09bf\u09af\u09bc\u09c7 \u09a5\u09be\u0995\u09c7 \u09a4\u09be\u09a6\u09c7\u09b0 \u0995\u09c7 \u098f\u09ae\u09a8 \u0985\u09ac\u09b8\u09cd\u09a4 \u0995\u09b0\u09ac\u09c7 \u0995\u09c7 \u0986\u09b0 \u09ae\u09c1\u09a4\u09cd\u09b0 \u0996\u09be\u0993\u09af\u09bc\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09be \u0986\u09b0\u09cb \u09a6\u09b6\u09ac\u09be\u09b0 \u099c\u09a8\u09cd\u09ae \u09a8\u09bf\u09af\u09bc\u09c7 \u0986\u09b8\u09bf\u09b2\u09c7\u0993 \u098f\u0987 \u09b0\u0995\u09ae \u09b9\u09be\u09ae\u09b2\u09be \u0995\u09b0\u09a4\u09c7 \u09aa\u09be\u09b0\u09ac\u09c7 \u09a8\u09be \u0987\u09a8\u09b6\u09be\u09b2\u09cd\u09b2\u09be\u09b9 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09a6\u09c7\u09b0 \u09ae\u09a4\u09cb \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09c7\u09b6 \u09a5\u09be\u0995\u09a4 \u09a4\u09be\u0987\u09b2\u09c7 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09a7\u09b0\u09b7\u09a8 \u0995\u09b0\u09a4\u09be\u09ae ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a6\u09c7\u09b2\u09cb\u09df\u09be\u09b0 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09a6\u09c7\u09b0 \u09aa\u09c7\u09b8\u09be\u09ac \u0996\u09c7\u09df\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8 \u09ac\u09c7\u099a\u09c7 \u0986\u099b\u09c7 \u09ac\u09a1\u09bc\u09cb \u0995\u09a5\u09be \u09ac\u09b2\u09bf\u09b8 \u0995\u09c7\u09a8 \u09b2\u099c\u09cd\u099c\u09be \u09b2\u09be\u0997\u09c7 \u09a8\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0986\u09b2\u09cd\u09b2\u09be\u09b9 \u098f\u0987 \u09b9\u09c1\u099c\u09c1\u09b0\u0995\u09c7 \u09b9\u09c7\u09a6\u09be\u09df\u09c7\u09a4 \u09a6\u09c7\u09a8 \u099b\u09be\u0997\u09b2 \u09b9\u09c1\u099c\u09c1\u09b0 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u0986\u09b0\u09c7 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u0997\u09cb \u0986\u09ac\u09be\u09b0 \u09ac\u09dc \u09ac\u09dc \u0995\u09a5\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09a6\u09c7\u09b0 \u0995\u09c7\u09a8 \u09aa\u09bf\u099f\u09be\u0987 \u09ac\u09c1\u099c\u09b8\u09a4\u09cb \u0986\u09b0\u09cb \u09aa\u09bf\u099f\u09be\u09ae\u09c1 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a2\u09be\u0995\u09be\u09df \u0985\u09ac\u09b8\u09cd\u09a5\u09be\u09a8 \u09b0\u09a4 \u09b8\u0995\u09b2 \u09ac\u09cc\u09a6\u09cd\u09a7 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09a6\u09c7\u09b0 \u09b9\u09a4\u09cd\u09af\u09be \u0995\u09b0\u09be\u09b0 \u0986\u09b9\u09ac\u09be\u09a8 \u099c\u09be\u09a8\u09bf\u09df\u09c7\u099b\u09c7\u09a8 \u09af\u09c1\u0995\u09cd\u09a4\u09b0\u09be\u099c\u09cd\u09af \u09aa\u09cd\u09b0\u09ac\u09be\u09b8\u09c0 \u09a8\u09c7\u09a4\u09c3\u09ac\u09c3\u09a8\u09cd\u09a6 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09b8\u09b9 \u09b8\u09ac \u0989\u09aa\u099c\u09be\u09a4\u09bf\u09b0 \u0989\u09aa\u09b0 \u09b9\u09be\u09ae\u09b2\u09be \u099a\u09be\u09b2\u09be\u09a8 \u09b9\u09cb\u0995 \u09a4\u09be\u09b9\u09b2\u09c7 \u09b0\u09cb\u09b9\u09bf\u0999\u09cd\u0997\u09be \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u09ac\u09cd\u09af\u09be\u09a5\u09be \u09a4\u09be\u09b0\u09be \u09ac\u09c1\u099c\u09ac\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u0986\u09b0 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u0995\u09a4\u09cb \u0995\u09cb\u099f\u09bf \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09a5\u09be\u0995\u09c7 \u09b8\u09c7\u0987 \u0995\u09a5\u09be \u09b2\u09bf\u0996\u09b2\u09c7\u09a8 \u09a8\u09be \u09af\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09b0\u09be \u09a6\u09c7\u0996 \u0986\u09b2\u09cd\u09b2\u09be\u09b9\u09b0 \u0997\u099c\u09ac \u0995\u09bf \u09ad\u09be\u09ac\u09c7 \u09b9\u09df", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a4\u09cb\u09ae\u09be\u09a6\u09c7\u09b0 \u09a7\u09b0\u09ae\u09c7 \u09b6\u09c1\u09a7\u09c1 \u09b2\u09c1\u099a\u09cd\u099a\u09be\u09ae\u09bf \u0986\u09b0 \u09b2\u09c1\u099a\u09cd\u099a\u09be\u09ae\u09bf \u09a4\u09cb\u09ae\u09be\u09a6\u09c7\u09b0 \u09a6\u09c7\u09ac\u09c0\u09b0\u09be \u09ac\u09bf\u09df\u09c7\u09b0 \u0986\u0997\u09c7 \u09b8\u09a8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u09ae\u09be \u09b9\u09df \u099b\u09bf ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0986\u09b0 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09b0\u09be \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u0995\u09bf\u099b\u09c1 \u09b9\u09b2\u09c7 \u09ac\u09dc \u09ac\u09dc \u0995\u09a5\u09be \u09ac\u09b2\u09c7", + "output": [ + "Religious" + ] + }, + { + "input": " \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09a6\u09c7\u09b0 \u09b6\u09bf\u0995\u09a1 \u0989\u09aa\u09a1\u09c7 \u09a6\u09bf\u09df\u09c7 \u09ad\u09be\u09b0\u09a4 \u09ae\u09bd\u09be \u09b8\u09be\u0997\u09b0\u09c7 \u09aa\u09c7\u09b2\u09c7 \u09a6\u09bf\u09a4\u09c7 \u09ac\u09b2\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a4\u09cb\u09ae\u09be\u09b0 \u099a\u09c7\u09b9\u09be\u09b0\u09be\u09b0 \u09a6\u09bf\u0995\u09c7 \u09a4\u09be\u0995\u09bf\u09df\u09c7 \u09a6\u09c7\u0996 \u09a4\u09cb\u09ae\u09be\u0995\u09c7 \u09ae\u09cb\u099f\u09c7\u0993 \u09ad\u09be\u09b2 \u09ae\u09be\u09a8\u09c1\u09b7 \u09ae\u09a8\u09c7\u09b9\u09df\u09a8\u09be \u09b6\u09df\u09c7\u09a4\u09be\u09a8\u09c7\u09b0 \u09ae\u09a4 \u09b2\u09be\u0997\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09aa\u09ac\u09bf\u09a4\u09cd\u09b0 \u0995\u09be\u09ac\u09be \u0998\u09b0\u09c7\u0995\u09c7 \u09a8\u09bf\u09df\u09c7 \u09af\u09c7\u0987 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09df \u09ac\u09c7\u0999\u09cd\u0997\u09cb \u0995\u09b0\u09b2\u09cb \u0993\u09b0 \u09ac\u09bf\u099a\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u0995\u09bf \u0995\u09b0\u09b2 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09b8\u09b0\u0995\u09be\u09b0 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09b9\u09bf\u099f\u09b2\u09be\u09b0 \u098f\u0995\u099c\u09a8 \u09b8\u09a4\u09cd\u09af\u09bf\u0995\u09be\u09b0\u09c7\u09b0 \u09b2\u09cb\u0995 \u09af\u09c7 \u0987\u09b9\u09c1\u09a6\u09c0 \u09b8\u09ac \u09b6\u09c7\u09b7 \u0995\u09b0\u09be\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf\u0997\u09cd\u0997\u09be \u0995\u09b0\u09c7", + "output": [ + "Religious" + ] + }, + { + "input": " \u09a4\u09cb\u09b0\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09b0\u09be \u09ac\u09b2\u099b\u09bf\u09b8 \u09af\u09c7 \u0985\u09be\u09ae\u09be\u09a6\u09c7\u09b0 \u09ae\u09be \u09ac\u09cb\u09a8\u09b0\u09be \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09c7\u09b0 \u099a\u09c1\u09a6\u09be\u09a8\u09bf \u0996\u09c7\u09df\u09c7\u099b\u09c7 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u0985\u09be\u09b8\u09b2 \u09ac\u09cd\u09af\u09be\u09aa\u09be\u09b0\u099f\u09be\u0987 \u09a4\u09cb \u09a4\u09cb\u09b0\u09be \u099c\u09be\u09a8\u09bf\u09b8 \u09a8\u09be \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u099a\u09c7\u09df\u09c7 \u09aa\u09be\u0995\u09bf\u09b8\u09cd\u09a4\u09be\u09a8\u09bf\u09a6\u09c7\u09b0 \u09ac\u09c7\u09b6\u09bf \u0995\u09cd\u09b7\u09cb\u09ad \u099b\u09bf\u09b2 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u09aa\u09cd\u09b0\u09a4\u09bf \u098f\u09b0 \u09b2\u09be\u0987\u0997\u09be\u0987 \u09a4\u09cb \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u09ac\u09be\u0981\u099a\u09be\u09a4\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0 \u09aa\u0995\u09cd\u09b7 \u09b9\u09a4\u09c7 \u09a4\u09cb\u09b0\u09be \u09af\u09c1\u09a6\u09cd\u09a7 \u0995\u09b0\u09c7\u099b\u09bf\u09b2\u09bf \u0985\u09be\u09b0 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09ae\u09be \u09a6\u09c7\u09b0 \u0985\u09a7\u09bf\u0995\u09be\u0982\u09b6 \u0995\u09cd\u09b7\u09c7\u09a4\u09cd\u09b0\u09c7\u0987 \u099a\u09c1\u09a6\u09be\u09a8\u09bf \u09a6\u09bf\u099b\u09c7 \u09aa\u09be\u0995\u09ac\u09be\u09b9\u09bf\u09a8\u09c0 \u09a4\u09cb\u09a6\u09c7\u09b0 \u0987\u09a8\u09cd\u09a7\u09bf\u09b0\u09be \u0997\u09be\u09a8\u09cd\u09a7\u09c0\u09b0\u09c7 \u09a4\u09cb \u0985\u09be\u09ae\u0997\u09cb \u09ac\u0999\u09cd\u0997\u09ac\u09a8\u09cd\u09a7\u09c1 \u099a\u09c1\u09a6\u09be\u09a8\u09bf \u09a6\u09bf\u099b\u09c7 \u09ab\u09bf\u09a6\u09c7\u09b2 \u0995\u09cd\u09af\u09be\u09b8\u09cd\u09a4\u09cd\u09b0\u09cb \u09a6\u09bf\u099b\u09c7 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09ad\u09be\u09b0\u09a4 \u098f\u09a4\u0987 \u0996\u09be\u09b0\u09be\u09aa \u09af\u09c7 \u099a\u09be\u0993\u09df\u09be\u09b2\u09be\u0995\u09c7\u0993 \u09aa\u09cd\u09b0\u09a7\u09be\u09a8\u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0 \u09ac\u09be\u09a8\u09be\u09df \u09b8\u09be\u09a8\u09bf \u09b2\u09bf\u0993\u09a8\u09c7\u09b0 \u09ae\u09a4\u09cb \u099a\u09c1\u09a6\u09be\u09a8\u09bf \u09ae\u09be\u09b2\u09c7\u09b0 \u099c\u09a8\u09cd\u09ae \u09b9 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0987\u09b8\u09b2\u09be\u09ae\u09c7 \u09ac\u09b0\u09cd\u09ac\u09b0\u09a4\u09be \u099a\u09be\u09b0\u09be \u0986\u09b0 \u0995\u09bf\u099b\u09c1\u0987 \u09a8\u09df ", + "output": [ + "Religious" + ] + }, + { + "input": " \u0986\u09b2\u09cd\u09b2\u09be\u09b9 \u0995\u0987\u099b\u09c7 \u09a4\u09cb\u09b0\u09be \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09b0\u09be \u0995\u09cb\u09a8 \u099a\u09bf\u09a8\u09cd\u09a4\u09be \u0995\u09b0\u09ac\u09bf \u09a8\u09be \u0997\u09b0\u09c1 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u0997\u09cb \u09ae\u09be \u0993\u09b0\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09b0\u09be \u0997\u09b0\u09c1 \u099b\u09cb\u099f \u09a5\u09c7\u0995\u09c7 \u0996\u09c1\u09ac \u09af\u09a4\u09cd\u09a8\u09b8\u09b9\u0995\u09be\u09b0\u09c7 \u09aa\u09be\u09b2\u09a8 \u0995\u0987\u09b0\u09be \u09ac\u09dc \u0995\u09b0\u09ac\u09c7 \u09ac\u09dc \u09b9\u0993\u09df\u09be\u09b0 \u09aa\u09b0 \u09a4\u09cb\u0997\u09cb \u0995\u09be\u099b\u09c7 \u09ac\u09bf\u0995\u09cd\u09b0\u09bf \u0995\u09b0\u09ac\u09c7 \u09a4\u09cb\u09b0\u09be \u099c\u09ac\u09be\u0987 \u0995\u0987\u09b0\u09be \u0996\u09be\u09ac\u09bf \u0985\u09b0\u09be \u0996\u09be\u09b2\u09bf \u09aa\u09be\u09b2\u09ac\u09c7 \u0986\u09b0 \u09a4\u09cb\u09b0\u09be \u0996\u09be\u09ac\u09bf \u0993\u09b0\u09be \u09aa\u09be\u09b2\u09ac\u09c7 \u0986\u09b0 \u09a4\u09cb\u09b0 \u0996\u09be\u09ac\u09bf \u098f\u0987 \u099c\u09a8\u09cd\u09af\u0987 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09b0\u09be \u0997\u09b0\u09c1\u09b0 \u0997\u09cb\u09b8 \u0996\u09be\u0987\u09a4\u09c7 \u09aa\u09b0\u09c7 \u09a8\u09be \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09b0\u09be \u098f\u09a4 \u0995\u09b7\u09cd\u099f \u0995\u0987\u09b0\u09be \u0997\u09b0\u09c1 \u09aa\u09be\u09b2\u09c7 \u0997\u09b0\u09c1 \u09ac\u09bf\u0995\u09cd\u09b0\u09bf \u0995\u09b0\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7 \u0997\u09cb\u09b8 \u0996\u09be\u09df \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09c7\u09b0\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7 \u0993\u09b0\u09be \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09b0\u09be \u0996\u09be\u0987\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 \u09a8\u09be \u0993\u0997\u09cb \u09b2\u0987\u0997\u09be \u099c\u09be\u09b9\u09c7\u09af \u09a8\u09be\u0987 \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u0997\u09b0\u09c1\u09b0 \u09ae\u09c1\u09a4 \u0996\u09be\u0993\u09df\u09be \u099c\u09be\u09b9\u09c7\u099c \u0986\u099b\u09c7 \u0986\u09b9 \u0995\u09bf \u09b6\u09be\u09a8\u09cd\u09a4\u09bf \u09b6\u09be\u09a8\u09cd\u09a4\u09bf ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a4\u09c1\u0987 \u09a4\u09cb \u099f\u09be\u0995\u09be\u09b0 \u0995\u09be\u099b\u09c7 \u09a4\u09cb\u09b0 \u09a7\u09b0\u09cd\u09ae \u09ac\u09bf\u0995\u09cd\u09b0\u09bf \u0995\u09b0\u099b \u09a4\u09c1\u0987 \u09a4\u09cb \u09ae\u09be\u09a8\u09c1\u09b7 \u09a8\u09be\u09ae\u09c7\u09b0 \u099c\u09be\u09a8\u09cb\u09df\u09be\u09b0 \u09b9\u09be\u09b0\u09c7 \u09a8\u09be\u09b8\u09cd\u09a4\u09bf\u0995 \u0986\u09b2\u09cd\u09b2\u09be\u09b0 \u0995\u09cd\u09b7\u09ae\u09be \u099a\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a8\u09be\u09b8\u09cd\u09a4\u09bf\u0995 \u0993\u09b0\u09be \u09b9\u09b2\u09cb \u09a6\u09c1\u09a8\u09bf\u09df\u09be\u09b0 \u09ae\u09df\u09b2\u09be \u0986\u09ac\u09b0\u09cd\u099c\u09a8\u09be \u0986\u09b0 \u09a8\u09b0\u09cd\u09a6\u09ae\u09be\u09b0 \u0995\u09c0\u099f \u09ad\u09a8\u09cd\u09a1 \u098f\u0995 \u09a8\u09be\u09ae\u09cd\u09ac\u09be\u09b0 \u09ae\u09bf\u09a5\u09cd\u09af\u09be\u09ac\u09be\u09a6\u09c0 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u098f\u0987 \u09b6\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u099a\u09cd\u099a\u09be\u09ac\u09b2\u09c7 \u0995\u09bf \u09b0\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u098f\u0987\u099f\u09be \u0995\u09c0 \u09a4\u09b0\u09ac\u09be\u09aa\u09c7\u09b0 \u09a6\u09c7\u09b6 \u09a8\u09be\u0995\u09c0 \u099c\u09be\u09ae\u09a8\u09c7\u099a\u09be\u09df \u09a4\u09be\u0995\u09b0\u09ac\u09bf \u09a4\u09a6\u09c7\u09b0\u09ae\u09a4 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09a6\u09c7\u09b0 \u0995\u09c1\u09a4\u09be\u09a6\u09bf\u09df\u09be \u099a\u09c1\u09a6\u09be \u09a6\u09b0\u0995\u09be\u09b0 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u098f\u09a4 \u0997\u09c1\u09b2\u09be\u09a8 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09ae\u0987\u09b0\u09be \u09b6\u09c7\u09b7 \u09a4\u09be\u09a4\u09c7 \u0995\u09cb\u09a8 \u09aa\u09cd\u09b0\u09a4\u09bf\u0995\u09cd\u09b0\u09bf\u09df\u09be \u09a8\u09c7\u0987 \u0985\u09a5\u099a \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09a6\u09c7\u09b0 \u099c\u09a8\u09cd\u09af\u0987 \u09a4\u09be\u09b0 \u09af\u09a4 \u09ac\u09cd\u09af\u09be\u09a5\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u09ae\u09be\u09a5\u09be \u0986\u09b0 \u0997\u09b0\u09c1\u09b0 \u09ae\u09be\u09a5\u09be\u09b0 \u09ae\u09a7\u09cd\u09af\u09c7 \u0996\u09c1\u09ac \u098f\u0995\u099f\u09be \u09aa\u09be\u09b0\u09cd\u09a5\u0995\u09cd\u09af \u09a8\u09c7\u0987", + "output": [ + "Religious" + ] + }, + { + "input": " \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0\u09be \u09a4\u09cb \u099a\u09cb\u09b0 \u098f\u0995\u09be\u09a4\u09c1\u09b0\u09c7\u09b0 \u09aa\u09b0 \u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6\u09b0 \u09b8\u09ac \u09ae\u09c1\u09b2\u09ac\u09be\u09a8 \u09b8\u09ae\u09cd\u09aa\u09a6 \u099a\u09c1\u09b0\u09bf \u0995\u09b0\u09c7\u099b\u09c7 \u09b0\u09be\u09a4\u09be\u09b0\u09be\u09a4\u09bf ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09be\u0989\u09a8 \u0995\u09be \u09ac\u09be\u099a\u09cd\u099a\u09be \u0995\u09cb\u09df\u09bf \u09a8\u09c7\u09b9\u09c0 \u0986\u099a\u09cd\u099a\u09be \u09af\u09cb \u09ad\u09c0 \u0986\u099a\u09cd\u099a\u09be \u0993 \u09ad\u09c0 \u09b6\u09c1\u09df\u09be\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be", + "output": [ + "Religious" + ] + }, + { + "input": "\u09b8\u09ae\u09b8\u09cd\u09a4 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 NRC \u098f\u09b0 \u09b8\u09ae\u09b0\u09cd\u09a5\u09a8\u09c7 \u099d\u09be\u09aa\u09bf\u09af\u09bc\u09c7 \u09aa\u09dc\u09c1\u09a8 \u0993\u0987 \u09a7\u0982\u09b6\u09cb \u0995\u09be\u09b0\u09bf \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09a6\u09c7\u09b0 \u09a4\u09be\u09dc\u09be\u09a4\u09c7\u0987 \u09b9\u09ac\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u0986\u09b0\u09c7 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u098f\u09b0 \u099c\u09be\u09a4 \u09a4\u09a6\u09c7\u09b0 \u0995\u09c7 \u09a6\u09bf\u09df\u09c7 \u09a4\u09a6\u09c7\u09b0 \u09ae\u09be\u09a4\u09be \u099c\u0982\u0997\u09bf \u09b9\u09be\u09b8\u09bf\u09a8\u09be \u099f\u09cd\u09b0\u09be\u09ae \u0996\u09c7\u09b2\u09a4\u09be\u099b\u09c7 \u0986\u09b0 \u09b8\u09c7\u0987 \u099f\u09cd\u09b0\u09be\u09ae\u09c7 \u0995\u09be\u099f \u09b9\u0987\u09b2\u09bf \u09a4\u09b0\u09be \u098f\u0996\u09a8 \u0993 \u0995\u09bf \u09a4\u09a6\u09c7\u09a4 \u09ac\u09c1\u099d\u09c7 \u0986\u09b8\u09c7\u09a8\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09a4\u09a6\u09c7\u09b0 \u0995\u09c7 \u09ac\u09b2\u09bf\u09b0 \u09aa\u09be\u09a0\u09be \u09ac\u09be\u09a8\u09be\u0987\u099b\u09c7 \u09a4\u09b0\u09be \u09b9\u0987\u09b2\u09bf \u09ac\u09b2\u09bf\u09b0 \u09aa\u09be\u09a0\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09a4\u09a6\u09c7\u09b0 \u098f\u0987 \u09aa\u09b0\u09bf\u09b8\u09cd\u09a5\u09bf\u09a4\u09bf\u09b0 \u0995\u09bf\u099b\u09c1 \u09ac\u09b0 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u099c\u09b0\u09bf\u09a4 \u09a4\u09a6\u09c7\u09b0 \u0995\u09c7 \u09a6\u09bf\u09df\u09c7 \u09ac\u09b0 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09b0\u09be \u09ab\u09df\u09a6\u09be \u09a4\u09c1\u09b2\u099b\u09c7 \u09ae\u09be\u099d \u0996\u09be\u09a8\u09c7 \u099b\u09cb\u099f \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09b0\u09be \u09b9\u0987\u09b2 \u09ac\u09b2\u09bf\u09b0 \u09aa\u09be\u09a0\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u098f\u0996\u09a8\u0987 \u0995\u09cb\u09a8 \u09ae\u09b8\u09c1\u09b2\u09ae\u09be\u09a8 \u09af\u09a6\u09bf \u098f\u0987 \u09b0\u09be\u09b8\u09cd\u09a4\u09be \u09a6\u09bf\u09df\u09c7 \u09af\u09be\u09df \u0986\u09ae\u09bf \u09ac\u09be\u09a7\u09cd\u09af \u09b9\u09ac \u0993\u0987 \u09ae\u09b8\u09c1\u09b2\u09ae\u09be\u09a8 \u0995\u09c7 \u09a6\u09bf\u09df\u09c7 \u0986\u09ae\u09be\u09b0 \u0997\u09c1\u09a6\u09c7\u09b0 \u099c\u09cd\u09ac\u09be\u09b2\u09be \u09ae\u09c7\u099f\u09be\u09a4\u09c7", + "output": [ + "Religious" + ] + }, + { + "input": " \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09a6\u09c7\u09b0 \u09ad\u09be\u09b2 \u0995\u09b0\u09c7 \u09b6\u09bf\u0995\u09cd\u09b7\u09be \u09a6\u09c7\u09df\u09be\u09b0 \u09a6\u09b0\u0995\u09be\u09b0 \u09b8\u09be\u09b2\u09be \u09ae\u09b2\u09c1\u09b0 \u099c\u09be\u09a4 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0997\u09b0\u09c1\u09b0 \u09ae\u09c1\u09a4\u09c7\u09b0 \u09aa\u09c1\u099c\u09be\u09b0\u09bf \u0989\u09b2\u0982\u0997 \u09a8\u09be\u09b0\u09c0\u09a6\u09c7\u09b0 \u09ae\u09c2\u09b0\u09cd\u09a4\u09bf\u09b0 \u09aa\u09c2\u099c\u09be\u09b0\u09bf", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09c7\u09b0 \u0995\u09bf\u099b\u09c1 \u09b9\u09b2\u09c7 \u09ac\u09c1\u09ac\u09c1 \u099c\u09be\u09a8 \u099a\u09c1\u09aa \u0986\u09b0 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u0995\u09bf\u099b\u09c1 \u09b9\u09b2\u09c7 \u09ac\u09c1\u09ac\u09c1 \u099a\u09cb\u0996\u09c7\u09b0 \u099c\u09b2\u09c7 \u09ad\u09be\u09b8\u09be\u09df \u09ac\u09c1\u0995 \u0986\u09ae\u09b0\u09be \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09b0\u09be \u0995\u09bf \u0995\u09b0\u09c7 \u098f\u0996\u09a8\u0993 \u09a5\u09c7\u09ae\u09c7 \u0986\u099b\u09bf \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u0988\u09ae\u09be\u09a8 \u0995\u09bf \u098f\u09a4\u09cb \u09a6\u09c1\u09b0\u09cd\u09ac\u09b2 \u09b9\u09df\u09c7 \u0997\u09c7\u099b\u09c7 \u0986\u09ac\u099b\u09cb\u09b8 \u09ae\u09a8\u09cd\u09a6\u09bf\u09b0 \u09ad\u09be\u0999\u09cd\u0997\u09be\u09b0 \u0998\u099f\u09a8\u09be \u09aa\u09cd\u09b0\u09a4\u09bf \u099f\u09be \u0996\u09ac\u09b0\u09c7\u09b0 \u0995\u09be\u0997\u099c\u09c7 \u099c\u09be\u09df\u0997\u09be \u09aa\u09be\u09df \u0995\u09bf\u09a8\u09cd\u09a4\u09c1 \u09ae\u09b8\u099c\u09bf\u09a6 \u09aa\u09c1\u09b0\u09c7 \u09a6\u09c7\u09df\u09be\u09b0 \u0998\u099f\u09a8\u09be \u0995\u09cb\u09a5\u09be\u0993 \u09a0\u09be\u0987 \u09aa\u09c7\u09b2 \u09a8\u09be \u098f\u09b0\u09be \u09a8\u09be\u09ae \u0995\u09bf \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09c7\u09b0 \u09a6\u09c7\u09b6 \u099b\u09bf\u0983", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a6\u09c2\u09b0\u09cd\u0997\u09be \u09ae\u09be\u09b0 \u0997\u09c1\u09a6\u09c7 \u09af\u0996\u09a8 \u0995\u09be\u09ae\u09dc \u0989\u09a0\u09a4\u09cb \u09a4\u0996\u09a8 \u09ac\u09cd\u09af\u09be\u09b8\u09be\u09b2\u09df\u09c7 \u0997\u09bf\u09df\u09c7 \u0995\u09be\u09ae\u09dc \u09ae\u09c7\u099f\u09be\u09a4\u09cb", + "output": [ + "Religious" + ] + }, + { + "input": "\u099b\u09be\u09df\u09c7\u09a6\u09c1\u09b2 \u09b9\u0995 \u09ac\u09b2\u09c7\u09a8 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09be \u09ac\u09bf\u09b7\u09df\u099f\u09bf \u09a8\u09bf\u09df\u09c7 \u09ac\u09be\u09dc\u09be\u09ac\u09be\u09dc\u09bf \u0995\u09b0\u099b\u09c7 \u0986\u09b0 \u098f \u0998\u099f\u09a8\u09be\u0995\u09c7 \u09ab\u09c1\u09b2\u09bf\u09df\u09c7 \u09ab\u09be\u0981\u09aa\u09bf\u09df\u09c7 \u09aa\u09cd\u09b0\u099a\u09be\u09b0 \u0995\u09b0\u09c7 \u0985\u09a4\u09bf\u09b0\u099e\u09cd\u099c\u09bf\u09a4 \u0995\u09b0\u09c7\u099b\u09c7 \u09b8\u09be\u0982\u09ac\u09be\u09a6\u09bf\u0995\u09b0\u09be \u0985\u09a5\u099a \u0998\u099f\u09a8\u09be \u0995\u09bf\u099b\u09c1\u0987 \u09a8\u09df ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09b0\u09c7 \u09a6\u09b0 \u0993\u09b0 \u09ae\u09be\u09a5\u09be \u0995\u09be\u09a0", + "output": [ + "Religious" + ] + }, + { + "input": "\u0987\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09b0 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09b0\u09be \u09b6\u09c1\u09a8 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u09ad\u09be\u09b2 \u09ac\u09cd\u09af\u09be\u09ac\u09b9\u09be\u09b0 \u0995\u09b0 \u09a8\u09be\u0987\u09b2\u09c7 \u0995\u09aa\u09be\u09b2\u09c7 \u09a6\u09c1\u0983\u0996 \u0986\u099b\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a4\u09c1\u09b0\u09be \u09a8\u09be\u09b8\u09cd\u09a4\u09bf\u0995\u09b0\u09be \u09ab\u09c7\u09b0\u09be\u0989\u09a8\u09c7\u09b0 \u0985\u09a8\u09c1\u09b8\u09be\u09b0\u09bf \u098f\u09ac\u0982 \u09ab\u09c7\u09b0\u09be\u0989\u09a8\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u099c\u09be\u09b9\u09be\u09a8\u09cd\u09a8\u09be\u09ae\u09c7\u09b0 \u0986\u0997\u09c1\u09a8\u09c7 \u099a\u09c1\u09dc\u09c7 \u09ab\u09c7\u09b2\u09be \u09b9\u09ac\u09c7 \u09b9\u09ac\u09c7 \u09a4\u09cb\u09a6\u09c7\u09b0 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ad\u09be\u09b0\u09a4\u09c0\u09df \u09ae\u09be\u09a6\u09be\u09b0 \u099a\u09c1\u09a6 \u0997\u09cb\u09b0\u09c7 \u0996\u09be\u09b2\u09bf \u09aa\u09c1\u099f\u0995\u09bf \u09ae\u09be\u09b0\u09be\u09b0 \u09a6\u09b0\u0995\u09be\u09b0 \u098f\u09a6\u09c7\u09b0\u0995\u09c7 \u0986\u09ac\u09be\u09b0 \u0995\u09bf\u09b8\u09c7\u09b0 \u09b8\u09be\u09b9\u09be\u09af\u09cd\u09af \u0995\u09b0\u099b\u09c7 \u09b8\u09b0\u0995\u09be\u09b0 \u09b8\u09b0\u0995\u09be\u09b0 \u0995\u09bf\u099b\u09c1 \u0996\u09be\u0987\u099b\u09c7 \u09a8\u09be\u0995\u09bf \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09b0\u09be \u09a6\u09c1\u09a8\u09bf\u09df\u09be\u09b0 \u09b8\u09ac\u099a\u09c7\u09df\u09c7 \u09a8\u09bf\u0995\u09c2\u09b7\u09cd\u099f \u099c\u09be\u09a4\u09bf", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09c1\u09b0\u09cd\u09a4\u09bf\u09aa\u09c1\u099c\u09be\u09b0\u09c0 \u09ae\u09be\u099c\u09be\u09b0\u09aa\u09c1\u099c\u09be\u09b0\u09c0 \u09ad\u09a8\u09cd\u09a1 \u09aa\u09c0\u09b0\u09a6\u09c7\u09b0 \u09aa\u09cb\u09a6 \u09ab\u09c7\u099f\u09c7 \u0997\u09c7\u099b\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09a8\u09be\u09ae\u09a6\u09be\u09b0\u09bf \u09ae\u09c1\u09a8\u09be\u09ab\u09c7\u0995\u09a6\u09c7\u09b0 \u09a6\u09b2\u09c7\u09b0\u09be \u0986\u09b0 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u0995\u09c1\u09b2\u09be\u0982\u0997\u09be\u09b0\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09be \u09a6\u09c7\u09b6\u09a8\u09c7\u09a4\u09b0\u09bf \u0996\u09be\u09b2\u09c7\u09a6\u09be \u099c\u09bf\u09af\u09bc\u09be\u09b0 \u09ac\u09bf\u09aa\u0996\u0996\u09c7 \u0995\u09a5\u09be \u09ac\u09b2\u09a4\u09c7\u099a\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0986\u09b0\u09c7 \u099c\u09be\u09a8\u09cb\u09df\u09be\u09b0 \u09a4\u09c1\u0987 \u0987\u09b8\u09b2\u09be\u09ae\u0995\u09c7 \u0998\u09c0\u09a8\u09be \u0995\u09b0\u09bf\u099b \u09a4\u09be \u09b9\u09b2\u09c7 \u09a4\u09cb\u09b0 \u09a8\u09be\u09ae\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7 \u0995\u09c7\u09a8 \u098f\u0996\u09a8 \u09aa\u09cb\u09b0\u099c\u09a8\u09a4 \u0987\u09b8\u09b2\u09be\u09ae \u09b2\u09be\u0997\u09be\u09a8\u09cb \u0986\u099b\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u098f\u0987 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09be \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09a6\u09be\u09b2\u09be\u09b2 \u09b8\u09be\u09b2\u09be\u09b0\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": " \u098f\u0987 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09b0\u09be \u0995\u09be\u09b6\u09cd\u09ae\u09c0\u09b0\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u098f\u09ac\u0982 \u09b9\u09be\u09df\u09a6\u09be\u09b0\u09be\u09ac\u09be\u09a6\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09b9\u09a4\u09cd\u09af\u09be \u0995\u09b0\u09c7\u099b\u09c7 \u098f\u099f\u09be \u09a4\u09be\u09b0\u09be \u09a8\u09bf\u099c\u09c7\u09a6\u09c7\u09b0 \u09ae\u09c1\u0996\u09c7\u0987 \u09b8\u09cd\u09ac\u09c0\u0995\u09be\u09b0 \u0995\u09b0\u09c7\u099b\u09c7 \u09a4\u09be\u09b9\u09b2\u09c7 \u09aa\u09cd\u09b0\u0995\u09c3\u09a4 \u09b8\u0982\u0996\u09cd\u09af\u09be \u09b9\u09ac\u09c7 \u09a4\u09be\u09b0 \u09a5\u09c7\u0995\u09c7 \u0985\u09a8\u09c7\u0995 \u0985\u09a8\u09c7\u0995 \u09ac\u09c7\u09b6\u09c0 \u0995\u09be\u09b6\u09cd\u09ae\u09c0\u09b0\u09c7\u09b0 \u099c\u09ae\u09cd\u09ae\u09c1 \u099b\u09bf\u09b2 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09b8\u0982\u0996\u09cd\u09af\u09be\u0997\u09b0\u09bf\u09b7\u09cd\u09a0 \u098f\u09b2\u09be\u0995\u09be \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u0989\u09aa\u09b0 \u0997\u09a8\u09b9\u09a4\u09cd\u09af\u09be \u099a\u09be\u09b2\u09bf\u09df\u09c7 \u09b8\u09c7\u099f\u09be \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09b8\u0982\u0996\u09cd\u09af\u09be\u0997\u09b0\u09bf\u09b7\u09cd\u09a0 \u098f\u09b2\u09be\u0995\u09be \u09ac\u09be\u09a8\u09bf\u09df\u09c7 \u09ab\u09c7\u09b2\u09c7\u099b\u09c7 \u0997\u09c1\u099c\u09b0\u09be\u099f\u09c7 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u0995\u09c7 \u09aa\u09c1\u09dc\u09bf\u09df\u09c7 \u09b9\u09a4\u09cd\u09af\u09be \u0995\u09b0\u09c7\u099b\u09c7 \u0997\u09c1\u099c\u09b0\u09be\u099f\u09c7\u09b0 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u0998\u09b0 \u09ac\u09be\u09dc\u09bf \u0986\u099c\u0993 \u09a4\u09be\u09a6\u09c7\u09b0 \u09a6\u0996\u09b2\u09c7 \u0997\u09c1\u099c\u09b0\u09be\u099f\u09c7\u09b0 \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u098f\u09ae\u09aa\u09bf\u0995\u09c7 \u09aa\u09b0\u09cd\u09af\u09a8\u09cd\u09a4 \u09a4\u09be\u09b0\u09be \u099c\u09ac\u09be\u0987 \u0995\u09b0\u09c7 \u09b9\u09a4\u09cd\u09af\u09be \u0995\u09b0\u09c7\u099b\u09c7 \u098f\u09a4 \u09ac\u09dc \u09b9\u09be\u09b0\u09be\u09ae\u099c\u09be\u09a6\u09be \u099c\u09be\u09a4\u09bf \u098f\u0987 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u099a\u09be \u0985\u09b0\u09c7 \u099c\u09c1\u09a4\u09be \u09ae\u09be\u09b0 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u098f\u099f\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09a6\u09c7\u09b0 \u0995\u09be\u09b0\u09b8\u09be\u099c\u09c0 \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09a6\u09c7\u09b0 \u09ab\u09be\u09b8\u09be\u09a8\u09cb\u09b0 \u099c\u09a8\u09cd\u09af ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ac\u09be\u0982\u09b2\u09be\u09a6\u09c7\u09b6 \u09a5\u09c7\u0995\u09c7 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u09a4\u09be\u09a1\u09bc\u09bf\u09af\u09bc\u09c7 \u09a6\u09c7\u0993\u09af\u09bc\u09be\u09b0 \u09aa\u09b0\u09bf\u09a3\u09be\u09ae \u098f\u099f\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0993\u09b0\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09a6\u09c7\u09b0 \u0996\u09c1\u09a6\u0995\u09c1\u09dc\u09cb \u0996\u09be\u0993\u09df\u09be \u09ae\u09c1\u0995\u09cd\u09a4 \u09ae\u09a8\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ad\u09a8\u09cd\u09a1 \u0995\u09be\u09a6\u09bf\u09df\u09be\u09a8\u09c0 \u09a5\u09c7\u0995\u09c7 \u09b8\u09be\u09ac\u09a7\u09be\u09a8", + "output": [ + "Religious" + ] + }, + { + "input": " \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae \u09ad\u09be\u0987\u09b0\u09be \u099a\u09be\u09b2\u09bf\u09df\u09c7 \u09af\u09be\u09a8 \u09a6\u09bf\u09a8\u09a4\u09cb \u098f\u0996\u09a8 \u0986\u09aa\u09a8\u09be\u09a6\u09c7\u09b0 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09ac\u09b2\u09c7 \u0997\u09be\u09b2\u09bf \u09a6\u09bf\u09ac\u09c7\u09a8 \u09ae\u09c1\u09b0\u09cd\u09a4\u09bf \u09ad\u09be\u0999\u09ac\u09c7\u09a8 \u09ae\u09a8\u09cd\u09a6\u09bf\u09b0 \u09ad\u09be\u0982\u09ac\u09c7\u09a8 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1\u09a6\u09c7\u09b0 \u09ac\u09be\u09b0\u09bf\u09a4\u09c7 \u0986\u0997\u09c1\u09a8 \u09a6\u09bf\u09ac\u09c7\u09a8 \u09b2\u09c1\u099f \u0995\u09b0\u09ac\u09c7\u09a8 \u09b8\u09be\u09b0\u09bf\u09b0\u09bf\u0995 \u09ad\u09be\u09ac\u09c7 \u09a8\u09bf\u09b0\u09cd\u099c\u09be\u09a4\u09a8 \u0995\u09b0\u09ac\u09c7\u09a8 \u0986\u09b0 \u0995\u09bf \u09ac\u09be\u0995\u09bf \u0986\u099b\u09c7 \u09b8\u09c7\u099f\u09be \u09a5\u09be\u0995\u09b2\u09c7 \u0995\u09b0\u09c7 \u09ab\u09c7\u09b2\u09c7\u09a8 \u0995\u09be\u09b0\u09a8 \u09a6\u09c7\u09b6\u099f\u09be \u0986\u09aa\u09a8\u09be\u09a6\u09c7\u09b0 \u098f\u0995\u099c\u09a8 \u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0 \u09b9\u09df\u09c7 \u09aa\u09c1\u09b0\u09be \u099c\u09be\u09a4\u09bf\u0995\u09c7 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09ac\u09b2\u09c7 \u0997\u09be\u09b2\u09bf \u09a6\u09bf\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 \u0986\u09b0 \u09a6\u09bf\u09a8\u09c7\u09b0 \u09ae\u09a4\u09cb \u0989\u099c\u09cd\u099c\u09cd\u09ac\u09b2 \u09b8\u09a4\u09cd\u09a4\u099f\u09be\u0995\u09c7 \u09ae\u09bf\u09a4\u09cd\u09a5\u09c7 \u09ac\u09b2\u09a4\u09c7 \u09aa\u09be\u09b0\u09c7 \u09a4\u0996\u09a8 \u098f\u099f\u09be\u0987 \u09aa\u09cd\u09b0\u09ae\u09be\u09a8 \u0995\u09b0\u09c7 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09b8\u09b0\u0995\u09be\u09b0 \u0986\u09aa\u09a8\u09be\u09a6\u09c7\u09b0 \u09b8\u09be\u09a5\u09c7\u0987 \u0986\u099b\u09c7 \u09b8\u09be\u09a5\u09c7 \u0986\u099b\u09c7 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u09ae\u09be\u09a8\u09a8\u09bf\u09df \u09aa\u09cd\u09b0\u09a7\u09be\u09a8 \u09ae\u09a8\u09cd\u09a4\u09cd\u09b0\u09c0\u0993 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ac\u09cd\u09af\u09b6\u09cd\u09af\u09be\u09b8\u09cd\u09af\u09be\u09b2\u09df\u09c7\u09b0 \u09ae\u09be\u099f\u09bf \u099b\u09be\u09dc\u09be \u09a6\u09c2\u09b0\u09cd\u0997\u09be \u09ae\u09c2\u09b0\u09cd\u09a4\u09bf \u0997\u09dc\u09be \u09b9\u09ac\u09c7\u0987 \u09a8\u09be", + "output": [ + "Religious" + ] + }, + { + "input": " \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u09aa\u09be\u09a1\u09be \u0986\u09b0 \u09a6\u09be\u09ae\u09dc\u09be \u09ad\u09bf\u0996\u09be\u09b0\u09bf\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09be \u098f\u0996\u09be\u09a8\u09c7 \u09ad\u09bf\u0995\u09cd\u09b7\u09be \u099a\u09be\u0987\u09a4\u09c7 \u0986\u09b8\u099b\u09c7 \u098f\u0987 \u09ad\u09bf\u0996\u09be\u09b0\u09bf\u09b0\u09be \u09ad\u09bf\u0995\u09cd\u09b7\u09be \u09a8\u09be \u09aa\u09be\u0987\u09b2\u09c7 \u098f\u0996\u09be\u09a8\u09c7 \u098f\u09b0\u0995\u09ae \u09ac\u09b2\u09a6\u09c7\u09b0 \u09ae\u09a4 \u09b2\u09be\u09ab\u09be\u09b2\u09be\u09ab\u09bf \u0995\u09b0\u09ac\u09c7 \u09ad\u09be\u09b0\u09a4\u09c7\u09b0 \u098f\u0987 \u09ad\u09bf\u0996\u09be\u09b0\u09bf\u0997\u09c1\u09b2\u09cb\u0995\u09c7 \u09a6\u09c1\u0987 \u099f\u09be\u0995\u09be \u09ad\u09bf\u0995\u09cd\u09b7\u09be \u09a6\u09c7\u0993\u09df\u09be \u09b9\u09cb\u0995 \u0997\u09cb \u09ae\u09c2\u09a4\u09cd\u09b0 \u0996\u09be\u0993\u09df\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09ac\u09b8\u09cd\u09a4\u09bf\u09b0 \u09a6\u09c7\u09b6\u09c7 \u0995\u09bf\u099b\u09c1 \u09aa\u09be\u09df \u09a8\u09be \u09a4\u09be\u0987 \u0986\u09ae\u09be\u09a6\u09c7\u09b0 \u0995\u09be\u099b\u09c7 \u09b9\u09be\u09a4 \u09aa\u09c7\u09a4\u09c7 \u099f\u09be\u0995\u09be \u09a8\u09bf\u09a4\u09c7 \u0986\u09b8\u099b\u09c7 \u09b0\u09c7\u09a8\u09cd\u09a1\u09bf\u09df\u09be\u09b0 \u09ad\u09bf\u0996\u09be\u09b0\u09bf\u09b0\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0986\u099a\u09cd\u099b\u09be \u098f\u0987 72 \u09b9\u09c1\u09b0\u09c7\u09b0\u09be \u0995\u09bf \u09ac\u09c7\u09b6\u09cd\u09af\u09be\u09ac\u09c3\u09a4\u09cd\u09a4\u09bf \u0995\u09b0\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a6\u09c1\u09b0 \u09b8\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u09df\u09c1\u09a8 \u09aa\u09be\u0997\u09b2 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09b0\u09cd\u09ae\u09c2\u0996 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09a6\u09c7\u09b0 \u0990 \u0995\u09cd\u09b2\u09be\u09ac\u09c7 \u09a0\u09c1\u0995\u09b2\u09c7 \u0997\u09b2\u09be \u09a0\u09be\u0995\u09cd\u0995\u09be \u09a6\u09bf\u09df\u09c7 \u09ac\u09c7\u09b0 \u0995\u09b0\u09c7 \u09a6\u09bf\u09a4\u09c7 \u09b9\u09ac\u09c7 \u0995\u09be\u09b0\u09a8 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09b0\u09be \u099f\u09df\u09b2\u09c7\u099f \u0995\u09b0\u09c7 \u09aa\u09be\u09a8\u09bf \u09ac\u09cd\u09af\u09ac\u09b9\u09be\u09b0 \u0995\u09b0\u09c7\u09a8 \u0993\u09a6\u09c7\u09b0 \u0997\u09be\u09df\u09c7\u09b0 \u09a5\u09c7\u0995\u09c7 \u0997\u09a8\u09cd\u09a7 \u0986\u09b8\u09c7 \u09b9\u09be\u09b9\u09be\u09b9\u09be \u09b9\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a4\u09cb\u09a6\u09c7\u09b0 \u09ae\u09a4 \u09a8\u09be\u09b8\u09cd\u09a4\u09bf\u0995\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0 \u099c\u09a8\u09cd\u09af \u09ae\u09c1\u09b8\u09b2\u09ae\u09be\u09a8\u09a6\u09c7\u09b0 \u0986\u099c\u0995\u09c7\u09b0 \u09ac\u09a6\u09a8\u09be\u09ae ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0986\u0997\u09c7 \u09a8\u09be\u09ae \u09ac\u09a6\u09b2\u09be\u09df\u09be \u098f\u0995\u099f\u09be \u09a8\u09be\u09b8\u09cd\u09a4\u09bf\u0995 \u09a8\u09be\u09ae \u09b0\u09be\u0996 \u09a4\u09cb\u09b0 \u09ac\u09be\u09ac\u09be \u09ae\u09be\u09b0 \u0995\u09aa\u09be\u09b2 \u0996\u09be\u09b0\u09be\u09aa \u09a4\u09cb\u09b0 \u09ae\u09a4\u09a8 \u09b6\u09c1\u09df\u09cb\u09b0\u09c7\u09b0 \u099c\u09a8\u09cd\u09ae \u09a6\u09bf\u09b8\u09c7 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0986\u09b2\u09cd\u09b2\u09be\u09b9 \u09a4\u09cb \u0998\u09b0\u09c7 \u0998\u09b0\u09c7 \u099a\u09c1\u09a6\u09be\u09a8\u09cb\u09b0 \u0995\u09a5\u09be \u09ac\u09b2\u09c7\u099b\u09c7 \u09a8\u09ac\u09c0 \u09a4\u09cb \u09ac\u09dc\u09cb \u09ae\u09be\u09a6\u09be\u09b0\u099a\u09cb\u09a6 \u0986\u09b2\u09cd\u09b2\u09be \u099a\u09c1\u09a6\u09bf\u09b0\u09be \u09a4\u09cb\u09b0\u09be \u09a4\u09cb \u09a8\u09c0\u099c\u09c7\u09b0 \u09ac\u09cb\u09a8\u09b0\u09c7 \u099a\u09c1\u09a6\u09bf\u09b8 ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09c1\u09b9\u09ae\u09cd\u09ae\u09a6 \u09af\u0996\u09a8 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09ae\u09c7\u09df\u09c7 \u0986\u09df\u09c7\u09b6\u09be\u0995\u09c7 \u09ac\u09bf\u099b\u09be\u09a8\u09be\u09df \u09a8\u09bf\u09df\u09c7 \u09af\u09be\u09df (\u098f\u099f\u09be\u0995\u09c7 \u0986\u09ae\u09bf \u09ac\u09bf\u09df\u09c7 \u09ac\u09b2\u09ac\u09cb \u09a8\u09be) \u09b8\u09c7\u099f\u09be \u09b2\u09c1\u099a\u09cd\u099a\u09be\u09ae\u09bf \u09b8\u09c7\u099f\u09be \u09b6\u09bf\u09b6\u09c1\u0995\u09be\u09ae\u09bf\u09a4\u09be \u09b8\u09c7\u099f\u09be \u09a7\u09b0\u09cd\u09b7\u09a3 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09ae\u09be\u09a8\u09c7 \u099c\u09be\u09b0\u099c \u09a8\u09be \u0995\u09bf\u099b\u09c1 \u0995\u09bf\u099b\u09c1 \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u0986\u099b\u09c7 \u099c\u09be\u09b0\u099c \u098f\u09b0 \u09a5\u09c7\u0995\u09c7\u0993 \u09ac\u09c7\u09b6\u09bf ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09a6\u09c7\u09b6\u09c7\u09b0 \u09ae\u09be\u09a8\u09c1\u09b7 \u0995\u09bf \u098f\u09a4\u0987 \u09ae\u09c2\u09b0\u09cd\u0996 \u09af\u09c7\u0996\u09be\u09a8\u09c7 \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09be\u0986\u09ae\u09b0\u09be \u09b8\u09be\u09b0\u09be\u0995\u09cd\u09b7\u09a8 \u09a8\u09bf\u099c\u09c7\u09a6\u09c7\u09b0 \u09a8\u09bf\u09b0\u09be\u09aa\u09a4\u09cd\u09a4\u09be \u09a8\u09bf\u09df\u09c7 \u09b8\u0982\u09b6\u09df \u09b8\u09c7\u0996\u09be\u09a8\u09c7 \u0995\u09bf\u09ad\u09be\u09ac\u09c7 \u09b6\u09bf\u09ae\u09c1\u09b2 \u0997\u09be\u099b\u09c7 \u0997\u09be \u099a\u09c1\u09b2\u0995\u09be\u09a4\u09c7 \u09af\u09be\u0987 \u09af\u09c7\u0996\u09be\u09a8\u09c7 \u0997\u09be \u09a5\u09c7\u0995\u09c7 \u09b0\u0995\u09cd\u09a4 \u09ac\u09c7\u09b0 \u09b9\u0993\u09df\u09be\u09b0 \u09b8\u09ae\u09cd\u09ad\u09be\u09ac\u09a8\u09be \u09a5\u09be\u0995\u09c7 \u09a8\u09be \u098f\u099f\u09be \u09ad\u09a8\u09cd\u09a1\u09ac\u09be\u09a6\u09c0 \u0990 \u09a7\u09b0\u09cd\u09ae\u09ad\u09bf\u09b0\u09c1\u09a6\u09c7\u09b0 \u099a\u0995\u09cd\u09b0\u09be\u09a8\u09cd\u09a4 \u099b\u09be\u09dc\u09be \u0986\u09b0 \u0995\u09bf\u099b\u09c1\u0987 \u09a8\u09df ", + "output": [ + "Religious" + ] + }, + { + "input": " \u0993\u0987 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u0995\u09c1\u09a4\u09cd\u09a4\u09be\u09b0 \u09ac\u099a\u09cd\u099a\u09be\u09b0\u09be \u0995\u09a5\u09be \u09b8\u09be\u09ac\u09a7\u09be\u09a8\u09c7 \u09ac\u09b2 ", + "output": [ + "Religious" + ] + }, + { + "input": " \u09b8\u09be\u09b2\u09be \u09a4\u09c1\u0987 \u09ae\u09be\u09b2\u09be\u0989\u09a8 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09b9\u09be\u09a4\u09a5\u09c7\u0995\u09c7 \u09ac\u09be\u0982\u09b2\u09be\u0995\u09c7 \u09aa\u09c1\u09a8\u09b0\u09c1\u09a6\u09cd\u09a7\u09be\u09b0 \u09a8\u09be\u0995\u09b0\u09be \u09aa\u09b0\u09cd\u09af\u09a8\u09cd\u09a4 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09ac\u09be\u09dc\u09be\u09ac\u09be\u09dc\u09bf \u0995\u09ae\u09ac\u09c7\u0993 \u09a8\u09be \u09b9\u09bf\u09a8\u09cd\u09a6\u09c1 \u09a8\u09bf\u09b0\u09cd\u09af\u09be\u09a4\u09a8\u0993 \u09ac\u09a8\u09cd\u09a7 \u09b9\u09ac\u09c7\u09a8\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be \u09a4\u09cb\u09a6\u09c7\u09b0 \u0989\u09aa\u09b0 \u0986\u09b2\u09cd\u09b2\u09be\u09b9\u09b0 \u09b2\u09be\u09a8\u09a4 \u09a4\u09be\u0987 \u09a4\u09cb\u09a6\u09c7\u09b0 \u0995\u09aa\u09be\u09b2\u09c7 \u0997\u09b0\u09c1\u09b0 \u09ae\u09be\u0982\u09b8 \u09a8\u09be\u0987 \u0986\u09b2\u09cd\u09b2\u09be\u09b9 \u09a4\u09cb\u09a6\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u09b0\u09c7\u0996\u09c7\u099b\u09c7\u09a8 \u09b6\u09c1\u09a7\u09c1 \u0997\u09b0\u09c1\u09b0 \u09ae\u09c1\u098f \u09a4\u09be\u0987 \u09b6\u09c1\u09a7\u09c1 \u09ae\u09c1\u098f \u09aa\u09be\u09a8 \u0995\u09b0 \u0986\u09b0 \u099a\u09c1\u09aa \u09a5\u09be\u0995", + "output": [ + "Religious" + ] + }, + { + "input": "\u09a4\u09b8\u09b2\u09bf\u09ae\u09be \u09a8\u09be\u09b8\u09b0\u09bf\u09a8\u09c7\u09b0 \u09ae\u09a4 \u09a4\u09c1\u09ae\u09bf \u0993 \u099f\u09be\u0995\u09be \u09aa\u09be\u0993 \u0995\u09be\u09ab\u09c7\u09b0", + "output": [ + "Religious" + ] + }, + { + "input": " \u09a4\u09cb\u09a6\u09c7\u09b0 \u099c\u09a8\u09cd\u09af \u099a\u09bf\u09a8 \u09ac\u09be\u0981\u09b6 \u09b0\u09c7\u09a1\u09bf \u0995\u09b0\u09a4\u09be\u099b\u09c7 \u09b8\u09ae\u09df \u09ae\u09a4 \u09a4\u09cb\u09a6\u09c7\u09b0 \u09aa\u09c1\u099f\u0995\u09bf\u09b0 \u09ad\u09bf\u09a4\u09b0 \u09a2\u09cb\u0995\u09bf\u09df\u09c7 \u09a6\u09bf\u09ac\u09c7 \u09b6\u09be\u09b2\u09be \u09ae\u09be\u09b2\u09be\u0989\u09a8\u09c7\u09b0 \u09ac\u09be\u099a\u09cd\u099a\u09be\u09b0\u09be ", + "output": [ + "Religious" + ] + }, + { + "input": "\u0995\u09cb\u099f\u09bf \u09ae\u09c1\u09b8\u09b2\u09bf\u09ae\u09a6\u09c7\u09b0 \u09ac\u09be\u09b8 \u09ad\u09be\u09b0\u09a4\u09c7 \u0986\u09ac\u09be\u09b2\u09b0\u09be \u09a4\u09be\u09b0\u09be \u0995\u09bf \u09ae\u09be\u09b2\u09be\u0989\u09a8", + "output": [ + "Religious" + ] + } + ] +}