Skip to content

Latest commit

 

History

History
88 lines (62 loc) · 3.78 KB

fasta_fastq.md

File metadata and controls

88 lines (62 loc) · 3.78 KB

Session 3 cont.: FASTA and FASTQ files

Class Materials

You can follow the class materials below.

1. Session 3.2: Genomic Resources

Session 3.2

Slides: Fasta/Fastq file formats

FASTA files

Now you learned the location of the genomes in the cluster, find a fasta file for the mouse reference (mm10)

$ ls -l /share/data/umw_biocore/genome_data/mouse/mm10/*.fa
-rwxr-xr-x 1 gxy11w umw_manuel_garber 2785490220 Apr 29  2014 /share/data/umw_biocore/genome_data/mouse/mm10/mm10.fa
-rwxr-xr-x 1 gxy11w umw_manuel_garber   99845877 Aug  2  2019 /share/data/umw_biocore/genome_data/mouse/mm10/rsem_ref.idx.fa
-rw-r--r-- 1 gxy11w umw_manuel_garber   95664752 Jul 10  2019 /share/data/umw_biocore/genome_data/mouse/mm10/rsem_ref.n2g.idx.fa
-rwxr-xr-x 1 gxy11w umw_manuel_garber   99845877 Aug  2  2019 /share/data/umw_biocore/genome_data/mouse/mm10/rsem_ref.transcripts.fa

Now look at the first 10 lines of the mouse mm10.fa file using head

$ head /share/data/umw_biocore/genome_data/mouse/mm10/mm10.fa

And the last 10 lines of the same file using tail

$ tail /share/data/umw_biocore/genome_data/mouse/mm10/mm10.fa

Looking at the output, notice two more details about FASTA files:

  • They can contain the N character in nucleotide sequences, not just A/C/T/G. Usually this is used to represent gaps and unknown sequences in the genome assembly, for example telomeres and centromeres.
  • Sometimes the sequence will be encoded as lowercase actg in place of the standard ACTG notation, for most uses this will not make a difference, but some programs can interpret these as different information, and it is commonly used to note the regions of the genome with repetitive elements so that they can be easily masked if that is desired.

FASTQ files

During the homework exercise in Session 1: Linux environment, you made a copy of several fastq files to your home directory:

$ ls -l ~/bootcamp/RNA-Seq/reads/
total 32946
-rwxr-x--- 1 ed70w umw_manuel_garber 3233830 Apr 15 15:45 control_rep1.1.fq
-rwxr-x--- 1 ed70w umw_manuel_garber 3233830 Apr 15 15:45 control_rep1.2.fq
-rwxr-x--- 1 ed70w umw_manuel_garber 2112249 Apr 15 15:45 control_rep2.1.fq
-rwxr-x--- 1 ed70w umw_manuel_garber 2112249 Apr 15 15:45 control_rep2.2.fq
-rwxr-x--- 1 ed70w umw_manuel_garber 2283880 Apr 15 15:45 control_rep3.1.fq
-rwxr-x--- 1 ed70w umw_manuel_garber 2283880 Apr 15 15:45 control_rep3.2.fq
-rwxr-x--- 1 ed70w umw_manuel_garber 2356860 Apr 15 15:45 exper_rep1.1.fq
-rwxr-x--- 1 ed70w umw_manuel_garber 2356860 Apr 15 15:45 exper_rep1.2.fq
-rwxr-x--- 1 ed70w umw_manuel_garber 2807338 Apr 15 15:45 exper_rep2.1.fq
-rwxr-x--- 1 ed70w umw_manuel_garber 2807338 Apr 15 15:45 exper_rep2.2.fq
-rwxr-x--- 1 ed70w umw_manuel_garber 1251985 Apr 15 15:45 exper_rep3.1.fq
-rwxr-x--- 1 ed70w umw_manuel_garber 1251985 Apr 15 15:45 exper_rep3.2.fq

Exercise

  • Take a look at the first and last 8 lines in one of these files

  • Count how many reads are in the file exper_rep1.2.fq. Since there are 4 lines per read in this fastq, you can divide the result of the number of lines by 4 using awk to get the correct number:

    $ wc -l exper_rep1.2.fq | awk '{print $0/4}'
    

Homework

During Session 2 Extra: Useful commands and tools you became familiar with the command grep, but it has extra power when used with certain arguments:

$ grep --help
  • What is the nucleotide sequence of the read named HWI-ST333_0273_FC:8:1212:9473:35651#CTGGGC/1 in the file exper_rep2.1.fq

Expected result:

AAAGCGGTCAACTGGAAACTAAATGGAGCAGCAGCTCCTC